A Novel Protein Elicitor (PELL1) Extracted from Lecanicillium lecanii Induced Resistance against Bemisia tabaci (Hemiptera: Aleyrodidae) in Gossypium hirsutum L.

Protein elicitors play a key role in signaling or displaying plant defense mechanism and emerging as vital tools for biocontrol of insects. This study was aimed at the characterization of the novel protein elicitor isolated from entomopathogenic fungi Lecanicillium lecanii (V3) strain and its activity against whitefly, Bemisia tabaci, in cotton (Gossypium hirsutum L.). The sequence of purified elicitor protein showed 100% similarity with hypothetical protein LEL_00878 (Cordyceps confragosa RCEF 1005) (GenBank accession no. OAA81333.1). This novel protein elicitor has 253 amino acid residues and 762 bp with a molecular mass of 29 kDa. Their combatant protein was expressed in Escherichia coli using pET-28a (+) plasmid. Bioassay was revealed to quantify the impact of numerous concentrations of protein (i.e., 58.32, 41.22, and 35.41 μg/ml) on the fecundity rate of B tabaci on cotton plants. Bioassay results exhibited a significant effect (P ≤ 0.001) of all the concentrations of protein on the fecundity rate of B. tabaci. In addition, the gene expression analysis found a significant upregulation of the major genes associated with salicylic acid (SA) and jasmonic acid (JA) defense pathways in elicitor protein-treated plants. Our results showed that the potential application of novel protein elicitor derived from Lecanicillium lecanii will be used as future biointensive controlling approaches against whitefly, Bemisia tabaci.

1. Introduction

The application of fungal elicitors has been described as among the most successful methods for increasing the production of secondary metabolites in plant cell culture [1, 2] and also reported that it is the best effective method for the improvement of hairy roots [3, 4]. Fungal elicitors involve metabolites and degradation products [5]. The elicitor molecules include lipids, glycoproteins, and proteins causing resistance against pathogens and herbivores in plants [6-8]. Fungal-derived proteins can induce hypersensitivity responses (HR) and trigger secondary metabolite accumulation. For instance, PebC1 protein elicitor isolated from Botrytis cinerea enhances disease resistance in Arabidopsis thaliana, causes disease resistance and drought tolerance, and improves plant growth in tomato plants [9]. A fungal elicitor protein (SsCut) extracted from Sclerotinia sclerotiorum causes numerous defense responses in the crop. A novel protein elicitor (PevD1) causes resistance of Verticillium wilt in cotton plants [10].

Several microbes including entomopathogenic fungi (EPF) have shown effectiveness against a broad range of insect pest [11, 12]. Furthermore, EPF has the capability to produce endophytes within various parts of plants [13, 14]. EPF develop systemic resistance against biotic stresses in several plants including pathogens and phytoparasites, improve plant growth [15], enhance yield [16] improving plant nutrition [17], and increase plant root growth [18, 19]. Several EPF have been described in broth cultures to secrete various insecticidal, antifeedant, and bioactive toxic substances [20].

Salicylic acid and jasmonic acid are two important signaling pathways involving plant defense mechanisms [21, 22]. Accumulative defense signaling pathways are activated in response to a herbivorous attack, but the jasmonate reaction is mainly related to chewing herbivorous [23], and salicylate responses are linked with phloem-sucking insect pests such as aphids and whiteflies [24, 25]. Our study is aimed at the purification and characterizations of the novel protein elicitor extracted from entomopathogenic fungi Lecanicillium lecanii (V3) strain and its potential bioactivity against whitefly, B. tabaci, in cotton. This result will help to provide a potential a new approach for B. tabaci control.

2. Materials and Methods

2.1. Insect Rearing

Adults of whitefly (Bemisia tabaci) were collected from Langfang Research Station, Institute of Plant Protection (IPP), Chinese Academy of Agricultural Sciences (CAAS), Beijing, China. Whitefly adults were reared in a controlled greenhouse at 26 ± 2°C 65% RH on cotton plants for the proper growth.

2.2. Fungus Growth

Lecanicillium lecanii (V3) strain was obtained from the Key Laboratory of Biopesticides Engineering, Department of Biopesticides and Biocontrol (IPP) (CAAS), and kept on PDA (potatoes dextrose agar) in a Petri plate for 15 days at 25°C. Conidia were harvested at 16 days. The petri dishes were flashed with 20 ml sterile water and filtered by using sterile cheesecloth. Spore concentrations were determined under a microscope by using a hemocytometer.

2.3. Protein Isolation

V3 strain was grown in 1 l of LB medium shaken at 150 rpm [26]. The cultured media was filtered through 0.45 μM of Whatman filter paper. The fungal filtrate was precipitated with 80% ammonium sulfate (NH)4SO4 overnight at 4°C, centrifuged at 12000 rpm, for 30 min at 4°C. The pellet was collected and resuspended in 30 ml with buffer A (50 mM Tris-HCl, pH = 8.0). Total protein was filtered through a 0.22 μm-membrane filter paper (Chen et al. 2012). Protein fragments were further purified using AKTA protein purification system, used an ion-exchange chromatography column, loading with buffer (A) (50 mM Tris-HCl, pH =8.0), eluted with buffer (B) (50 mM Tris-HCl, 1 mM NaCl, pH = 8.0). The eluted peak was collected and centrifuged (3500 rpm for 30 min at 4°C) by using desalting column. The isolated protein was detected by SDS-PAGE. Protein concentrations were evaluated by Easy II Protein Quantitative Kit (BCA) method.

2.4. Amino Acid Sequencing

Liquid chromatography-mass spectrometry analysis of digested proteins in gel was performed to assess the protein sequence of amino acids. The protein was analyzed by ESI-MS/MS, and de novo quenching was evaluated. The purified protein was blast on the NCBI database, and the result showed 100% similarity with hypothetical protein LEL_00878 (Cordyceps contraposed RCEF 1005) (GenBank accession no. OAA81333.1). The sequence of this gene was used to design primers.

2.5. Gene Amplification

DNA was extracted by using the fungal DNA kit. According to the results from BLAST searches in the NCBI databases, a pair of primers was designed: F. primer (ATGGCAGGCGGCTCCTAC), R. primer (TCACAAACGAGCTGGTAAATGAAAC). The elicitor-encoding gene was amplified from Verticillium lecanii. The amplified gene was used for cloning.

2.6. Expression and Purification of Protein

The amplified gene was cloned into the pET-28a (+) plasmid using ligation-independent cloning (Aslanidis et al. 1990). BamHI and HindIII were used as restriction enzymes. The ligated plasmid was transformed into E.coli BL21 (DE3). Cells were grown at 37°C in the LB medium. The protein recombinant was induced with 0.2 mM IPTG at 17°C for 12 hours. Bacterial cells were centrifuged at 4°C, 10000 rpm for 10 minutes. The collected cells were resuspended with buffer A (50 mM Tris HCl, pH 8.0) and disrupted with an ultrasonic. Then, the cells were centrifuged at 13000 rpm for 25 minutes. Additional purification of the recombinant protein was executed by affinity chromatography with a His-Trap HP column, loading with buffer B (50 mM Tris-HCl, 200 mM NaCl, pH 8), eluted by buffer C (500 mM imidazole, 200 mM NaCl, 50 mM Tris-HCl, pH 8) directly, the eluted peak was desalted in desalting column HiTrap (GE Healthcare, Waukesha, WI, USA). The purified protein elicitor was detected by SDS-PAGE. Protein concentrations were evaluated as described previously [27].

2.7. Bioassay of Whitefly (B. tabaci)

Laboratory bioassays were carried out on cotton plants to determine the bioactivity of a novel purified protein against B. tabaci. Three concentrations of purified protein (58.32, 41.22, and 35.41 μg ml−1) were tested while buffer was used as control treatment. Until the cotton plants were covered thoroughly, they were treated with elicitor by using aerosol spray bottle @ 2-3 ml elicitor solution plant1. The plants were allowed to dry about 20 hours. In order to evaluate the fecundity of the white fly, 3-5 fresh nymph of white fly was released. The fecundity rate was determined by calculating the total no. of offspring that these new emerging nymph produced. The experiment was repeated three times independently with 10 replicates.

2.8. PCR (RT-qPCR)

Plant leaves were treated with 58.32 μg/ml concentration of protein elicitor and B. tabaci allowed to feed at the same time on these treated and untreated plants. These leaves were extracted with total RNARNA ER301-01 kit (TransGen Biotech, Beijing, China) and cDNAAT341-01 kit (TransGen Biotech, Beijing, China) was synthesized. The relative expression of main genes related in cotton defense mechanism has been determined by RT-qPCR in B. tabaci-infested protein elicitor-treated and control plants. Jasmonic acid-associated genes used in this study were UBQ7, GhACT4, and GhLOX while salicylic acid-associated genes were OPR3, b-1,3-glucanase, and acidic chitinase. Primer pairs used to amplify these genes by RT-qPCR are given in Table 1. For each procedure, three experimental replicates were performed.

Table 1

Primer pairs used to amplify genes involved in JA and SA pathways.

Genes	F. primer	R. primer
OPR3	ATGTGACGCAACCTCGTTATC	CCGCCACTACACATGAAAGTT
b-1,3-Glucanese	AATGCGCTCTATGATCCG	GATGATTTATCAATAGCAGCG
Acidic chitinase	GCTCAGAATTCCCATGAAACTACAGGG	GGTTGGATCCTTTGCGACATTC
GhACT4	TTGCAGACCGTATGAGCAAG	ATCCTCCGATCCAGACACTG
UBQ7	GAATGTGGCGCCGGGACCTTC	ACTCAATCCCCACCAGCCTTCTGG
GhLOX	ACATGCCGAAGCCGCTGCTT	GGGCGTATTCGGGGCCCTTG

2.9. Statistical Analysis

The data regarding concentration of protein elicitors and time were subjected to analysis of variance (ANOVA) with factorial arrangement using Statistics 8.1 software (Tallahassee, FL, USA). Means were compared using the least significant difference (LSD) test at 5% level of probability. The expression levels of RT-qPCR were measured using the comparative CT method (2−∆∆CT). Statistical data of protein elicitor-treated and untreated plants were compared with a probability level of 0.05 by using Student's t-test [28].

3. Results

3.1. Purification, Cloning, and Characterization of a Novel Protein Elicitor

Crude protein extracted from Lecanicillium lecanii (V3) strain was further purified using AKTA purification system. The isolated protein was detected by SDS-PAGE. The SDS-P AGE gel was cut, and the protein band was detected by liquid chromatography mass spectrometry analysis. Result was searched by NCBI-BLAST, and the best-matched protein was obtained (GenBank: OAA81333.1). This novel protein elicitor has 253 amino acid residues and 762 bp. To amplify the gene, primers were designed, and desired band of the gene (762 bp) was obtained from agarose gel (Figure 1(a)). The amplified gene ligated to plasmid pET-28a (+). Target Gene and pET-28a vector joined together by using T4 ligase enzyme. Cells were grown at 37°C in the LB plates overnight. On the next day, positive clone was observed on the plates (Figure 1(b)). The ligated plasmid was transformed into E. coli. Recombinant elicitor protein was purified by affinity chromatography (Figure 2(a)). The purified protein recombinant was characterized by a single band at 29 kDa on SDS-PAGE (Figures 2(b) and 3).

Figure 1

(a) Amplified gene of 762 bp on agarose gel. M: molecular weight marker; 1: size of the gene. (b) Positive clones were observed after target gene and pET-28a vector joined together by using T4 ligase enzyme.

Figure 2

Purification of recombinant protein. (a) Total protein purified by the AKTA using a His-Trap HP column. (b) The purified protein on tricine (SDS-PAGE) displayed a single band with molecular mass of 29 kDa. M: protein molecular mass marker.

Figure 3

The 3D structure of purified protein extracted from Lecanicillium lecanii.

3.2. Effect of Purified Protein Elicitor on the Fecundity of B. tabaci

A significant result was observed on B. tabaci fecundity with the interaction of different purified protein concentrations (i.e., 58.32, 41.22, and 35.41 μg/ml). B. tabaci adults fed on purified protein (treated plants) produced fewer offspring than those fed control plants (untreated plants). The lowest fecundity rate was observed for the highest protein concentration (58.32 μg/ml), and the highest fecundity rate was recorded for the lowest protein concentration (35.41 μg/ml) (Figure 4).

Figure 4

Average fecundity of B. tabaci after the treatments with different concentrations of protein. Letters on each bar showed the differences among concentrations (one-way ANOVA; LSD at α = 0.05).

3.3. Expression Levels of SA- and JA-Linked Genes in response to Purified Protein Elicitor

To evaluate the putative role of novel protein elicitor isolated from L. lecanii in induced resistance in cotton against B. tabaci, the expression levels of SA- and JA-associated genes were analyzed. The RT-qPCR analyses showed the genes linked with the JA (i.e., GhACT4, GhLOX, and UBQ7) were moderately upregulated at each time interval (12, 24, 48, and 60 h postexposure to B. tabaci) (Figure 5), while salicylic acid-associated genes (OPR3, b-1,3-gluconate, and acidic chitinase) were significantly upregulated (Figure 6).

Figure 5

Relative expression of JA pathway plant defense observed after applying protein elicitor and B. tabaci infestation at various time intervals. The asterisk on bar indicated a significant difference from buffer control by Student's t-test (P < 0.05) for each gene.

Figure 6

Relative expression of SA pathway plant defense observed after applying protein elicitor and B. tabaci infestation at various time intervals. The asterisk on bar indicated a significant difference from buffer control by Student's t-test (P < 0.05) for each gene.

4. Discussion

In recent years, protein elicitor-induced plant resistance has drawn a significant interest for substitute, novel, and eco-friendly plant defense approaches (Mishra et al. 2012). Pathogenic fungi and bacteria, either biotrophic or necrotrophic, constitute an essential source of elicitors such as MAMPs or PAMPs [29]. This study was aimed at an in vitro evaluation of protein elicitor, purified from entomopathogenic fungi, Lecanicillium lecanii (V3), to determine its potential role against B. tabaci. The isolates from L. lecanii showed promising results against B. tabaci. A significant effect of purified novel protein elicitor was recorded on the fecundity rate of B. tabaci. It was observed that the developmental capability of B. tabaci was slowly reduced after the application of the protein-treated plants as compared to untreated plants. Our results are in line with previous findings [28] demonstrating that the PeBC1 elicitor caused significantly low mean lifetime fecundity of M. persicae. These findings are also like those of [30] who showed a significantly decreased fecundity of M. persicae in tomato by the application of protein elicitor PeBL1. In agreement with earlier studies, this result indicates that the treatment of plants with protein elicitor derived from entomopathogenic fungi has the potential to decrease population growth rates and performance of herbivorous insects. However, elicitors such as JA and MJ may induce the synthesis of different proteinase inhibitors in plants, as showed in tomato plants [31].

SA, JA, and ethylene (ET) pathways play an important role in insect resistance response in plants. Plant defense pathways contribute to the signaling transduction and promote a more efficient plant defense response to insects [32]. Our findings revealed that SA-linked genes were strongly upregulated, and JA-linked genes were moderately upregulated by the application of L. lecanii purified protein. Our results are in line with a previous work by [33-36] which demonstrated that, in different concentrations of protein elicitor PeBb1 extracted from B. bassiana, the fecundity rate of M. persicae decreased and there was significant upregulation of the expression levels of ET and JA pathway-related genes in Brassica rapa ssp. Moreover, these findings corroborate that phloem-feeding herbivores, such as whitefly, activate SA defense pathway-related genes more strongly than those of the JA pathway [37-41].

5. Conclusion

In this study, we reported the purification, cloning, and characterization of a novel elicitor protein isolated from entomopathogenic fungi Lecanicillium lecanii (V3) strain as putative pest management tool against whitefly (B. tabaci). The effects with recombinant purified novel protein indicated a significant decrease in B. tabaci fecundity rate and a significant upregulation of the expression levels of SA and JA pathway-associated genes in the protein-treated cotton plants. These findings suggested that such proteins isolated from entomopathogenic fungi could be used as novel biocontrol pest tools against whitefly (Bemisia tabaci).