AICAR attenuates postoperative abdominal adhesion formation by inhibiting oxidative stress and promoting mesothelial cell repair.

BACKGROUND: Postoperative abdominal adhesion is one of most common complications after abdominal operations. 5-aminoimidazole-4-carboxyamide ribonucleoside (AICAR) is an adenosine 5'-monophosphate activated protein kinase (AMPK) pathway agonist that inhibits inflammation, reduces cell fibrosis and cellular reactive oxygen species (ROS) injury, promotes autophagy and mitochondrial function. This study aimed to explore the mechanism of AICAR in inhibiting adhesion formation.
MATERIALS AND METHODS: Forty rats were randomly divided into five groups. All of the rats except the sham group received cecal abrasion to establish an adhesion model. The rats in the sodium hyaluronate group were treated with 2 mL sodium hyaluronate before closing the peritoneal cavity. The AICAR 1 and 2 groups were treated with 100 mg/kg and 200 mg/kg AICAR, respectively. Seven days after the operation, all of the rats were euthanized, and the adhesion condition was evaluated by Nair's system. Inflammation was assessed by Eosin-hematoxylin (HE) staining and transforming growth factor-β (TGF-β1) detection. Oxidative stress effect was determined by ROS, nitric oxide (NO) level, superoxide dismutase (SOD), catalase, glutathione peroxidase (Gpx) and malondialdehyde (MDA) levels in adhesion tissue. Then, Sirius red picric acid staining was used to detect the fiber thickness. Immunohistochemical staining of cytokeratin-19 (CK-19), alpha-smooth muscle actin (α-SMA) and nuclear factor erythroid 2-related factor 2 (Nrf2) was also performed. Finally, HMrSV5 cells were treated with TGF-β1 and AICAR, the mRNA expression of E-cadherin, α-SMA and vimentin was assessed by q-PCR and cellular immunofluorescent staining.
RESULTS: The rats in the AICAR-treated group had fewer adhesion formation incidences and a reduced Nair's score. The inflammation was determined by HE staining and TGF-β1 concentration. The ROS, SOD, Catalase, Gpx, MDA levels and fiber thickness were decreased by AICAR treatments compared to the control. However, the NO production, Nrf2 levels and peritoneal mesothelial cell integrity were promoted after AICAR treatments. In vitro work, AICAR treatments reduced E-cadherin, α-SMA and vimentin mRNA level compared to that in the TGF-β1 group.
CONCLUSION: AICAR can inhibit postoperative adhesion formation by reducing inflammation, decreasing oxidative stress response and promoting peritoneal mesothelial cell repair.

1 Introduction

As a most commonly complication after surgery, postoperative abdominal adhesion occured in 90%-95% of patients who underwent abdominal surgery will have abdominal adhesion formation, and 20% of these patients will suffer adhesion-related disease [1]. Despite surgical removal of the adhesion bands, there is currently no other effective treatment [2]. Therefore, preventing postoperative adhesion formation is very important.

The formation of postoperative adhesion is a complex process [3, 4]. After surgery, the injury or trauma of peritoneal tissue will lead to inflammation and collagen formation or deposition. Oxidative stress injury plays a vital role, and overaccumulation of superoxide not only harms mesothelial cells but also promotes cell transformation into mesenchymal cells [5]. Inhibiting reactive oxygen species (ROS) is a promising way to prevent adhesion formation [6]. Adenosine 5’-monophosphate activated protein kinase (AMPK) is an important pathway that maintains energy homeostasis and inhibits tissue injury [7]. A previous study illustrated that the AMPK pathway has a protective effect in chronic inflammatory diseases and can inhibit cell fibrosis, reduce ROS injury, promote autophagy, and improve mitochondrial function [8-10]. However, the function of the AMPK pathway in abdominal formation has not yet been determined.

The formation of abdominal adhesion is a process of inflammation that in turn leads to collagen deposition or fiber formation; thus, the AMPK pathway may have a protective effect by preventing adhesion in postoperative abdominal adhesion. Here, we demonstrated that the AMPK agonist 5-aminoimidazole-4-carboxyamide ribonucleoside (AICAR) [11] can reduce adhesion formation by inhibiting oxidative stress and promoting peritoneal repair in a rat model.

2 Materials and methods

The rats were purchased from the Experimental Animal Center of Xi’an Jiaotong University and kept in an approximately 22±2°C environment. All rats had free access to food and water. The experiment was approved by the Ethics Committee of Xi’an Jiaotong University (No. XJTULAC2021-318).

2.1 Abdominal adhesion animal model

Forty Sprague–Dawley (SD) rats, aged>3months and weighing 200g-250g, were used to establish the abdominal adhesion animal model as described in a our previous study. One day before surgery, the abdominal hair was removed, and fasting water was provided 6 hours before surgery. The rats were anesthetized under isoflurane anesthesia (2% isoflurane with 0.4 L/min O2 flow). After skin sterilization, a 2- to 3-centimeter incision was created in the middle of the abdomen. Both the right side and cecum were rubbed with dry gauze 30 times until needle-like bleeding points appeared. Then, the injured cecum side was placed on the opposite side of the injured abdominal wall. Finally, the abdominal wall was closed by an intermittent suture in two layers.

2.2 Study design and adhesion assessment

Forty rats were randomly divided into five groups. The rats in the sham group received only open and close abdominal wall surgery, and the rats in the other groups underwent the abdominal adhesion model procedure. For the sodium hyaluronate group, 2 mL sodium hyaluronate was spread on the injured side of the abdominal wall and cecum before closing the abdominal wall. Within 7 days after surgery, the control group was treated with 1 mL normal saline through intraperitoneal injection on the left upper side of the abdomen, while AICAR Group 1 and Group 2 were treated with AICAR (#9944p, cell signaling technology, USA, purity>99%) 100 mg/kg and 200 mg/kg via subcutaneous injection, respectively, every day after surgery. Seven days after surgery, the rats were killed, and the adhesion condition was classified accoding to the Nair’s score system, described as follows: Grade 0: complete absence of adhesions; Grade 1: single band of adhesion between viscera or from one viscera to the abdominal wall; Grade 2: two bands either between viscera or from viscera to the abdominal wall; Grade 3: more than two bands between viscera or from viscera to the abdominal wall, Grade 4: multiple dense adhesions or viscera directly adherent to the abdominal wall, irrespective of number or extent of adhesive bands [12]. Then, the adherent tissue was collected and divided into two pieces, one kept at -80°C and the other fixed with 4% paraformaldehyde.

2.3 Hematoxylin-eosin (HE) staining and inflammation evaluation

For HE staining, the tissues were first fixed in 4% paraformaldehyde overnight and then made into 4 μm thick serial paraffin sections. HE staining was performed according to instructions of the HE staining kit (Beijing Soleibao Technology Co., Ltd., Beijing, China). The inflammation histopathological score was evaluated by the following system: 0 for the tissue without inflammatory cells; 1 for cases with observable macrophages, lymphocytes, and plasma cells; 2 for cases with macrophages, plasma cells, eosinophils, and neutrophils; and 3 for cases with inflammatory cell infiltration and microabscess formation. This process was performed by two independent researchers. At least five randomly selected high-power fields were reviewed for each section, at least four sections per rat were evaluated, and the score per section was the mean score of all sections per rat.

2.4 ELISA

An enzyme-linked immunosorbent assay (ELISA) was performed to detect the level of TGF-β1 production (CSB-E04727r, Shanghai Ximei Chemical Co. Ltd., Shanghai, China) and NO production (EMSNO, Invitrogen, Thermo Fisher Scientific, Inc.) according to the manufacturers’ manual.

2.5 Chemiluminescence test for ROS

ROS were measured in the peritoneal lavage fluid 7 days after the operation. The lavage fluids were collected before opening the abdominal cavity. A commercial ROS detection kit (Sinovac Biochemical Reagents, Shanghai, China) was used according to the manufacturer’s protocol. The concentrations of the samples were calculated using a standard curve.

2.6 Malondialdehyde (MDA) detection

The MDA concentration in the tissues was measured by an MDA detection kit (S0131S, beyotime biotechnology Co. Ltd., Shanghai, China) according to the manufacturer’s instructions.

2.7 Superoxide dismutase (SOD), Catalase and Glutathione peroxidase (Gpx) activity detection

SOD activity was measured spectrophotometrically according to the methods of Flohe and Otting [13]. In this method, inhibition of the cytochrome c reduction rate is monitored at 550nm at 25°C utilizing the xantine/xantine oxidase system as the source of O2. SOD competes for superoxide and decreases the reduction rate of cytochrome c. One unit of SOD activity was defifined as the amount of enzyme that inhibits by 50% the rate of cytochrome c reduction. The method of Aebi [14] was used to analyze catalase activity. This method uses change in absorbance at 240nm at 25°C of the solution of 10mM H2O2 in phosphate buffer, pH 7.0. The decrease in absorbance per unit time is a measure of the catalase activity. Gpx activity was assayed by the method of Paglia and Valentine [15]. The rate of oxidation of the reduced form of glutathione was monitored by a decrease in the concentration of NADPH caused by addition of glutathione reductase to the reaction mixture. All enzyme activities were reported as units/mg of protein.

2.8. Immunohistochemical (IHC) Staining

IHC staining was used to assess mesothelial cell healing by cytokeratin-19 (CK-19), alpha-smooth muscle actin (α-SMA) and nuclear factor erythroid 2-related factor 2 (Nrf2). IHC staining was performed using a streptavidin-biotin kit (Maxim, Fuzhou, China) following the manufacturer’s instructions. The sections were deparaffinized and rehydrated, incubated with 30 g/L hydrogen peroxide solution at room temperature for 5 minutes, and blocked with goat serum. Subsequently, the sections were incubated with mouse CK-19 (CK-19; 1 : 50 dilution, Abcam, UK), rabbit α-SMA (ab5694, 1 : 100 dilution, Abcam) and Nrf2 antibodies (Nrf2; 1 : 100 dilution, Abcam) at 4°C overnight. The sections were then incubated with biotinylated rabbit anti-mouse IgG for 20 minutes. Incubation with streptavidin-biotin peroxidase complex at 37°C was performed for another 20 minutes. The sections were washed in phosphate-buffered saline four times for 5 minutes per wash. Diaminobenzidine tetrahydrochloride was used for visualization, and hematoxylin was used as the counterstain. The sections were dehydrated, mounted, and sealed. To evaluate the expression of these indicators, at least five random high-power fields of adhesion tissue were reviewed for each section as described in the histopathological evaluation. α-SMA staining was used to assess the fibrosis level of tissue in different treatments by using Image-Pro Plus 5.0 software (Leica Qwin. Plus, Leica Microsystem Imaging Solutions Ltd., Cambridge, UK). Then, CK-19 staining was used to assess the rate of the integrity of the mesothelial cells. This rate was calculated by the stained mesothelial cell length in the adhesion tissue divided by the total mesothelial cell length in the selected fields. The Nrf2 scoring system was as follows: 0—no expression, 1—low expression, 2—moderate expression, 3—strong expression, and 4—very strong expression. The expression condition in the adhesive tissue was calculated as the average score of examined sections.

2.9. Sirius red picric acid staining

More than 5 pathological sections were randomly selected for Sirius red picric acid staining using the experimental method. Staining was performed with 0.1% Sirius red picric acid (Direct Red 80; Sigma–Aldrich, St. Louis, MO, USA), followed by counterstaining with hematoxylin. Five high-magnification fields were randomly selected from each pathological section to measure the width of collagen tissue by using Image-Pro Plus 5.0 software. The average thickness of the adhesive area of each tissue was considered the thickness of the adhesive area of each tissue.

2.10 Culture of HMrSV5 human peritoneal mesothelial cells

Human HMrSV5 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, NY, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, USA) at 37°C in humidified 5% CO2. Transforming growth factor-β1 (TGF-β1) (10 ng/mL, Solarbio Science & Technology Co., Ltd., Beijing, China) was used to induce the epithelial-mesenchymal transition (EMT).

2.11 Cellular immunofluorescent staining

HMrSV5 cells (5×106) were grown on cover slips. Then, the cells in the AICAR-treated group were cultured in a 1 mg/mL AICAR solution for 2 hours and 5 ng/mL TGF-β1 for 24 hours, while the control group was treated with the same dose of PBS. Next, after washing three times, the cells were fixed with 4% paraformaldehyde overnight. Cellular immunofluorescent staining was performed as described in previous studies. The fluorescence intensity was measured by ImageJ software and compared to the control group.

2.12 RNA isolation and real-time PCR

Total RNA was extracted and purified from cells by a kit according to the manufacturer’s instructions (Pioneer Biological Co., Ltd. Xi’an, China). Then, the total RNA was reverse-transcribed using SYBR Green (Takara Biotechnology Co., Ltd.) and an ABI 7500 instrument (Thermo Fisher Scientific, Inc.). Primers were designed according to the sequences reported below (Table 1). The real-time PCR data were normalized to endogenous levels and were carried out in triplicate.

Table 1

Primers designed for different target genes.

Vimentin	Forward	TTGAACGCAAAGTGGAAT
	Reverse	AGGTCAGGCTTGGAAACA
E-cadherin	Forward	CAACGACCCAACCCAAGAA
	Reverse	CCGAAGAAACAGCAAGAGCA
α-SMA	Forward	CATCATGCGTCTGGATCTGG
	Reverse	GGACAATCTCACGCTCAGCA
GADPH	Forward	TGCACCACCAACTGCTTAGC
	Reverse	GGCATGGACTGTGGTCATGAG

2.13. Statistical analyses

All data were analyzed with SPSS 22.0 software (Chicago, IL, USA) and are presented as the means ± standard errors of the mean (SEM). Analysis of variance (ANOVA) was performed to determine significant differences in normally distributed data, and the abnormally distributed data were analyzed by the Kruskal–Wallis test. Enumeration data were determined by Fisher’s exact test. p values <0.05 were considered significant.

3. Results

3.1 AICAR ameliorates adhesion scores in a rat model

All forty rats finished this experiment, and none died or suffered serious postoperative complications. On the 7th day after surgery, the adhesion scores of all the rats were assessed by Nair’s system. All rats in the control group had formed a large number of dense adhesions, while those in the sodium hyaluronate-treated group showed formation of a few thin adhesions. The AICAR-treated group had fewer adhesion formation incidences than the control group (Fig 1A). The adhesion score, which was evaluated by Nair’s scoring system, demonstrated that AICAR treatment attenuated the adhesion score compared to that of the control group. However, the nonadhesion rate was not different from that of the control group (Fig 1B and 1C).

Fig 1

AICAR ameliorates adhesion scores and reduces inflammation in a rat model (n = 8).

(A) A typical picture of the most representative adhesion situation of each group. The sham group included rats that received only open and close surgery. The control group had massive adhesion, while in the HA- and AICAR-treated groups, adhesion formation was relieved. The black arrow indicates the adhesion bands. (B) The Nair’s score of different groups, assessed by Kruskal–Wallis test. (C) The nonadhesion rate in each group. (compared to control, * represents p < 0.05, ** represents p < 0.01).

3.2 AICAR reduces inflammation in adhesion tissue

Inflammation is the initiating cause of adhesion formation. By the HE staining inflammation scoring system, we found that the inflammation score in the AICAR-treated group was dramatically reduced (Fig 2A and 2B). Next, to explore the AICAR-related inflammation in adhension tissue, the level of key proteins involved in inflammation were measured using ELISA and western-blotting analysis (Fig 2C), TGF-β1 concentration was increased in adhesion tissue, while it was significantly decreased in the AICAR-treated group.

Fig 2

AICAR reduces inflammation in adhesion tissue.

(A) A typical picture of HE staining from each group. The black arrow indicates the adhesion tissue. (B) The inflammation score in each group; assessed by one-way ANOVA. (C) The TGF-β1 level assessed by ELISA in each group; assessed by Kruskal–Wallis test. (compared to control, * represents p < 0.05, ** represents p < 0.01).

3.3 AICAR alleviates the oxidative stress response in adhesion tissue

ROS play a vital role in the inflammatory reaction of the postoperative adhesion formation process. Here, we found that compared to the control group, the AICAR-treated group had a lower level of ROS and a ROS-related index, MDA (p<0.05) (Fig 3A and 3B). However, the NO levels was increased after AICAR treatments (p<0.05) (Fig 3C). The activity of SOD, Catalase and Gpx was also significanty decreased in the AICAR-treated group (p < 0.01) (Fig 3D). Then, we assessed the Nrf2 levels in adhesion tissue and found that AICAR can promote Nrf2 expression in adhesion tissue (p<0.05) (Fig 3E).

Fig 3

AICAR alleviates the oxidative stress response in adhesion tissues.

(A) The Relative ROS levels in each group, assessed by Kruskal–Wallis test. (B) The MDA level in each group, assessed Kruskal–Wallis test. (C) The NO levels in each group, assessed Kruskal–Wallis test. (D) The SOD, catalase, Gpx activity in each group; assessed by Kruskal–Wallis test. (E) Typical picture of Nrf2 IHC staining from each group. The black arrow indicates the adhesion tissue. The IHC score in each group, assessed by one-way ANOVA. (compared to control, * represents p < 0.05, ** represents p < 0.01).

3.4 AICAR treatment inhibits tissue fibrosis and promotes peritoneal mesothelial cell repair

Adhesion formation is the process of tissue fibrosis. By Sirius red picric acid staining, we found that the AICAR-treated group had a lower fiber thickness than the control group (Fig 4A1 and 4B). CK19 staining demonstrated that the AICAR groups had a higher rate of peritoneal mesenchymal cell integrity than the control (Fig 4A2 and 4C). α-SMA staining showed that the AICAR-treated groups can significantly reduce the fibrogenesis in vivo (Fig 4A3 and 4D), but the mechanism is still unclear.

Fig 4

AICAR treatment inhibits tissue fibrosis and promotes peritoneal mesothelial cell repair in vivo.

(A1) A typical picture of Sirius Red picric acid staining from each group. (A2) shows CK19 IHC staining from each group. The black arrow indicates the adhesion tissue or normal peritoneal tissues. (A3) α-SMA IHC staining from each group. The black arrow indicates the α-SMA staining. (B) The fiber thickness in each group was measured by Sirius Red picric acid staining, assessed by Kruskal–Wallis test. (C) The integrity of peritoneal mesothelial cells in each group, assessed Kruskal–Wallis test. (D) The tissue fibrogenesis in each group, assessed Kruskal–Wallis test. (compared to control, * represents p < 0.05, ** represents p < 0.01).

Peritoneal mesothelial cell mesenchymal transition (MMT) is an important process in fibrosis. Here, in a TGF-β1-induced HMrSV5 human cell MMT model, we found that AICAR treatment can reduced α-SMA and vimentin mRNA expression compared to that in the TGF-β1 group, while the E-cadherin mRNA expression was higher in the AICAR group (Fig 5A–5C). Cell immunofluorescence also showed that the α-SMA fluorescence intensity was downregulated in the AICAR group compared to it in the TGF-β1 group (Fig 5D).

Fig 5

AICAR treatment inhibits mesothelial cell mesenchymal transition in vitro.

q-PCR was used to assess E-cadherin mRNA expression in each group, n = 3, Kruskal–Wallis test. (B) q-PCR was used to assess α-SMA mRNA expression in each group, n = 3, Kruskal–Wallis test. (C) q-PCR was used to assess vimentin mRNA expression in each group, n = 3, Kruskal–Wallis test. (D) Cellular immunofluorescence staining was used to assess α-SMA expression in each group. Quantification located in adjacent graph. n = 3, Kruskal–Wallis test. (compared to control, * represents p < 0.05, ** represents p < 0.01).

4. Discussion

The AMPK pathway is an important pathway to maintain energy homeostasis in our body that participates widely in stress (ischemic, oxidative, hypoglycemic), exercise, and hormone (adiponectin, leptin) pathways and can be modulated by pharmacological agents [16]. Here, we demonstrated that AMPK agonists can alleviate inflammatory reactions, decrease oxidative stress response and promote mesothelial cell repair in postoperative adhesion formation. These results demonstrated that promoting the AMPK pathway may prevent adhesion formation.

As an AMPK pathway agonist, AICAR can reduce inflammatory reactions in many disease [17]. AICAR can inhibit NF-kB DNA binding independently of AMPK to attenuate lipopolysaccharide (LPS) triggered inflammatory responses in human macrophages [18]. AICAR can also inhibit NF-kB activation and reduce the expression of interleukin-1β (IL-1β) in inflammatory pain [19]. In an intestinal ischemia and reperfusion model, AICAR treatment has also been shown to decrease the inflammatory response and alleviate tissue damage caused by ischemia [20]. Here, we found by HE staining and TGF-β1 assessment that AICAR can inhibit the inflammation score in adhesion tissue and that the level of inflammatory factor TGF-β1 was also reduced by AICAR treatment.

During the formation of postoperative abdominal adhesions, due to the destruction of local tissues, a large amount of reactive oxygen species is generated, which in turn aggravates the inflammatory response and leads to tissue damage [21]. AICAR can decrease sepsis or LPS-induced endothelial activation and organ injury by reducing oxidative stress response [22]. Here, we found that AICAR may play a citical role in anti-oxidative effects, it can reduce ROS, SOD, catalase and Gpx activity in adhesion tissue. And it can also promote the expression of Nrf2. Nrf2 is best known as an oxidant stress response transcription factor, it lies at the center of a complex regulatory network and has a mutiple function. The most function exerted by Nrf2 is the protective role in anti-inflammation conditions and promoting cells repairment [23]. The peritoneum is composed of peritoneal mesothelial cells and the underlying connective tissue [24]. After damage, peritoneal mesothelial cells are missing. The peritoneal cells that repair the local tissue are derived from the surrounding normal peritoneal cells or other stem cells. However, in an inflammatory environment, these cells can undergo necrosis or become fibroblasts. This transformation will promote the formation of a local adhesion, and thus inhibition of peritoneal mesothelial cell-to-interstitial transformation is very important for the prevention and treatment of postoperative abdominal adhesion [25, 26]. In the in vivo experiment, we found that AICAR can reduce collagen deposition and fibrogenesis during adhesion and promote mesothelial cell repair. To further understand its possible mechanism, we extracted and cultured rat primary peritoneal mesothelial cells, and the results showed that AICAR treatment can significantly inhibit TGF-β1-induced peritoneal mesothelial cell-to-mesenchymal transition.

In conclusion, our study demonstrated that an AMPK pathway agonist can inhibit postoperative adhesion formation by reducing inflammation, decreasing oxidative stress response and promoting peritoneal mesothelial cell repair. This finding indicated that AICAR may be used as a potential drug to prevent the formation of postoperative abdominal adhesions.

(RAR)

Click here for additional data file.

9 Jun 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Md Ekhtear Hossain, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf  and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. As part of your revision, please complete and submit a copy of the Full ARRIVE 2.0 Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://arriveguidelines.org/sites/arrive/files/Author%20Checklist%20-%20Full.pdf (PDF). Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“This study was supported by 2021 Science and technology Talents Support project of Shaanxi Provincial People's Hospital (2021JY-08) and (2021JY-15).”

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“Fei Xue received 2021 Science and technology Talents Support project of Shaanxi Provincial People's Hospital (2021JY-08), Yunhua Wu received 2021 Science and technology Talents Support project of Shaanxi Provincial People's Hospital (2021JY-15),The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript the authors investigated the role of AMPK agonist AICAR in inhibiting post-operative abdominal adhesion formation. The authors showed that AICAR can reduce adhesion formation by inhibiting oxidative stress and facilitate peritoneal repair in a rat model.

Here’s my comments on the manuscript:

Major Comments:

1.Multiple studies indicated that p-eNOS expression and nitric oxide (NO) production were increased by in vivo administration of AICAR; please include results of NO and p-eNOS levels in your in vivo study groups. This data will further justify the effect of AICAR on oxidative stress.

2.As the authors indicated in the discussion section, “Peritoneal mesothelial cell mesenchymal transition (MMT) is an important process in fibrosis” please include the results of α-SMA and vimentin expression levels in your in vivo study groups (like you did for Nrf2).

3.In Figure 5D, the number of visible cells in the TGF-β group is way less than in other groups, which dismantled the validity of the quantitative data; please replace this image with the better one and recalculate the graph accordingly.

Minor comments:

1.Indicate the full name of AICIR (5-aminoimidazole-4-carboxyamide ribonucleoside) in the Material and Methods section and the purchasing information (company, purity, etc.).

2.Please include brief information about Nair’s scoring system and add a reference.

3.Please includes the purchasing information for the MDA detection kit.

4.In Figure 5D, the authors measured the transcriptional (mRNA) levels of E-cadherin, a-SMA, and Vimentin. Please indicate it in the figure, e.g., Relative mRNA expression of E-cadherin.

5.Please italicize the words in vivo and in vitro in the manuscript. The statistically significant symbol “P” should always indicate by a small letter (and italicize it); please correct it in the manuscript.

6.In Figure 3A, please replace “Relative ROS expression (%)” with “Relative ROS levels (%)” and subsequently correct the figure legend.

Reviewer #2: The manuscript by Xue F et al presented data linking AMPK agonist AICAR with post-operative abdominal adhesion formation. The experimental design was well constructed and showed the protective effect of AICAR on adhesion formation by inhibiting oxidative stress and peritoneal repair in the post-operative rats. Although the results are interesting, the reviewer has couple of comments.

1. In the abstract-back ground section should describe solely context of the research rather than describing results and concluding remark.

2. The authors conclude that AMPK activator AICAR inhibits inflammation and oxidative stress in the adhesion tissue. Thus, the author should first confirm AMPK and inflammatory signaling (i.e TGF-β and NF-kb) activation in the adhesion tissue by western blotting. All they evaluated to confirm anti-oxidative effects of AICAR were ROS and MDA. Thus reviewer is interested to see Sod, catalase and Gpx expression in the adhesion tissue.

3. They have shown inhibitory effects of AICAR on fibrosis and adhesion formation. Therefore, it would be interesting to see the protein abundance of collagen1, α-SMA, integrins and E-cadherin in the adhesion tissue of the post-operative rats.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

26 Jul 2022

Reviewer #1 (Reviewer Comments to the Author)

Response to Reviewer #1

Many thanks for your expert comments and suggestions for improving our manuscript. We have followed your advice and have improved the presentation of the manuscript accordingly.

1.Multiple studies indicated that p-eNOS expression and nitric oxide (NO) production were increased by in vivo administration of AICAR; please include results of NO and p-eNOS levels in your in vivo study groups. This data will further justify the effect of AICAR on oxidative stress.

Response: Thank you very much for your advice, to further demonstrate the effect of AICAR on the expression NO and p-eNOS, we had both detected the NO level by ELISA and the p-eNOS by IHC, however, we had fail the for the IHC staining of p-eNOS. However, the NO level had been increased by the AICAR treatments. As shown in Figure 3C.

2.As the authors indicated in the discussion section, “Peritoneal mesothelial cell mesenchymal transition (MMT) is an important process in fibrosis” please include the results of α-SMA and vimentin expression levels in your in vivo study groups (like you did for Nrf2).

Response: Thank you very much for your advice, we have added the α-SMA IHC staining for each group, as shown in figure (4A3 and 4D). The result showed that AICAR treatment can protect the integrity of peritoneal mesenchymal cell and inhibits tissue fibrogenesis. Due to a lack of time, we did not preformed the vimentin IHC staining.

3.In Figure 5D, the number of visible cells in the TGF-β group is way less than in other groups, which dismantled the validity of the quantitative data; please replace this image with the better one and recalculate the graph accordingly.

Response: Thank you very much. We chose fewer cell image fields in order to have a better view of cell morphological changes and fluorescence changes. Since the peritoneal mesothelial cells had turned into fibers and became smaller, they appeared to have fewer cells, so we have replaced with another one.

Reviewer #2 (Reviewer Comments to the Author)

Response to Reviewer #2

Many thanks for your expert comments and suggestions for improving our manuscript. We have followed your advice and have improved the presentation of the manuscript accordingly.

1.Indicate the full name of AICIR (5-aminoimidazole-4-carboxyamide ribonucleoside) in the Material and Methods section and the purchasing information (company, purity, etc.).

Response: Thank you for for carefully reminding, we purchased the AICIR from cell signaling technology, USA, purity >99%.

2.Please include brief information about Nair’s scoring system and add a reference.

Response: Thank you very much, we have added the Nair’s scoring system in our manuscript and added the citation.

3.Please includes the purchasing information for the MDA detection kit.

Response: Thank you for your advice, we have added the related information in our manuscript.

4.In Figure 5D, the authors measured the transcriptional (mRNA) levels of E-cadherin, a-SMA, and Vimentin. Please indicate it in the figure, e.g., Relative mRNA expression of E-cadherin.

Response: Thank you for your reminding, we have revised them.

5.Please italicize the words in vivo and in vitro in the manuscript. The statistically significant symbol “P” should always indicate by a small letter (and italicize it); please correct it in the manuscript.

Response: Thank you very much for your reminding, we have revised them.

6.In Figure 3A, please replace “Relative ROS expression (%)” with “Relative ROS levels (%)” and subsequently correct the figure legend.

Response: Thank you very much for your reminding, we have revised them.

Reviewer #3 (Reviewer Comments to the Author)

Response to Reviewer #3

1.In the abstract-back ground section should describe solely context of the research rather than describing results and concluding remark.

Response: Thank you for your suggestion, we have revised it.

2.The authors conclude that AMPK activator AICAR inhibits inflammation and oxidative stress in the adhesion tissue. Thus, the author should first confirm AMPK and inflammatory signaling (i.e TGF-β and NF-kb) activation in the adhesion tissue by western blotting. All they evaluated to confirm anti-oxidative effects of AICAR were ROS and MDA. Thus reviewer is interested to see Sod, catalase and Gpx expression in the adhesion tissue.

Response: Thank you for your suggestion. We have shown the TGF-β1 concentration result after different treatments in Figure 2C, and we can also show you the time-course result we did to confirm that TGF-β1 accumulation in adhesion tissue. Please see in below. But for this part of result, we don’t want to added in the figures.

Since NF-kb signaling pathway activation has been widely confirmed in adhesion tissue[1-4]. So, we don’t think we need to repeat this part again.

1.Chen S, Jiang S, Zheng W, Tu B, Liu S, Ruan H, Fan C. RelA/p65 inhibition prevents tendon adhesion by modulating inflammation, cell proliferation, and apoptosis. Cell Death Dis. 2017 Mar 30;8(3):e2710. doi: 10.1038/cddis.2017.135. PMID: 28358376; PMCID: PMC5386538.

2.Yang L, Lian Z, Zhang B, Li Z, Zeng L, Li W, Bian Y. Effect of ligustrazine nanoparticles on Th1/Th2 balance by TLR4/MyD88/NF-κB pathway in rats with postoperative peritoneal adhesion. BMC Surg. 2021 Apr 26;21(1):211. doi: 10.1186/s12893-021-01201-7. PMID: 33902534; PMCID: PMC8077798.

3.Jiang ZL, Fletcher NM, Diamond MP, Abu-Soud HM, Saed GM. Hypoxia regulates iNOS expression in human normal peritoneal and adhesion fibroblasts through nuclear factor kappa B activation mechanism. Fertil Steril. 2009 Feb;91(2):616-21. doi: 10.1016/j.fertnstert.2007.11.059. Epub 2008 Feb 20. PMID: 18281043; PMCID: PMC2812021.

4.Li L, Frei B. Iron chelation inhibits NF-kappaB-mediated adhesion molecule expression by inhibiting p22(phox) protein expression and NADPH oxidase activity. Arterioscler Thromb Vasc Biol. 2006 Dec;26(12):2638-43. doi: 10.1161/01.ATV.0000245820.34238.da. Epub 2006 Sep 14. PMID: 16973969.

For Sod, catalase and Gpx expression, we have added Sod, catalase and Gpx activity analysis in Figure 3D.

3.They have shown inhibitory effects of AICAR on fibrosis and adhesion formation. Therefore, it would be interesting to see the protein abundance of collagen1, α-SMA, integrins and E-cadherin in the adhesion tissue of the post-operative rats.

Response: Thank you for your advice, we have added the α-SMA IHC staining of post-operative rats in our manuscript, as shown in figure (4A3 and 4D).

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

29 Jul 2022

AICAR attenuates postoperative abdominal adhesion formation by inhibiting oxidative stress and promoting mesothelial cell repair

PONE-D-22-09036R1

Dear Dr. Xue,

We’re pleased to inform you that your revised manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Md Ekhtear Hossain, Ph.D.

Academic Editor

PLOS ONE

4 Aug 2022

PONE-D-22-09036R1

AICAR attenuates postoperative abdominal adhesion formation by inhibiting oxidative stress and promoting mesothelial cell repair

Dear Dr. Xue:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Md Ekhtear Hossain

Academic Editor

PLOS ONE