| Literature DB >> 36035187 |
Lin Cheng1,2,3, Fan Yang4, Xinlin Chen4, Jiawei Kang1,2,3, Jiafu Li1,2,3, Yuanzhen Zhang1,2,3, Juan Liu1,2,3, Jin Li2,3,5, Jianhong Ma1,2,3, Jie Duan1,2,3.
Abstract
Matrix metalloproteinase 9 (MMP9) is an important member of the matrix metalloproteinase family and plays a key role in balancing extracellular matrix proteins. Studies have shown that the homozygous mutations in MMP9 can lead to metaphyseal anadysplasia type 2 (MANDP2, OMIM#613073). The clinical phenotype of this disease is limited and there were only five reported cases of MANDP2 associated with homozygous MMP9 mutations from three families. In this study, we described a case of a fetus with skeletal system malformation. The main clinical manifestations include the short bilateral femur, absence of right fibula, and curved ipsilateral tibia with short length. Importantly, two novel compound heterozygous variants of the MMP9 gene (NM_004,994.3: c.151C > T and c.929del) were found through the trio whole exome sequencing and Sanger sequencing. This is the first report that identified the compound heterozygous variants of the MMP9 gene associated with metaphyseal dysplasia type 2.Entities:
Keywords: absence of fibula; matrix metalloproteinase 9 gene; metaphyseal anadysplasia type 2; prenatal diagnosis; short femur length
Year: 2022 PMID: 36035187 PMCID: PMC9411662 DOI: 10.3389/fgene.2022.938457
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Forward and reverse primers for MMP9 gene variant sites.
| Variant Site | Primers | Length of product |
|---|---|---|
| NM_004,994.3: | F: AGTGGGCTGATACCGTCTCTCC | 335bp |
| c.151C > T | R: GCCCTCAAAGGTTTGGAATCT | |
| NM_004,994.3: | F: GCCCCAGGACTCTACACCC | 195bp |
| c.929del | R: CGGGGCTGAACCTGGTAGA |
FIGURE 1The scan images of the proband [(A,B) the ultrasonography at 13+6 weeks of gestation showed abnormal development of the right calf. (C) the X-ray of the proband showed the absence of the right fibula with the bent tibia.]
FIGURE 2The pedigree-chart-based Sanger sequencing results of the proband (Cases I-1, II-2, II-3, and III-1 with c.151C > T, whereas cases I-3, II-4, and II-5 with c.929del.)
FIGURE 3Models of the MMP9 protein, and conservation sites of the MMP9 amino acid sequences among species [(A). Three-dimensional structure of normal MMP9 protein. (B) Three-dimensional structure of MMP9 protein variant when a stop codon introduced at position 310.(C) Partial three-dimensional structure when a stop codon introduced at position 310. (D) Partial three-dimensional structure when Arg changed to Cys at position 51, where H bond breaks. (E) The variant sites previously reported are demonstrated in blue, while the variants sites reported in this case are in red. (F) The MMP9 amino acid sequences were highly conserved among species.]
Summary of clinical features and molecular findings in MANDP2 patients caused by MMP9 variants.
| Cases | Variant | Type of Variant | Origin | Clinical findings |
|---|---|---|---|---|
| Two siblings ( | NM_004,994.3: c.21T > A | Homozygote | Pakistan | Normal stature, genu varum and metaphyseal fraying during infancy |
| Two siblings ( | NM_004,994.3: c.559C > T | Homozygote | Israel | The first one was diagnosed with shortening of the long bones during the 14.5 weeks of gestation and aborted. The second one was born with a severely reduced body length without associated finding of lethal skeletal dysplasia |
| One child ( | NM_004,994.3: c.1764G > A | Homozygote | Spain | Bowed legs at 19 months old. Clinical and radiological examination revealed scoliosis, genu varum and metaphyseal abnormalities. By the age of 39 months, lower limb alignment and metaphyseal features had already significantly improved, and scoliosis had disappeared |
| The fetus in our study | NM_004,994.3: c.151C > T and c.929del | Compound heterozygote | China | A short femur and unilateral absence of fibula with short curvature of tibia |