| Literature DB >> 36035167 |
Junjie Hu1, Ying Zhang1, Yanmei Yang1, Liya Wang1, Yixi Sun1, Minyue Dong1,2,3.
Abstract
The aim of this work was to explore the genetic cause of the proband (Ⅲ2) presenting with polyhydramnios and gastroschisis. Copy number variation sequencing (CNV-seq), methylation-specific multiplex PCR (MS-PCR), and methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) were used to characterize the genetic etiology. CNV-seq revealed a deletion of 732.26 kb at 14q32.2q32.31 in the proband (Ⅲ2) and its mother (Ⅱ2). MS-PCR showed the maternal allele was missing in the proband, while paternal allele was missing in its mother. MS-MLPA showed deletion of the DLK1, MEG3, MIR380, and RTL1 genes of both the proband and its mother. MEG3 imprinting gene methylation increased in the proband, while decreased in its mother. It was indicated that a maternally transmitted deletion was responsible for Kagami-Ogata syndrome in the proband (Ⅲ2), and the de novo paternal deletion resulted in Temple syndrome in the mother (Ⅱ2). Prenatal diagnosis was provided at 17+3 weeks of pregnancy on the mother's fourth pregnancy (Ⅲ4). Fortunately, the karyotype and single-nucleotide polymorphism array (SNP array) results were normal. The current investigation provided the detection methods for imprinted gene diseases, expanded the phenotype spectrum of the disease, and obtained the insight into the diagnosis, prenatal diagnosis, and genetic counseling of the disease.Entities:
Keywords: Kagami–Ogata syndrome; Temple syndrome; differentially methylated region; imprinting disorder; prenatal diagnosis
Year: 2022 PMID: 36035167 PMCID: PMC9410364 DOI: 10.3389/fgene.2022.959666
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Chinese KOS/TS pedigree. Black-filled symbols indicate patients who suffered from TS (Ⅱ2) and KOS (Ⅲ2). The proband (Ⅲ2) is indicated by an arrow. Ⅲ1 was ended by artificial abortion at 7 weeks. Ⅲ2 was induced labor at 32 weeks. Ⅲ3 was revealed as a biochemical pregnancy.
MS-PCR primers and PCR product size.
| Primer | Primer sequence | PCR product size |
|---|---|---|
| Methylated-forward (MF) | GTTAGTAATCGGGTTTGTCGGC | 160bp |
| Methylated-reverse (MR) | AATCATAACTCCGAACACCCGCG | |
| Unmethylated-forward (UF) | GAGGATGGTTAGTTATTGGGGT | 120bp |
| Unmethylated-reverse (UR) | CCACCATAACCAACACCCTATAATCACA |
M and U primers, specific to bisulfite-converted methylated and unmethylated DNA, respectively.
FIGURE 2CNV-Seq result showing a 739 kb deletion of 14q32.2q32.31 in the proband (Ⅲ2).
FIGURE 3MS-PCR primers specifically designed to amplify the methylated and unmethylated copies of the MEG3-DMR. Bisulfite-treated or -untreated genomic DNA was subjected to MS-PCR using the M or U primer pairs separately or multiplexed to generate a 160-bp or 120-bp band from bisulfite-modified methylated (left lanes 1, 2) and unmethylated (right lanes 1 and 3) template DNA, respectively. Sample 1: normal control; sample 2: the proband; sample 3: the mother; sample 4: negative control; M: a 100-bp size ladder.
FIGURE 4MS-MLPA results. Electropherograms and normalized data for the (A) proband and (B) the mother. (A1, B1) Copy number ratio of the 14q32 region was ∼0.5 for both cases (before HhaI digestion) (red box). Three of these probes contain a HhaI recognition site that can provide information about MEG3’s methylation status. (A2, B2) Methylation ratio of the MEG3 of chromosome 14q32 after digestion was ∼1 for the proband and ∼0 for its mother (red box).
Summary of prenatal ultrasound findings on previously reported cases of KOS.
| References | Polyhydramnios | Omphalocele | Gastroschisis | Other phenotypes | |
|---|---|---|---|---|---|
| Current study |
|
|
|
| |
|
|
|
| NA | Arthrogryposis | |
|
| Patient 1 |
| NA | NA | NA |
| Patient 2 |
| NA | NA | NA | |
| Patient 3 |
| NA | NA | NA | |
|
|
| NA | NA | Narrow thorax; MRI showed a small bell-shaped thorax | |
|
|
| NA | NA | NA | |
|
|
| NA | NA | NA | |
|
|
| NA | NA | NA | |
|
|
| NA | NA | Fetal bradycardia | |
|
| Patient AⅡ2 |
| NA | Abdominal wall defects | Bell-shaped, narrow thoracic deformity, and distal arthrogryposis deformities |
| Patient BⅡ1 |
| NA | NA | NA | |
| Patient BⅡ3 |
| NA | NA | Sonographically suspected encephalocele (not confirmed postnatally) | |
|
| Elder sister |
| NA | NA | Short limbs and a small chest |
| Younger brother |
| NA | NA | Short limbs and a narrow chest | |
|
|
| NA | NA | NA | |
|
|
|
| NA | Abnormal spine curvature, skin edema, and ventricular septal defect | |
|
|
| NA | NA | NA | |
|
| + | NA | NA | Small stomach bubble, mild left ventriculomegaly, and macroglossia | |
|
|
|
| NA | Estimated fetal weight large for date | |
|
|
|
| NA | Skeletal deformities (short limbs, arcuate ulna, and indirect signs of joint contractures) | |
|
|
|
| NA | Macrosomia (above the 97th percentile) and abnormal facial features (a prefrontal edema and a flat facial profile) | |
|
|
|
| NA | NA | |
|
| Patient 1 |
|
| NA | Overlapping digits and rocker bottom feet |
| Patient 2 |
| Suspected | NA | NA | |
NA, data not available.
FIGURE 5Molecular diagnostic flow chart. *Chr14 Abnormal: abnormality on chromosome 14.