| Literature DB >> 36035144 |
Haragopal Dutta1, Gyan P Mishra1, Muraleedhar S Aski1, Tejas C Bosamia2, Dwijesh C Mishra3, Jyotika Bhati3, Subodh Kumar Sinha4, Dunna Vijay5, Manjunath Prasad C T5, Shouvik Das6, Prashant Anupama-Mohan Pawar6, Atul Kumar5, Kuldeep Tripathi7, Ranjeet Ranjan Kumar8, Devendra Kumar Yadava9, Shiv Kumar10, Harsh Kumar Dikshit1.
Abstract
Market class, cooking time, quality, and milled grain yield are largely influenced by the seed size and shape of the lentil (Lens culinaris Medik.); thus, they are considered to be important quality traits. To unfold the pathways regulating seed size in lentils, a transcriptomic approach was performed using large-seeded (L4602) and small-seeded (L830) genotypes. The study has generated nearly 375 million high-quality reads, of which 98.70% were properly aligned to the reference genome. Among biological replicates, very high similarity in fragments per kilobase of exon per million mapped fragments values (R > 0.9) showed the consistency of RNA-seq results. Various differentially expressed genes associated mainly with the hormone signaling and cell division pathways, transcription factors, kinases, etc. were identified as having a role in cell expansion and seed growth. A total of 106,996 unigenes were used for differential expression (DE) analysis. String analysis identified various modules having certain key proteins like Ser/Thr protein kinase, seed storage protein, DNA-binding protein, microtubule-associated protein, etc. In addition, some growth and cell division-related micro-RNAs like miR3457 (cell wall formation), miR1440 (cell proliferation and cell cycles), and miR1533 (biosynthesis of plant hormones) were identified as having a role in seed size determination. Using RNA-seq data, 5254 EST-SSR primers were generated as a source for future studies aiming for the identification of linked markers. In silico validation using Genevestigator® was done for the Ser/Thr protein kinase, ethylene response factor, and Myb transcription factor genes. It is of interest that the xyloglucan endotransglucosylase gene was found differentially regulated, suggesting their role during seed development; however, at maturity, no significant differences were recorded for various cell wall parameters including cellulose, lignin, and xylose content. This is the first report on lentils that has unfolded the key seed size regulating pathways and unveiled a theoretical way for the development of lentil genotypes having customized seed sizes.Entities:
Keywords: Lens culinaris; RNA-seq; seed parameters; signal transduction pathway; transcription factors
Year: 2022 PMID: 36035144 PMCID: PMC9399355 DOI: 10.3389/fgene.2022.942079
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Different seed developmental stages and the developed seeds of L830 and L4602 genotypes.
Descriptive statistics for various seed traits of the genotypes L4602 and L830 using t-test.
| S. No. | Variables | L4602 | L830 | Statistical significance | ||
|---|---|---|---|---|---|---|
| Mean ± SD | SE mean | Mean ± SD | SE mean | |||
| 1 | 1000 seed weight (g) | 42.13 ± 1.21 | 0.70 | 20.90 ± 1.82 | 1.10 | HS |
| 2 | Area (mm2) | 22.59 ± 1.17 | 0.262 | 11.02 ± 0.68 | 0.152 | HS |
| 3 | Length (mm) | 5.57 ± 0.169 | 0.038 | 3.82 ± 0.121 | 0.027 | HS |
| 4 | Width (mm) | 5.24 ± 0.179 | 0.04 | 3.71 ± 0.117 | 0.0262 | HS |
| 5 | Width/Length | 0.9399 ± 0.027 | 0.006 | 0.9723 ± 0.015 | 0.003 | HS |
| 6 | Compactness (Circle) | 0.9379 ± 0.025 | 0.006 | 0.9688 ± 0.014 | 0.003 | HS |
| 7 | Compactness (Ellipse) | 0.9983 ± 0.002 | 0.0003 | 0.999 ± 0.0004 | 0.00008 | NS |
| 8 | Width/Area | 0.2320 ± 0.006 | 0.001 | 0.3377 ± 0.011 | 0.002 | HS |
| 9 | Volume (mm3) | 0.007 ± 0.0002 | 0.00005 | 0.0048 ± 0.0001 | 0.00003 | HS |
| 10 | Perimeter (mm) | 15.477 ± 0.452 | 0.101 | 10.663 ± 0.369 | 0.082 | HS |
Where total count or replication (N) = 20; HS: Highly significant (p ≤ 0.01); NS, Not significant
FIGURE 2A representative mature seed photograph of lentil genotypes (A,B) L4602 and (C,D) L830 was taken at two different wavelengths [(A,C) at 375 nm; (B,D) at 590 nm] using VideometerLab.
Summary of RNA-seq data in four developing seeds samples of lentils (small- and large-seeded).
| Sample name/Attributes | L830-Rep1 | L830-Rep2 | L4602-Rep1 | L4602-Rep2 |
|---|---|---|---|---|
| Mean read quality (Phred score) | 39.06 | 39.32 | 39.68 | 39.03 |
| Number of raw reads (PE) | 63569309 | 40918140 | 60281921 | 59467429 |
| Number of bases (Gb) | 12.71 | 8.18 | 12.05 | 11.89 |
| GC (%) | 46.34 | 46.24 | 48.02 | 48.08 |
| % data ≥ Q30 | 95.39 | 95.83 | 97.09 | 95.02 |
| Read length (bp) | 100 × 2 | 100 × 2 | 100 × 2 | 100 × 2 |
| Total read count | 127138618 | 81836280 | 120563842 | 118934858 |
| Clean read count | 99405074 | 80015960 | 78742292 | 117185022 |
| QC Pass (%) | 78.19 | 97.78 | 65.31 | 98.53 |
| Aligned Read Count | 94320301 | 77115384 | 59243198 | 112377029 |
| Aligned (%) | 94.88 | 96.38 | 75.24 | 95.9 |
Where Rep1 and Rep2 are the two biological replications.
Assembled transcript summary.
| Annotation Category | Numbers |
|---|---|
| No. of assembled transcripts (Total: 120,149) | 106,996 |
| Longest Read length (bp) | 32,136 |
| Mean GC of transcripts (%) (All Assembled Transcripts: 38.96%) | 38.83 |
| Total No. of Unigenes considered for BlastX | 43,369 |
| No. of Unigenes with a hit in UniProt Plant Database | 38,154 |
| No. of Unigenes with a significant hit in UniProt Plant Database | 21,038 |
| No. of Unigenes with a significant hit in PMN Database | 5,334 |
FIGURE 3Functional annotation of unigenes based on Gene Ontology (GO) categorization of lentil genotypes differing for seed sizes (molecular function). These GO terms are classified into three categories (cellular component, molecular function, and biological processes).
FIGURE 4Scatter plot showing overrepresented GO term (p < 0.01) in all comparisons with labels having seed-size responsive terms. Different shades in circles indicate the difference in p-values (as given in the scale), whereas the bubble size indicates the frequency of the GO term.
List of miRNAs and the target fragment identified from the RNA-seq data generated for seed size variations.
| S. No. | miRNA identified | Target details | miRNA aligned fragment | Target aligned fragment | Multiplicity |
|
| |||||
| 1 | gma-miR4353 | Lcu.2RBY.Chr1:20126119-20138212 | CAAGUCGUAGCCGGUGUUAUUACU | AGACAAGACACCAGCUGCGACUUG | 35 |
| 2 | bdi-miR7743-3p | Lcu.2RBY.Chr7:474327216-474368813 | UUUGAACUUUUGUAUUGGAUCUUU | CUAGCUCUAAUACAAAAGUAUGAA | 33 |
| 3 | ghr-miR7511 | Lcu.2RBY.Chr7:474327216-474368813 | AGAAGUUUUGCAUGUGUAGCUGAG | CAUAACUUCUAAUGCAGAACUUCU | 25 |
| 4 | osa-miR5543 | Lcu.2RBY.Chr5:37183597-37189152 | UAUGAAUGGUAUAUUUUCUUG | AAAUAAGAUAUGCCAUUCAAA | 22 |
| 5 | ppt-miR902i-3p | Lcu.2RBY.Chr7:474327216-474368813 | UGGAGGAUCUGCAUCGUAAAC | AAUUCUGAUCCAGAUCUUCUA | 21 |
| 6 | aly-miR3437-3p | Lcu.2RBY.Chr5:37183597-37189152 | CGGUGGAUCUUGUUUUUUGU | UUGAGAAAUAAGAUCCGCCA | 16 |
| 7 | hme-miR-190 | Lcu.2RBY.Chr5:37183597-37189152 | AGAUAUGUUUGAUAUUCUUGGU | CAAAAGAAUAUUGAACUGAUCU | 16 |
| 8 | ath-miR5658 | Lcu.2RBY.Chr4:218966545-219024978 | AUGAUGAUGAUGAUGAUGAAA | UAUUAUUAUUAUUAUUAUUAU | 13 |
| 9 | ahy-miR3520-5p | Lcu.2RBY.Chr6:116449652-116462261 | AGGUGAUGGUGAAUAUCUUAUC | UUCAAUAUCUUUACCGUCAGCU | 11 |
| 10 | gma-miR1533 | Lcu.2RBY.Chr4:218966545-219024978 | AUAAUAAAAAUAAUAAUGA | UUAUUAUUAUUAUUAUUAU | 11 |
| 11 | rgl-miR5576 | Lcu.2RBY.Chr4:226243450-226251514 | AGAAGUUGGCAUUUGCAAACACU | ACAAGGAGCAAAUGCCAACUUCU | 11 |
| 12 | bra-miR5720 | Lcu.2RBY.Chr4:218966545-219024978 | UUGUGAUUUGGUUGGAAUAUC | CGUAGUUCGACCAAACUACGA | 10 |
| 13 | gma-miR9742 | Lcu.2RBY.Chr7:474327216-474368813 | UGUGUUGUUUGUUUUGUAGCA | AUAAACAAAACAAACAACAAA | 10 |
|
| |||||
| 14 | esi-miR3457-3p | Lcu.2RBY.Chr1:538150492-538159831 | UAGCUUGUCCUGGGAUUCCGU | AUGGAUUCUCAGCAGAAGCUA | 20 |
| 15 | gma-miR1533 | Lcu.2RBY.Chr1:520995772-521054241 | AUAAUAAA-AAUAAUAAUGA | UUAUUGUUAUUGUUUGUUGU | 16 |
| 16 | vvi-miR3637-5p | Lcu.2RBY.Chr1:520995772-521054241 | AUUUAUGUAUUGUGUUUUGUCGGA | GUGUUCAAAGUUCAAUGUAUGAAA | 11 |
| 17 | aly-miR838-3p | Lcu.2RBY.Chr1:520995772-521054241 | UUUUCUUCUUCUUCUUGCACA | AUUGUUAAGACAAGAAGAAAG | 10 |
| 18 | csi-miR3951 | Lcu.2RBY.Chr1:520995772-521054241 | UAGAUAAAG-AUGAGAGAAAAA | UUUUUUUUUUAUUCUUUAUCUG | 10 |
| 19 | osa-miR1440b | Lcu.2RBY.Chr1:520995772-521054241 | UUUAGGAGAGUGGUAUUUGAG | UUUAAAUACCUCUUGCUUAAG | 10 |
| 20 | sly-miR6024 | Lcu.2RBY.Chr1:520995772-521054241 | UUUUAGCAAGAGUUGUUUUACC | CGUUGAACUACUUUUGCUGGAU | 10 |
| 21 | stu-miR6024-3p | Lcu.2RBY.Chr1:520995772-521054241 | UUUUAGCAAGAGUUGUUUUCCC | GUGAAAAUGAUUUUAGAUAAAA | 10 |
SSR prediction summary as identified from the RNA-seq data.
| S. No. | Type of repeat | Number of SSRs predicted |
|---|---|---|
| 1 | Mononucleotide (p1) | 6644 (46.02%) |
| 2 | Di-nucleotide (p2) | 2851 (19.75%) |
| 3 | Tri-nucleotide (p3) | 3808 (26.38%) |
| 4 | Tetra-nucleotide (p4) | 162 (1.12%) |
| 5 | Penta-nucleotide (p5) | 40 (0.28%) |
| 6 | Hexa-nucleotide (p6) | 50 (0.35%) |
| 7 | Compound (c) | 882 (6.01%) |
| 8 | Compound (c*) | 14 (0.10%) |
| Total | 14,437 | |
FIGURE 5Heat map generated using the differentially expressed genes (DEGs) associated with (A) membrane protein and (B) secondary metabolite. Genevestigator® was used, and the top 15 perturbations are presented.
FIGURE 6Heat map generated using the DEGs associated with (A) signaling molecule and (B) transcription factors from the lentil genotypes (early seed developmental stage). Genevestigator® was used, and the top 15 perturbations are presented.
Estimation of cellulose, lignin, acetyl bromide soluble lignin content, D-xylose, and acetylated xylose in the mature lentil seeds of the genotypes L4602 and L830.
| S. No. | Variables | L4602 | L830 |
| ||
|---|---|---|---|---|---|---|
| Mean ± SD | SE mean | Mean ± SD | SE mean | |||
| 1 | FT-IR cellulose (%) | 24.07 ± 0.714 | 0.50 | 25.96 ± 0.063 | 0.045 | 0.065 |
| 2 | FT-IR lignin (%) | 11.165 ± 0.049 | 0.035 | 12.80 ± 0.141 | 0.10 | 0.004 |
| 3 | Xylose content (mg/g) | 4.16 ± 0.088 | 0.063 | 6.86 ± 1.59 | 1.1 | 0.139 |
| 4 | O-Acetyl content (mg/g) | 2.014 ± 0.166 | 0.12 | 4.02 ± 1.77 | 1.3 | 0.252 |
| 5 | ABSL lignin content (%) | 21.98 ± 5.79 | 0.41 | 25.07 ± 5.98 | 0.42 | 0.652 |
Where total count or replication (N) = 3; FT-IR: Fourier transform-infrared spectroscopy; ABSL: acetyl bromide soluble lignin content; * at 95% confidence level
FIGURE 7Schematic diagram showing the interplay of key genes and pathways regulating the seed size in lentil genotypes.