| Literature DB >> 36034843 |
Ni Wang1,2,3,4,5, Furui Chu1,2,3,4,5, Lijuan Zhang1,2, Changyi Fei1,2, Chao Yu1,2, Sujun Xue1,2, Yongzhong Wang1, Ling Fang6, Daiyin Peng2,3,4, Xianchun Duan1,2,3,4,5, Weidong Chen2,3,4.
Abstract
Taohong siwu decoction (THSWD) has been shown to have a therapeutic effect on ischemic strokes (IS). However, it is not clear to us whether THSWD reduces deoxyribonucleic acid (DNA) damage after stroke and reduces the inflammatory response caused by the damage. Therefore, we constructed an IS model (I/R) in rats and performed oxygen-glucose deprivation/reoxygenation (OGD/R) on BV2 cells. Then ELISA, immunofluorescence staining, immunohistochemistry staining, and RT-qPCR were performed to detect the expressions of absent in melanoma 2 (AIM2), NLRC4, and Caspase-1 inflammasomes and other inflammatory factors. Experimental stroke causes DNA damage, and we found that the aforementioned inflammasomes as well as inflammatory factors were significantly inhibited after treatment with THSWD by comparing the model group with the model administration group. In addition, we examined the expression of AIM2, NLRC4, and Caspase-1 in BV2 cells of OGD/R and found that the expression of the aforementioned inflammasomes was significantly decreased in OGD/R by administration of THSWD-containing serum. Our data suggest that THSWD can reduced DNA damage after stroke as well as the inflammatory response caused by the damage.Entities:
Keywords: AIM2; NLRC4; Taohong Siwu Decoction; inflammasomes; ischemic stroke
Year: 2022 PMID: 36034843 PMCID: PMC9411787 DOI: 10.3389/fphar.2022.954867
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Constituents of THSWD.
| Components | Part used | Proportion | Batch number |
|---|---|---|---|
| Bai Shao (BS) ( | Dried root | 3 | 17050301 |
| Shu Dihuang (SDH) [ | Dried root | 4 | 17042501 |
| Dang Gui (DG) ( | Dried root | 3 | 16070501 |
| Chuan Xiong (CX) ( | Dried rhizome | 2 | 17061601 |
| Tao Ren(TR) [ | Dried ripe seed | 3 | 17033101 |
| Hong Hua (HH) ( | Dried flower | 2 | 17041401 |
Neurological function score.
| Score | Symptoms seen in rats |
|---|---|
| 0 | Moved normally |
| 1 | The left front paw could not be successfully extended |
| 2 | Turned to the left when crawling |
| 3 | The rat’s body was skewed to the left when crawling |
| 4 | Unconscious, unable to crawl |
Primer sequence.
| Primer | Sequence | Product length | |
|---|---|---|---|
| Gapdh | Forward | CTCCACTCACGGCAAATTCAAC | 147 |
| Reverse | GTAGACTCCACGACATACTCAGC | ||
| Polg1 | Forward | GATGAATGGGCCTACCTTGA | 66 |
| Reverse | TGGGGTCCTGTTTCTACAGC | ||
| Tert | Forward | CTAGCTCATGTGTCAAGACCCTCTT | 110 |
| Reverse | GCCAGCACGTTTCTCTCGTT | ||
| Dloop1 | Forward | CCCTTCCCCATTTGGTCT | 45 |
| Reverse | TGGTTTCACGGAGGATGG | ||
| Dloop2 | Forward | CAGTCATAAACTCTTCTCT | 70 |
| Reverse | CGGAGGATGGTAGATTAAT | ||
| IL-1β | Forward | AGTTGACGGACCCCAAA | 104 |
| Reverse | TCTTGTTGATGTGCTGCTG | ||
| IL-18 | Forward | GGAGGGTTTGTGTTCCAG | 62 |
| Reverse | AATACAGGCGAGGTCATCA |
FIGURE 1Neurofunctional score analysis of taohong siwu decoction (THSWD). Notes: *p < 0.05 vs. Sham group; # p < 0.05 vs. I/R group.
FIGURE 2Inhibition rate and different concentrations of THSWD-containing serum. Notes: (A) inhibition rate (B) cell viability.
FIGURE 3Expression of absent in melanoma 2 (AIM2), NLRC4, and caspase-1 inflammasomes in animal models. Notes: # p < 0.01 vs. Sham group; ## p < 0.01 vs. I/R group.
FIGURE 4Expression of AIM2, NLRC4 and caspase-1 inflammasomes in cellular models. Notes: # p < 0.01 vs. Sham group; ## p < 0.01 vs. I/R group.
FIGURE 5ELISA analysis of THSWD. Notes: # p < 0.01 vs. Sham group; ## p < 0.01 vs. I/R group.
FIGURE 6mRNA expression of IL-1β and IL-18. Notes: *p < 0.05, # p < 0.01 vs. Sham group; **p < 0.05 vs. I/R group.
FIGURE 7Expression of γ-H2AX in each group. Notes: # p < 0.01 vs. Sham group; **p < 0.05 vs. I/R group.
FIGURE 8DNA) testing. Notes: (A) animal models (B) cellular models. A *p < 0.05, # p < 0.01 vs. Sham group; **p < 0.05 vs. I/R group. B *p < 0.05, # p < 0.01 vs. CN group; **p < 0.05, ## p < 0.01 vs. oxygen-glucose deprivation/reoxygenation (OGD/R) group.