Molecular detection of pathogenic bacteria in the colonic biopsies from patients with Ulcerative Colitis.

Background/Aim: Ulcerative Colitis (UC) is an inflammatory bowel disease which is common in many areas of the world including Egypt. A lot of controversy regarding the pathogenesis of UC exist. The current study is an attempt to detect some pathogenic bacteria in UC patients. Materials and methods: Endoscopic colonic biopsies obtained from 40 patients with ulcerative colitis and 20 controls were analyzed by means of real-time PCR technique for the presence of Clostridium difficile, Helicobacter Pylori (H. pylori) and pathogenic Escherichia Coli (E. coli) which are positive for KPC and/or OXA-48.
Results: All patients and control samples were negative for Clostridium difficile. Three of the 40 patient samples (7.5%) and none of the 20 controls were positive for H. pylori with no significant difference between the two groups. KPC-positive E. coli were detected in 11 of the 40 patients (27.5%) and in none of the controls with a significant difference between the two groups (P=0.01). All patients and control samples were negative for OXA-48 positive E. coli.
Conclusion: Although this study does not support the claim that Clostridium difficile and/or H. pylori have a role in UC, it greatly suggests that pathogenic E. coli may be involved in one way or another in the course of UC.

Introduction

Ulcerative Colitis (UC) is an inflammatory bowel disease which occurs with different frequencies around the world with the highest incidence in Canada, United States, United Kingdom and Sweden 1, 2. Although no accurate data about the exact prevalence of UC in the Middle East, some studies pointed out that the incidence of UC is increasing in this area of the world due to changes in the lifestyle 3, 4.

The pathogenesis of UC has been a subject of much controversy. Several authors believed that UC may be induced by pathogenic bacteria. Shigella, Salmonella and Yersinia have been suggested as possible cause of UC 5. More recent studies have argued that pathogenic Escherichia Coli (E. coli) belonging to the B2 and D subgroups play an important role in the pathogenesis of UC 6, 7. Moreover, other investigators have shown that UC patients have a high risk of Clostridium difficile infection when compared with healthy individuals8, 9. Also Helicobacter Pylori (H. pylori) was found colonizing to the gastric mucosa 10. The relationship between H. pylori and UC is controversial. Some studies concluded that H. pylori has a protective role against UC 11–13. Contradictory results have been reported by other investigators who claimed that H. pylori may have a causative role in UC 14, 15.

In the current study we investigated the presence of Clostridium difficile, H. pylori and pathogenic E. coli in the colonic tissue specimens from patients with UC.

Materials and Methods

Study Subjects and specimen collection

This is a retrospective study which was performed on formalin fixed, paraffin-embedded (FFPE) colonic tissue specimens obtained by endoscopy from 40 patients with ulcerative colitis (UC). They were 21 females and 19 males. Their median age was 40 years. Twenty two specimens obtained from rectum or rectosigmoid and 18 were obtained from left colon.

Diagnosis of UC was based on the clinical picture, endoscopic and histologic findings 16. It is worth mentioning that 4 of 40 UC patients (10%) had helicobacter gastritis as proved by gastric biopsy done prior to the study. The disease activity was assessed histologically according to Gupta et al 17. All patients received no antibiotics for at least 2 months before taking the biopsy. Twenty control specimens were obtained from age-matched individuals who underwent endoscopy because of abdominal pain or discomfort. They showed normal endoscopic and histologic findings.

This work was approved by the institutional review board of Ain Shams faculty of Medicine which waived the requirement for informed consent because it was a retrospective study and the cases were analyzed in an anonymous way.

Real-time PCR procedure: Genomic DNA extraction from the 60 formation-fixed paraffin embedded colonic tissue specimens (40 UC patients and 20 controls) was performed using the DNA purification Kit (QIA amp DNA FFPE kit, Qiagen, Germany). The steps were done following the manufacturer protocol.

DNA amplification and detection was performed using Quanti-tech SYBR Green PCK Kit (Qiagen, Germany). A PCR reaction was done to amplify the primers as shown in (Table 1). Ten microliter of the template DNA was added to the reaction mixture following the instructions of the manufactures. PCR was performed using Roter Gene 5 plex machine (Qiagen, Germany). The amplification protocol included initial denaturation step at 94°C for 15 min, followed by 45 cycles which consisted of annealing at 55°C for 30 seconds and extension at 72°C for 30 seconds 18.

Table 1

Primers used in this study

Pathogen	Gene		Primer	Reference number
Clostridium difficile	Tyi	Forward Reverse	AAGAAGCTACTAAGGGTACAAA CATAATATTGGGTCTATTCCTAC	35
H. pylori	VAC A	Forward Reverse	ATGGAAATACAACAAACACAC CTGCTTGAATGCGCCAAAC	36
E coli	16S rDNA	Forward Reverse	CATGCCGCGTGTATGAAGAA CGGGTAACGTCAATGAGCAAA	37
	Bla (KPC)	Forward Reverse	TCGCTAAACTCGAACAGG TTACTGCCCGTTCACGCCCAATCC	18
	Bla (oxa-48)	Forward Reverse	TGTTTTTGGTGGCATCGAT GTAAMRATGCTTGGTTCGC	18

KPC: Klebsiella pneumoniae Carbapenemase Producing gene.

Bla OXA-48: Beta lactamase producing gene (oxacillinase).

An additional test was performed to detect Carbapenem resistant E. coli (MDR) using the KPC and OXA-48 resistant gene primers according to Monterio et al. 2012 18 as shown in (Table 1). The same conditions and reagents quantities were applied.

The results were interpreted by melting curve analysis. It is an assessment of the dissociation characteristics of double-stranded DNA during heating. As the temperature is raised, the double strand begins to dissociate leading to a rise in the absorbance intensity. The temperature at which 50% of DNA denaturated is known as melting point 19.

Statistical analysis

Descriptive data were presented as count and percentages. Quantitative variables were given as median. The statistical analysis was performed using Fisher's exact test and the statistical software SPSS, version 16, A value of P ≤ 0.05 was considered significant.

Results

Endoscopic examination showed that 18 of the 40 UC patients (45%) had Pancolitis, 15 patients (37.5%) had left sided colitis and 7 patients (17.5%) had proctitis.

They were classified into 12(30%) having active disease and 28 (70%) having quiescent disease. Inflammation was marked in 15 patients (including the 12 with active disease), moderate in 9 and mild in 16 cases. Low grade dysplasia was detected in 5 cases (12.5%). No case had high grade dysplasia.

All tissue specimens from patients and controls were negative for Clostridium difficile. H. pylori were identified in 3 of the 40 UC specimens (7.5%). They were absent in all 20 control tissue specimens (Figure 1). The difference was not statistically significant (P>0.05). No significant association could be detected between H. pylori infection and the patient age, gender or disease activity (P>0.05) (Table 2).

Figure (1)

Melting curve shows 3 positive H. pylori samples

Table 2

Relationship between H. pylori and patients' samples

Patient data	H. pylori +ve	H. pylori -ve	Fisher exact test value	P-value
Age (years) > 40 < 40	2 1	20 17	1	NS
Gender Male Female	2 1	17 20	0.596	NS
Activity Active Inactive	2 1	10 27	0.209	NS

NS: Not significant

Commensal E. coli were detected in all 60 tissue specimens included in the study (40 patients and 20 controls) as shown in (Figure 2). Also, all samples were negative for Bla OXA48 positive E. coli as shown in (Figure 3), However, 11 of the 40 UC tissue specimens were KPC positive (27.5%) as compared to the controls which all KPC negative (Figure 4). The difference was statistically significant (Fisher exact test value 0.011, p=0.01) as shown in (Table 3).

Figure (2)

positive E. coli samples (indicated by the elevated peaks)

Figure (3)

shows all-negative BlaOXA48 E. coli samples

Figure (4)

KPC positive samples with one negative KPC control sample

Table 3

Comparing patients and controls regarding KPC

	Patients	controls	Fisher exact test value	P-value
KPC +Ve	11	0	0.001	0.01 Sig
KPC -Ve	29	20
Total	40	20

Sig: significant

NS: Not significant

There was no significant association between KPC positively and patient age, gender or disease activity (P>0.05) (Table 4).

Table 4

Relationship between pathogenic E. coli KPC and patients data

Patient data	E. coli +ve	E. coli -ve	Fisher exact test value	P-value
Age (years) > 40 > 40	7 4	15 14	0.724	NS
Gender Male Female	4 7	15 14	0.488	NS
Activity Active Inactive	3 8	9 20	1.00	NS

NS: Not significant

Discussion

Ulcerative Colitis (UC) is an inflammatory disease which affects the colon and rectum. Many factors are thought to contribute to the pathogenesis of UC including genetic, host immune system disorders, intestinal bacteria, and environmental factors. However, studies on the role of intestinal bacteria in the pathogenesis of UC have been inconclusive 1, 2.

In the current study we investigated the presence of Clostridium difficile, H. pylori and pathogenic E. coli in the colonic tissue from patients with UC, using real-time PCR technique.

We could not detect Clostridium difficile in all specimens from patients and controls. This results contradicts that of Lin et al. and Shoaei et al. 20, 21 who detected Clostridium difficile in 17.6% and 29.4% of UC patients respectively. In fact, this contradiction was expected since the previous two studies were performed on fecal samples while our study was performed on colonic tissue. It is well known that stool analysis for bacteria may give much higher false positive results than tissue analysis since most bacteria live within the intestinal lumen and don't enter the mucosa 22. That is why, Lin et al concluded that microbial analysis of colonic tissue samples may give more solid data than stool analysis 24, 25. Amre et al. reported that the low prevalence of H. pylori infection in patients with inflammatory bowel disease may explain the role of the hygienic hypothesis in the development of this disease. The authors speculated that inadequate microbial stimulation of the gut-associated lymphoid tissue leads to maturation of the mucosal immunity 26. This speculation is supported by the study of Koloski et al. who reported that a clean environment decreases the incidence of common infections as H. pylori. This leads to autoimmunity and increased susceptibility to certain autoimmune diseases as UC 27.

The most important organism investigated in this study was E. coli. We detected that 27.5% of our UC patients had KPC positive E coli (MDR resistant) which are most likely pathogenic. It is interesting to note that detection of pathogenic E. coli in the colonic tissue of UC patients has been also reported by Kotlowski et al. who identified E. coli belonging to the B2 group which are known to be pathogenic 28. Moreover, E. coli strains positive for pathogenecity factors ompA, afae and USP were detected in UC patients 7. In a recent study by Meheissen et al. they identified pathogenic E. coli strainsin 25% (15/60) of inflammatory bowel disease (IBD) cases and in none of the controls 29.

Other studies were performed on the commensally E. coli and found that their number was significantly higher than the controls and concluded that E coli may play a role in the pathogenesis of UC 30–32. More recently, Pilarczyk-Zurek et al. pointed out that E. coli have a dual role in the course of UC. One role is initiation of inflammation and the other is that E. coli may help induction of remission of UC33.

The limitation of the current study is the small number patients included and using FFPE tissue samples. However, it has the advantage of using colonic tissue, rather than stool sample, thus giving more reliable data. Also, we used real-time PCR technique which is an accurate technique to reassure the amplicon by monitoring the accumulation of specific product during each cycle and discriminating it from outliers through melting curve analysis. Moreover, amplification and detection was performed in the same tube (close tube system). This decreases the possibility of contamination and false positive result 34. At the same time, the primers used in the study were species specific. So, they only anneal to the templates from one species, thus increasing the accuracy of the results 35–37.

Conclusion

The present study suggests that Clostridium difficile and H. pylori seem to have no role in UC. More importantly, the detection of pathogenic E. coli in 27.5% of our UC patients suggests that these bacteria may be involved in the process of inflammation in one way or another. This point of research is still in its beginning, and a lot of future studies are recommended to clarify the relationship between E. coli and UC.