| Literature DB >> 36016658 |
Steven Paniagua1, Bilal Cakir1, Yue Hu2, Ferdi Ridvan Kiral1, Yoshiaki Tanaka1,3, Yangfei Xiang4, Benjamin Patterson1, Jeffrey R Gruen5, In-Hyun Park1.
Abstract
Dyslexia, also known as reading disability, is defined as difficulty processing written language in individuals with normal intellectual capacity and educational opportunity. The prevalence of dyslexia is between 5 and 17%, and the heritability ranges from 44 to 75%. Genetic linkage analysis and association studies have identified several genes and regulatory elements linked to dyslexia and reading ability. However, their functions and molecular mechanisms are not well understood. Prominent among these is KIAA0319, encoded in the DYX2 locus of human chromosome 6p22. The association of KIAA0319 with reading performance has been replicated in independent studies and different languages. Rodent models suggest that kiaa0319 is involved in neuronal migration, but its role throughout the cortical development is largely unknown. In order to define the function of KIAA0319 in human cortical development, we applied the neural developmental model of a human embryonic stem cell. We knocked down KIAA0319 expression in hESCs and performed the cortical neuroectodermal differentiation. We found that neuroepithelial cell differentiation is one of the first stages of hESC differentiation that are affected by KIAA0319 knocked down could affect radial migration and thus differentiation into diverse neural populations at the cortical layers.Entities:
Keywords: KIAA0319; NPCs; cell cycle; differentiation; hESCs
Year: 2022 PMID: 36016658 PMCID: PMC9395643 DOI: 10.3389/fcell.2022.967147
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
FIGURE 1Depletion of KIAA0319 by CRISPR interference (CRISPRi) (A) Workflow for generating KIAA0319 KD using CRISPRi in hESCs. (B) Confirmation of KIAA0319 KD by qRT-PCR in H7 cells after transfection and puromycin selection. (C) Confirmation of KIAA0319 KD by qRT-PCR on days 7, 14, 21, and 28 of neuronal differentiation in H7 cells by qRT-PCR in neuronally differentiated H7 cells. (D) Immunofluorescence images of KIAA0319 KD and control on day 28. Green: KIAA0319, grey: DAPI. Scale bar: 50 µm.
FIGURE 2KIAA0319 KD decreases expression of neuronal epithelial marker SOX10 but increases neuronal progenitor marker PAX6. (A) After 14 days of neuronal differentiation, immunofluorescence was performed for SOX10 (green), PAX6 (red), and DAPI (grey). (B) After 21 days of neuronal differentiation, immunofluorescence was performed for SOX10 (green), PAX6 (red), and DAPI (grey). qRT-PCR for SOX10 (C) and PAX 6 (D) were performed on days 14 and 21 of KIAA0319 KD and Control H7 cells. The percentage of the population of SOX10+ (E) or PAX6+ (F) cells were calculated on day 14 and day 21 of differentiation for KIAA0319 KD and Control H7 cells.
FIGURE 3KIAA0319 KD decreases the percentage of proliferating neuronal progenitor cells. (A–B) Immunostaining of KIAA0319 KD and control cells for KI67 (green) and PAX6 (red) in Dapi (gray) on day 28 (A) and day 42 (B) of neuronal differentiation. Scale bar: 50 µm. Percentage of KI67 + cells (C) and PAX6+ population (D) among DAPI + cells at day 28 and day 42. Percentage of PAX6+ cells among KI67 + population at day 28 and day 42 (E).
FIGURE 4KIAA0319 KD cells do not continue differentiating. (A) Images of KIAA0319 KD, Control, Control + DMSO (Positive Apoptosis Control) at day 28 of neuronal differentiation stained with cleaved-caspase 3 (green) and DAPI (grey). (B) QRT-PCR at day 28 for neuronal lineage markers TBR1, TBR2, β-Tubulin, and MAP2.
FIGURE 5KIAA0319 KD RNA-Seq shows pathways that promote cell cycle arrest of neuronal progenitor cells. (A) RNA Sequencing performed at four distinct timepoints separated by 7-day intervals during cortical neuronal differentiation. (B) Ingenuity Pathway Analysis revealed enrichment of pathways appearing in multiple time points. (C) Ingenuity Pathway Analysis revealed enrichment of genes appearing in multiple time points.
CRISPRi oligos.
| Gene target | Forward sgRNA | Bottom sgRNA |
|---|---|---|
|
| ttgTGGTAACCGCGGCGGCGGAAAGGgtttaagagc | ttagctcttaaacCCTTTCCGCCGCCGCGGTTACCAcaacaag |
| Control | ttgGACCAGGATGGGCACCACCCgtttaagagc | ttagctcttaaacGGGTGGTGCCCATCCTGGTccaacaag |
qRT-PCR gene target primers.
| Gene target | Forward primer | Reverse primer |
|---|---|---|
|
| GGAAACCAGAGCAGTGACGATC | GAAGGTATGGCGTCTGTACTCC |
|
| CTCCAACATCCTGAACCTCAGC | CGTCACACCATTGCTATTCTTCG |
|
| ATGAACGCCTTCATGGTGTGGG | CGCTTGTCACTTTCGTTCAGCAG |
|
| CTGAGGAATCAGAGAAGACAGGC | ATGGAGCCAGATGTGAAGGAGG |
|
| AAATGGGTGACCTGTGGCAAA | CTCCTGTCTCATCCAGTGGGAA |
|
| TCACTGGAGGTTTCAAGGAGGC | TTTCTTGGCGCATCCAGTGAGC |
|
| CCACCTGAGATTAAGGATCA | GGCTTACTTTGCTTCTCTGA |
|
| TCAGCGTCTACTACAACGAGGC | GCCTGAAGAGATGTCCAAAGGC |
|
| GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
|
| GTACCAGGACCTGCTCAAT | CAACTATCCTGCTTCTGCTC |
|
| ATGCACGACCTCAACATCGCCA | ACCAGTCGCTTCATCTCCTCCA |