| Literature DB >> 36003654 |
Victoria Anthony Uyanga1, Jingpeng Zhao1, Xiaojuan Wang1, Hongchao Jiao1, Okanlawon M Onagbesan2, Hai Lin1.
Abstract
Heat stress adversely affects the growth performance, muscle development, and protein metabolism in poultry. l-Citrulline (L-Cit), is a non-essential amino acid that is known to stimulate muscle protein synthesis under stress conditions. This study investigated whether L-Cit could influence the growth performance, amino acid profile, and protein metabolism in broilers exposed to high ambient temperature. In a 2 × 2 factorial arrangement, Arbor acre broilers (288 chickens) were fed with basal diet (CON) or 1% L-Cit supplemented diet and later subjected to either thermoneutral (TNZ: 24°C, 24 h/d) or heat stress (HS: 35°C for 8 h/d) environment for 21 days. The results showed that L-Cit diet promoted the body weight and body weight gain of broilers higher than the CON diet, and it further alleviated HS suppression of body weight and feed intake at certain periods (p < 0.05). Plasma urea, uric acid, glucose, and total cholesterol were elevated during HS, whereas, the triglyceride content was decreased (p < 0.05). Serum amino acids including citrulline, alanine, aspartate, and taurine were decreased by HS. L-Cit supplementation restored the citrulline level and alleviated HS induction of 3-methylhistidine (p < 0.05). L-Cit supplementation increased the plasma growth hormone (GH) and insulin-like growth factor-1 (IGF-1) concentration, as well as the GH concentration in the breast muscle (p < 0.05). The mRNA expression showed that HS elicited tissue-specific responses by upregulating some growth factors in the breast muscle, but downregulated the GH receptor, GH binding protein, and IGF-1 expression in the hypothalamus. L-Cit supplementation upregulated the GHRH and IGFBP2 expression in the hypothalamus. L-Cit also upregulated the expression of IGF-1R and IGFBP2 in the breast muscle of HS broilers. The total mTOR protein level in the breast muscle of HS broilers was also increased by L-Cit diet (p < 0.05). Therefore, this study demonstrated that HS negatively affected the growth performance of broilers and dysregulated the expression of growth factors related to protein metabolism. Contrarily, L-Cit promoted the growth responses of broilers via its stimulation of circulating GH/IGF-1 concentration. To certain extents, L-Cit supplementation elicited protective effects on the growth performance of HS broilers by diminishing protein catabolism.Entities:
Keywords: L-citrulline; broilers; growth hormone; heat stress; protein synthesis
Year: 2022 PMID: 36003654 PMCID: PMC9393253 DOI: 10.3389/fphys.2022.937443
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Composition and nutrient levels of experimental diets (as-fed basis) %.
| Ingredients (%) | d1-21 | d22-42 | ||
|---|---|---|---|---|
| CON | L-Cit | CON | L-Cit | |
| Corn (8.5% CP) | 55.02 | 55.02 | 59.61 | 59.61 |
| Soybean meal (43% CP) | 37.02 | 37.02 | 31.71 | 31.71 |
| Soybean oil | 3.87 | 3.87 | 4.73 | 4.73 |
| Limestone | 1.19 | 1.19 | 1.27 | 1.27 |
| Dicalcium phosphate | 1.68 | 1.68 | 1.63 | 1.63 |
| NaCl | 0.30 | 0.30 | 0.28 | 0.28 |
| L-Lys·HCl (99%) | 0.20 | 0.20 | 0.18 | 0.18 |
| DL-Met (99%) | 0.21 | 0.21 | 0.14 | 0.14 |
| Choline Chloride (50%) | 0.26 | 0.26 | 0.20 | 0.20 |
| Vitamin premix | 0.05 | 0.05 | 0.05 | 0.05 |
| Mineral premix | 0.20 | 0.20 | 0.20 | 0.20 |
|
| — | 1.00 | — | 1.00 |
| Calculated Nutrient level | ||||
| CP, % | 21.00 | 21.00 | 19.00 | 19.00 |
| ME, kcal/kg | 3,000 | 3,000 | 3,100 | 3,100 |
| Ca, % | 0.90 | 0.90 | 0.90 | 0.90 |
| Available P | 0.45 | 0.45 | 0.43 | 0.43 |
| Lys | 1.23 | 1.23 | 1.10 | 1.10 |
| Met | 0.54 | 0.54 | 0.45 | 0.45 |
| Met + Cys | 0.89 | 0.89 | 0.77 | 0.77 |
| Thr | 0.86 | 0.86 | 0.78 | 0.78 |
Vitamin premix provided the following per kilogram of diet: VA (retinyl acetate) 10 000 IU, VD3 (cholecalciferol) 2,000 IU, VE (DL-α-tocopheryl acetate) 11.0 IU, VK, 1.0, VB1 1.2, VB2 5.8, VB6 2.6, VB12 0.012, niacin 66.0 mg, pantothenic acid (calcium pantothenate) 10.0, biotin 0.20, folic acid 0.70 mg.
Mineral premix provided the following per kilogram of diet: Mg 100, Zn 75, Fe 80, I 0.65, Cu 8.0, Se 0.35 mg.
List of primers used for real-time PCR analysis.
| Gene | Primer sequence (5′to 3′) | Orientation |
| Product length | Annealing Temperature(oC) |
|---|---|---|---|---|---|
| GHR | CAAGGTGGGAAGAGCACAGT | Forward | M74057.1 | 231 | 58 |
| TCCATACTTGGGGTTTCTGC | Reverse | ||||
| GHRH | AGTCACAAGCTCCATCTCCTCTCC | Forward | XM_015296360 | 299 | 58 |
| CTGGGCTGCTCTCACTGTTTCTG | Reverse | ||||
| GHBP | GGCACTGGTCTGTGCAAAT | Forward | DQ138367.1 | 192 | 60 |
| TCCGGACATTCTTTCCAGTC | Reverse | ||||
| IGF-1 | AGACGAGGCTTCTACTTCA | Forward | NM_001004384.2 | 152 | 54 |
| GCAGATTTAGGTGGCTTT | Reverse | ||||
| IGF1R | CAGGAACGATGGAGGAGAAG | Forward | AF041800.1 | 199 | 58 |
| ACGCAAGCAGTGTTGTTGTC | Reverse | ||||
| IGFBP2 | CACAACCACGAGGACTCAAA | Forward | NM_205359.1 | 205 | 58 |
| CATTCACCGACATCTTGCAC | Reverse | ||||
| β-Actin | TGCGTGACATCAAGGAGAAG | Forward | NM_205518 | 300 | 58 |
| TGCCAGGGTACATTGTGGTA | Reverse |
Accession number refers to Gene bank (NCBI). GH, receptor (GHR); GH, releasing hormone (GHRH); GH-binding protein (GHBP); IGF-1, Insulin-like growth factor-1 (IGF-1); IGF-1, receptor (IGF-1R); IGF1-binding proteins 2 (IGFBP2).
Effects of heat stress and L-citrulline supplementation on the production performance of broilers.
| Parameters | Experimental groups |
| |||||
|---|---|---|---|---|---|---|---|
| TNZ + CON | TNZ + L-Cit | HS + CON | HS + L-Cit | Envt | Diet | Envt*Diet | |
| Body weight(g/bird) | |||||||
| D0 | 45.43 ± 0.17 | 45.60 ± 0.10 | 0.409 | ||||
| wk1 | 158.47 ± 2.24 | 162.42 ± 2.26 | 0.225 | ||||
| wk2 | 398.71 ± 8.43 | 417.22 ± 11.28 | 0.199 | ||||
| wk3 | 733.96 ± 12.93y | 785.95 ± 13.34x | 0.009 | ||||
| wk4 | 1,211.13 ± 18.53 | 1,276.39 ± 40.76 | 1,077.34 ± 19.48 | 1,217.04 ± 39.50 | 0.005 | 0.003 | 0.246 |
| wk5 | 1721.98 ± 25.92 | 1825.16 ± 48.19 | 1,547.27 ± 37.82 | 1742.59 ± 57.69 | 0.007 | 0.002 | 0.304 |
| wk6 | 2,311.76 ± 45.57a | 2,351.58 ± 49.63a | 1971.88 ± 64.39b | 2,283.39 ± 95.78a | 0.004 | 0.011 | 0.041 |
| Body weight gain (g/bird) | |||||||
| wk1 | 113.04 ± 2.31 | 116.82 ± 2.25 | 0.251 | ||||
| wk2 | 240.24 ± 8.01 | 254.80 ± 10.57 | 0.281 | ||||
| wk3 | 335.25 ± 10.52y | 368.73 ± 4.25x | 0.006 | ||||
| wk4 | 452.72 ± 22.80 | 494.91 ± 24.11 | 367.83 ± 22.79 | 426.62 ± 27.76 | 0.004 | 0.048 | 0.737 |
| wk5 | 510.85 ± 8.36 | 548.77 ± 10.66 | 469.93 ± 23.80 | 525.56 ± 25.44 | 0.097 | 0.019 | 0.639 |
| wk6 | 566.64 ± 33.46a | 501.76 ± 16.91 ab | 433.92 ± 46.43b | 506.24 ± 18.05 ab | 0.054 | 0.906 | 0.041 |
| Feed intake (g/bird) | |||||||
| wk1 | 135.11 ± 2.47 | 139.34 ± 2.98 | 0.293 | ||||
| wk2 | 426.92 ± 20.57x | 328.44 ± 19.24y | 0.004 | ||||
| wk3 | 476.95 ± 11.71 | 481.99 ± 18.87 | 0.823 | ||||
| wk4 | 680.39 ± 15.56b | 716.59 ± 39.47b | 570.49 ± 19.99c | 793.17 ± 17.32a | 0.511 | <.0001 | 0.001 |
| wk5 | 994.83 ± 28.62 | 1,012.35 ± 58.18 | 860.27 ± 25.24 | 956.73 ± 47.77 | 0.032 | 0.188 | 0.358 |
| wk6 | 1,281.82 ± 130.83 | 1,099.93 ± 17.38 | 969.79 ± 30.00 | 984.29 ± 62.48 | 0.033 | 0.379 | 0.304 |
| Feed conversion ratio | |||||||
| d1-21 | 1.47 ± 0.05x | 1.30 ± 0.04y | 0.027 | ||||
| d22-42 | 1.92 ± 0.09 | 1.84 ± 0.04 | 1.90 ± 0.09 | 1.88 ± 0.05 | 0.876 | 0.492 | 0.705 |
Data were presented as mean ± SEM (n = 8); x,y Different letters indicate significant main effect of diet at p < 0.05; a,b,c Different letters indicate significant differences in environment × diet interaction at p < 0.05. TNZ + CON = thermoneutral + control diet; TNZ+ L-Cit = thermoneutral + 1% l-citrulline diet; HS + CON = heat stress + control diet; HS + L-Cit = heat stress + 1% l-citrulline diet.
Effects of heat stress and L-citrulline supplementation on organ indexes of broiler chickens.
| Parameters | Experimental groups |
| |||||
|---|---|---|---|---|---|---|---|
| TNZ + CON | TNZ + L-Cit | HS + CON | HS+ L-Cit | Envt | Diet | Envt. * Diet | |
| Absolute organ weights (g) | |||||||
| Liver | 36.26 ± 1.43 | 32.38 ± 2.85 | 37.36 ± 1.96 | 31.64 ± 2.14 | 0.034 | 0.934 | 0.673 |
| Kidney | 5.93 ± 0.12 | 4.98 ± 0.50 | 6.30 ± 0.19 | 5.19 ± 0.35 | 0.004 | 0.378 | 0.806 |
| Heart | 7.34 ± 0.62 | 6.64 ± 0.84 | 7.48 ± 0.32 | 6.51 ± 0.42 | 0.168 | 0.992 | 0.825 |
| Spleen | 1.93 ± 0.16 | 1.70 ± 0.30 | 2.03 ± 0.16 | 1.88 ± 0.42 | 0.512 | 0.63 | 0.895 |
| Thymus | 5.11 ± 0.51 | 4.83 ± 1.21 | 5.21 ± 0.35 | 4.59 ± 1.17 | 0.616 | 0.94 | 0.852 |
| Bursa | 3.80 ± 0.38 | 2.20 ± 0.39 | 3.14 ± 0.25 | 2.78 ± 0.49 | 0.017 | 0.911 | 0.121 |
| Relative organ weights (%) | |||||||
| Liver | 1.70 ± 0.04 | 1.70 ± 0.06 | 1.64 ± 0.06 | 1.57 ± 0.07 | 0.565 | 0.109 | 0.584 |
| Kidney | 0.28 ± 0.01 | 0.26 ± 0.01 | 0.28 ± 0.01 | 0.26 ± 0.01 | 0.02 | 0.819 | 0.944 |
| Heart | 0.34 ± 0.02 | 0.35 ± 0.03 | 0.33 ± 0.01 | 0.32 ± 0.01 | 0.937 | 0.359 | 0.774 |
| Spleen | 0.09 ± 0.01 | 0.09 ± 0.01 | 0.09 ± 0.01 | 0.09 ± 0.02 | 0.83 | 0.966 | 0.875 |
| Thymus | 0.09 ± 0.01 | 0.09 ± 0.01 | 0.09 ± 0.01 | 0.09 ± 0.02 | 0.787 | 0.739 | 0.909 |
| Bursa | 0.18 ± 0.02 | 0.12 ± 0.02 | 0.14 ± 0.01 | 0.13 ± 0.02 | 0.06 | 0.519 | 0.131 |
Data were presented as mean ± SEM, with significant difference at p < 0.05 (n = 8). TNZ + CON = thermoneutral + control diet; TNZ+ L-Cit = thermoneutral + 1% l-citrulline diet; HS + CON = heat stress + control diet; HS + L-Cit = heat stress + 1% L-citrulline diet.
Effects of L-citrulline supplementation on the plasma metabolites of broilers during heat stress.
| Parameters | Experimental groups |
| |||||
|---|---|---|---|---|---|---|---|
| TNZ+ CON | TNZ + L-Cit | HS+ CON | HS + L-Cit | Envt | Diet | Envt x Diet | |
| Alanine transaminase (U/L) | 17.88 ± 1.33 | 22.38 ± 2.51 | 20.75 ± 1.81 | 20.13 ± 2.34 | 0.880 | 0.353 | 0.222 |
| Aspartate aminotransferase (U/L) | 237.00 ± 12.69 | 310.88 ± 31.44 | 292.38 ± 25.10 | 315.13 ± 36.07 | 0.292 | 0.093 | 0.365 |
| Urea (mmol/L) | 0.15 ± 0.04 | 0.27 ± 0.05 | 0.45 ± 0.16 | 0.89 ± 0.38 | 0.035 | 0.186 | 0.463 |
| Uric acid (µmol/L) | 141.75 ± 17.92 | 146.13 ± 13.01 | 288.50 ± 73.69 | 283.13 ± 96.15 | 0.029 | 0.994 | 0.938 |
| Glucose (mmol/L) | 11.58 ± 0.30 | 11.77 ± 0.37 | 12.28 ± 0.46 | 12.85 ± 0.39 | 0.028 | 0.334 | 0.632 |
| Triglyceride (mmol/L) | 0.27 ± 0.02 | 0.26 ± 0.03 | 0.21 ± 0.03 | 0.17 ± 0.01 | 0.001 | 0.269 | 0.568 |
| Total cholesterol (mmol/L) | 2.58 ± 0.16 | 2.77 ± 0.17 | 3.40 ± 0.25 | 3.68 ± 0.41 | 0.003 | 0.382 | 0.869 |
Data were presented as mean ± SEM, with significant difference at p < 0.05 (n = 8). TNZ + CON = thermoneutral + control diet; TNZ + L-Cit = thermoneutral + 1% l-citrulline diet; HS + CON = heat stress + control diet; HS + L-Cit = heat stress + 1% l-citrulline diet.
Effects of heat stress and L-citrulline supplementation on the serum amino acid composition of broilers.
| Amino acids (µg/ml) | Experimental groups |
| |||||
|---|---|---|---|---|---|---|---|
| TNZ + CON | TNZ + L-Cit | HS + CON | HS + L-Cit | Envt | Diet | Envt * Diet | |
| Essential AA | |||||||
| Methionine | 7.47 ± 0.48 | 7.87 ± 1.04 | 7.13 ± 0.56 | 6.48 ± 0.56 | 0.236 | 0.863 | 0.467 |
| Lysine | 2.65 ± 0.15 | 2.58 ± 0.19 | 3.36 ± 0.38 | 2.28 ± 0.24 | 0.444 | 0.041 | 0.071 |
| Histidine | 8.85 ± 0.54 | 9.22 ± 1.01 | 9.94 ± 1.01 | 7.31 ± 0.37 | 0.611 | 0.171 | 0.072 |
| Phenylalanine | 28.64 ± 1.95 | 27.42 ± 1.95 | 23.69 ± 2.38 | 29.33 ± 2.15 | 0.480 | 0.309 | 0.119 |
| Arginine | 56.94 ± 2.74 | 50.87 ± 6.03 | 62.40 ± 6.51 | 58.17 ± 3.99 | 0.230 | 0.330 | 0.861 |
| Isoleucine | 4.52 ± 0.33 | 5.85 ± 1.09 | 4.32 ± 0.51 | 3.90 ± 0.47 | 0.131 | 0.512 | 0.216 |
| Leucine | 12.07 ± 0.86 | 11.46 ± 0.69 | 13.85 ± 1.56 | 10.84 ± 0.75 | 0.585 | 0.094 | 0.259 |
| Threonine | 54.35 ± 6.25 | 44.58 ± 6.17 | 39.18 ± 5.17 | 39.54 ± 5.64 | 0.094 | 0.425 | 0.392 |
| Valine | 12.40 ± 1.13 | 11.98 ± 0.92 | 11.18 ± 1.57 | 10.57 ± 1.12 | 0.292 | 0.676 | 0.939 |
| Cysteine | 44.30 ± 3.51 | 39.47 ± 3.47 | 44.64 ± 5.43 | 41.46 ± 3.82 | 0.783 | 0.347 | 0.845 |
| Glycine | 26.24 ± 1.36 | 23.27 ± 2.49 | 22.20 ± 1.10 | 23.10 ± 1.28 | 0.220 | 0.544 | 0.259 |
| Non-essential AA and Peptides | |||||||
| Citrulline | 123.88 ± 7.40a | 115.31 ± 2.66a | 95.02 ± 6.25b b | 116.47 ± 7.70a | 0.046 | 0.337 | 0.032 |
| Ornithine | 59.17 ± 7.51 | 54.93 ± 10.20 | 49.30 ± 6.80 | 47.17 ± 8.10 | 0.299 | 0.705 | 0.900 |
| Serine | 75.64 ± 3.74a | 56.78 ± 7.92b | 51.98 ± 4.48b | 65.42 ± 5.77ab | 0.209 | 0.646 | 0.010 |
| Alanine | 70.62 ± 5.73 | 60.20 ± 8.69 | 50.54 ± 4.20 | 54.06 ± 5.40 | 0.047 | 0.587 | 0.277 |
| Aspartate | 9.67 ± 1.00 | 10.41 ± 0.77 | 7.11 ± 0.92 | 8.44 ± 0.87 | 0.017 | 0.255 | 0.743 |
| Taurine | 68.39 ± 9.99 | 50.22 ± 5.48 | 35.77 ± 5.13 | 42.41 ± 7.12 | 0.007 | 0.413 | 0.085 |
| Cystathionine | 6.55 ± 0.44 | 6.19 ± 0.77 | 5.84 ± 0.64 | 4.89 ± 0.47 | 0.108 | 0.291 | 0.630 |
| Tyrosine | 28.35 ± 1.72 | 23.76 ± 1.62 | 30.29 ± 2.56 | 25.81 ± 1.07 | 0.287 | 0.020 | 0.977 |
| 3Methylhistidine | 3.23 ± 0.34b | 3.30 ± 0.20b | 11.52 ± 1.96a | 2.65 ± 0.29b | 0.0001 | <.0001 | <.0001 |
| Anserine | 7.87 ± 0.61ab | 8.86 ± 1.03ab | 10.29 ± 1.13a | 7.06 ± 0.77b | 0.740 | 0.235 | 0.030 |
| Carnosine | 5.35 ± 0.25b | 9.66 ± 2.00a | 6.95 ± 0.70ab | 5.78 ± 0.39b | 0.319 | 0.174 | 0.021 |
| Essential AA | 232.19 ± 12.97 | 210.98 ± 12.82 | 219.68 ± 8.79 | 209.89 ± 11.46 | 0.562 | 0.192 | 0.626 |
| Non-essential AA | 475.19 ± 29.47 | 440.36 ± 20.56 | 373.92 ± 14.14 | 399.76 ± 28.76 | 0.007 | 0.853 | 0.217 |
| Total AA | 707.38 ± 41.69 | 661.73 ± 27.37 | 593.60 ± 18.76 | 609.65 ± 38.00 | 0.017 | 0.653 | 0.351 |
Data were presented as mean ± SEM (n = 8).
TNZ + CON = thermoneutral + control diet; TNZ + L-Cit = thermoneutral + 1% l-citrulline diet; HS + CON = heat stress + control diet; HS + L-Cit = heat stress + 1% l-citrulline diet; a,b Different letters indicate significant differences in environment × diet interaction at p < 0.05.
FIGURE 1Effects of heat stress and l-citrulline supplementation on somatotropic axis gene in the hypothalamus of broilers (A) Growth hormone receptor (GHR) (B) Growth hormone releasing hormone (GHRH) (C) Growth hormone binding protein (GHBP) (D) Insulin-like growth factor-1 (IGF-1) (E) Insulin-like growth factor-1 receptor (IGF-1R) (F) Insulin-like growth factor-1 binding protein 2 (IGFBP2). Data were presented as mean ± SEM (n = 8). Means with different alphabetical superscripts indicate significant differences in environment × diet interaction at p < 0.05; Asterisk indicate significant effect of environment at *p < 0.05; ***p < 0.001.
FIGURE 2Effects of heat stress and l-citrulline supplementation on the concentration of somatotropic axis hormones (A) Plasma Growth hormone (B) Plasma Insulin-like growth factor-1 (C) Growth hormone in breast muscle (D) Insulin-like growth factor-1 in breast muscle. Data were presented as mean ± SEM (n = 8). Asterisk indicate significant main effect at *p < 0.05; **p < 0.01
FIGURE 3Effect of heat stress and l-citrulline supplementation on somatotropic axis gene in the breast muscle (A) Growth hormone receptor (GHR) (B) Growth hormone binding protein (GHBP) (C) Insulin-like growth factor-1 (IGF-1) (D) Insulin-like growth factor-1 receptor (IGF-1R) (E) Insulin-like growth factor-1 binding protein 2 (IGFBP2). Data were presented as mean ± SEM (n = 8). Means with different alphabetical superscripts indicate significant differences in environment × diet interaction at p < 0.05 Asterisk indicates significant main effect of environment at *p < 0.05.
FIGURE 4Effect of heat stress and l-citrulline supplementation on mTOR signaling pathway (A) phosphorylated, total and ratio of phosphorylated to total mTOR (B) phosphorylated, total and ratio of phosphorylated to total AKT (C) phosphorylated, total and ratio of phosphorylated to total 4E-BP1 (D) Western blot images of tested proteins. Data were presented as mean ± SEM. Means with different alphabetical superscripts indicate significant differences in environment × diet interaction at p < 0.05.
FIGURE 5Schematic illustration of the stimulatory effects of l-Citrulline on the GH/IGF-1 axis. The GH/IGF-1 axis is important in regulating body growth. In this study, it was found that with l-Citrulline supplementation, there was a stimulatory release of GHRH from the hypothalamus. The GHRH is responsible for GH production and secretion by the somatotrophs in the anterior pituitary gland. The GH released binds to GH receptors and induces IGF-1 production. This was evidenced by the increased peripheral circulation of GH and IGF-1 in the blood circulation with l-Citrulline supplementation. In the circulation, IGF-1 bioavailability allows for its activation of various pathways, including the mTOR signaling that promotes cell growth, metabolism, and protein synthesis. Thus, we hypothesize that l-Citrulline acts via its stimulation of GHRH to activate the GH/IGF-1 axis. Interestingly, under heat stress exposure, l-Citrulline can activate the mTOR signaling to maintain body growth and limit protein catabolism. These actions were also evidenced by l-Citrulline’s regulation of certain amino acids during heat stress such as its induction of circulating citrulline and diminishing of 3methylhistidine, a marker of muscle protein degradation. Note: (+) indicates stimulatory response; (−) indicates inhibitory response; yellow circling indicates the actions of l-citrulline during heat exposure. The image was created with Biorender.