| Literature DB >> 35996508 |
S O Jaafar1, J O Jaffar2, S A Ibrahim2, K K Jarjees3.
Abstract
Background: While different studies have investigated the association of SNPs with female reproductive disorders, a limited number of studies have investigated the effect of microRNAs variants in endometriosis. In this study, we evaluated the prevalence and the association of three different miRNAs variants including, miR-27a rs895819, miR-124-1 rs531564, and miR-423 rs6505162 with endometriosis to help further elucidate the importance of these variants in female reproductive disorders.Entities:
Keywords: endometriosis; microRNAs; polymorphism; severity; variants
Mesh:
Substances:
Year: 2022 PMID: 35996508 PMCID: PMC8915672 DOI: 10.3389/bjbs.2021.10207
Source DB: PubMed Journal: Br J Biomed Sci ISSN: 0967-4845 Impact factor: 2.432
General information of selected SNPs obtained from dbSNP.
| SNP | Position | Change | Primer sequences | Enzyme | Products length (bp) |
|---|---|---|---|---|---|
| miR-27a rs895819 | chr5:160485411 | NR_029501.1:n.40A>G | GAACTTAGCCACTGTGAACACCACTTGG TTGCTTCCTGTCACAAATCACATTG | DraIII | 182, 155, 27 |
| miR-124-1 rs531564 | chr8:9903189 | NR_024281.1:n.141C>G | TACAATTAAGGCACGCGGTGA ACGGAGGAAGGTGTTGACCC | Alw26I | 410, 234, 176 |
| miR-423 rs6505162 | chr17:30117165 | NR_029945.1:n.87A>C | CCCCTCAGTCTTGCTTCGTA AAGGGCGGGAATCAGGAC | RsaI | 143, 124, 19 |
Allele and genotype distribution frequencies of SNPs in the case and control groups.
| SNP | Model | Case | Control | X2 | OR (95%CI) |
|
|---|---|---|---|---|---|---|
| rs895819 | Allele A | 320 (73) | 252 (57) | 22.38 | 0.50 (0.38–0.67) |
|
| Allele G | 120 (27) | 188 (43) | ||||
| Co-dominant (AG v AA+GG) | 96 (44) | 100 (45) | 24.88 | 0.92 (0.63–1.35) |
| |
| Dominant (AA v AG+GG) | 112 (51) | 76 (35) | 11.39 | 0.51 (0.35–0.76) |
| |
| Recessive (GG v AA+AG) | 12 (5) | 44 (20) | 20.95 | 0.23 (0.11–0.45) |
| |
| † = 0.13 | ¥ = 0.29 | |||||
| rs531564 | Allele G | 288 (65.5) | 288 (65.5) | 0.02 | 1.02 (0.77–1.34) | 0.88 |
| Allele C | 152 (34.5) | 152 (34.5) | ||||
| Co-dominant (GC v GG+CC) | 106 (48) | 92 (43) | 2.01 | 1.29 (0.88–1.88) | 0.36 | |
| Dominant (GG v GC+CC) | 91 (43) | 98 (44.5) | 0.59 | 1.16 (0.79–1.69) | 0.44 | |
| Recessive (CC v GG+GC) | 23 (11) | 30 (14) | 0.78 | 0.76 (0.43–1.37) | 0.37 | |
| † = 0.33 | ¥ = 0.26 | |||||
| rs6505162 | Allele A | 275 (62.5) | 327 (74) | 16.36 | 1.80 (1.35–2.40) |
|
| Allele C | 165 (37.5) | 113 (26) | ||||
| Co-dominant (AC v AA+CC) | 115 (52) | 89 (40) | 17.16 | 1.35 (0.93–1.96) |
| |
| Dominant (AA v AC+CC) | 80 (36) | 119 (54) | 15.45 | 2.14 (1.46–3.14) |
| |
| Recessive (CC v AA+AC) | 25 (11) | 12 (5) | 6.33 | 2.42 (1.19–4.92) |
| |
| † = 0.08 | ¥ = 0.37 |
†Indicates HWB p-value for cases. ¥Indicates HWB p-value for controls.
Bold values are statistically significant values p<0.05.
Allele and genotype distribution frequencies of SNPs in women with mild and severe endometriosis.
| SNP | Model | Mild EN | Severe EN |
| OR (95%CI) |
|
|---|---|---|---|---|---|---|
|
|
| |||||
| rs895819 | Allele A | 139 (62) | 181 (83.7) | 26.2 | 0.31 (0.20–0.49) |
|
| Allele G | 85 (38) | 35 (16.3) | ||||
| Co-dominant (AG v AA+GG) | 73 (65.1) | 23 (21.2) | 44.8 | 0.14 (0.07–0.26) |
| |
| Dominant (AA v AG+GG) | 33 (29.5) | 79 (73.1) | 41.9 | 0.15 (0.08–0.27) |
| |
| Recessive (GG v AA+AG) | 6 (4.4) | 6 (5.5) | 0.04 | 1.03 (0.32–3.32) | 0.94 | |
| rs6505162 | Allele A | 120 (53.5) | 155 (71.7) | 15.52 | 0.45 (0.30–0.67) |
|
| Allele C | 104 (46.5) | 61 (28.3) | ||||
| Co-dominant (AC v AA+CC) | 72 (64.2) | 43 (39.8) | 22.0 | 0.36 (0.21–0.63) |
| |
| Dominant (AA v AC+CC) | 24 (21.5) | 56 (51.8) | 21.99 | 0.25 (0.14–0.45) |
| |
| Recessive (CC v AA+AC) | 16 (14.2) | 9 (8.3) | 1.93 | 0.54 (0.23–1.29) | 0.16 |
EN, endometriosis.
Distribution of haplotype blocks in endometriosis patients and controls.
| rs531564 | rs6505162 | rs895819 | Overall frequency % | Case frequency % | Control frequency % | OR (95% CI) |
|
|---|---|---|---|---|---|---|---|
| G | A | A | 28.8 | 29.3 | 0.16 | 1.06 (0.80–1.42) | 0.661 |
| G | A | G | 18.7 | 21.7 | 0.16 | 0.65 (0.46–0.90) |
|
| G | C | A | 12.5 | 7.8 | 0.16 | 1.92 (1.23–2.99) |
|
| C | A | A | 11.7 | 12.2 | 0.16 | 0.75 (0.44–1.27) | 0.285 |
| C | C | A | 11.7 | 7.0 | 0.16 | 2.02 (1.40–2.93) |
|
| C | A | G | 8.5 | 11.0 | 0.16 | 0.54 (0.34–0.86) |
|
| G | C | G | 5.3 | 6.7 | 0.16 | 0.74 (0.34–1.58) | 0.442 |
| C | C | G | 2.5 | 3.3 | 0.16 | 0.17 (0.03–0.80) |
|