Ji Di1,2, Bo Jiang2,3, Hao Shang4, Xin Yang5, Chengwu Zhang6, Xiali Shi7, Yan Chai2. 1. Department of Medical Oncology, Affiliated Hospital of Qinghai University, XiNing 810012, China. 2. School of Clinical Medicine, Tsinghua University, Beijing 100084, China. 3. Beijing Tsinghua Changgung Hospital, Beijing 100084, China. 4. Department of General Surgery, The Second Affiliated Hospital, Xi'an Jiaotong University School of Medicine, Xi'an, Shaanxi 710004, China. 5. Second Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450000, China. 6. Department of Surgical Oncology, Affiliated Hospital of Qinghai University, XiNing 810012, China. 7. Department of Anesthesiology and Surgery, The Second Affiliated Hospital, Xi'an Jiaotong University School of Medicine, Xi'an, Shaanxi 710004, China.
Abstract
Gastric cancer is the most common digestive tract malignancy in China and has a poor prognosis, with a 5-year overall survival rate of only 35.1%. Because its early symptoms are not obvious and early diagnosis is complicated, there is an urgent need to find biological targets for diagnosis and treatment. This research detected the expression of STAT3 in gastric cancer tissues and adjacent tissues by Western blot and immunohistochemical experiments and conducted corresponding basic experiments to explore the role of STAT3 in inhibiting the proliferation of cisplatin-resistant gastric cancer cells and promoting their apoptosis, including the construction of cisplatin-resistant gastric cancer cell line, the knock-out STAT3 in drug-resistant gastric cancer cells by CRISPR-Cas9, and the comparison of the proliferation and apoptosis of drug-resistant cells and drug-resistant cells STAT3(-). The mechanism provides a possible intervention target for clinically improving the prognosis of patients with cisplatin-resistant gastric cancer.
Gastric cancer is the most common digestive tract malignancy in China and has a poor prognosis, with a 5-year overall survival rate of only 35.1%. Because its early symptoms are not obvious and early diagnosis is complicated, there is an urgent need to find biological targets for diagnosis and treatment. This research detected the expression of STAT3 in gastric cancer tissues and adjacent tissues by Western blot and immunohistochemical experiments and conducted corresponding basic experiments to explore the role of STAT3 in inhibiting the proliferation of cisplatin-resistant gastric cancer cells and promoting their apoptosis, including the construction of cisplatin-resistant gastric cancer cell line, the knock-out STAT3 in drug-resistant gastric cancer cells by CRISPR-Cas9, and the comparison of the proliferation and apoptosis of drug-resistant cells and drug-resistant cells STAT3(-). The mechanism provides a possible intervention target for clinically improving the prognosis of patients with cisplatin-resistant gastric cancer.
Gastric cancer is the most common digestive tract malignancy in China, and the prognosis is poor, with a 5-year overall survival rate of 35.1% [1]. According to the International Agency for Research on Cancer, there are about 1.089 million new cases of gastric cancer worldwide in 2020, ranking fifth in the number of people with malignant tumors [2]. There are approximately 769,000 deaths due to gastric cancer worldwide in 2020, ranking fourth in the number of deaths due to malignancy, with 43.9% of the incident cases and 48.6% of the deaths occurring in China [3]. The above characteristics indicate the malignant degree of gastric cancer and its serious impact on social development. Clinically, for early or advanced gastric cancer, the first choice of treatment is surgery, but treatments other than surgery are equally important, and it is widely used in chemotherapy for patients with advanced gastric cancer. And, targeted therapy can significantly prolong the survival period of patients and improve their quality of life. The drug resistance in tumor cells is one of the important reasons that tumors recur after the systematic and standard treatment. Multidrug resistance (MDR) of gastric cancer seriously affects the advanced prognosis in patients with gastric cancer [4]. Various factors mediate the occurrence of MDR, and its main mechanism includes the inactivation of apoptosis-related signal pathways.Signal transducer and activator of transcription 3 (STAT3) is an important member of the STAT family and plays an important role in tumor occurrence, proliferation, metastasis, and drug resistance [5-7]. At present, it has been found that there are a large number of proteins involved in the regulation of cell apoptosis. Some researchers showed that matrix metalloproteinase-9 (MMP-9) was mainly involved in the extracellular matrix. The degradation process also helps tumor cell invasion and metastasis [8, 9], and its expression was positively correlated with the invasion of tumors [10]. Bcl-2-associated X-protein (BAX) is a member of the proapoptotic protein in the Bcl-2 family of proteins [11]. As a tumor suppressor gene, BAX plays a pivotal role in the prevention of tumorigenesis. Its dysregulation may lead to apoptotic dysfunction and increase a variety of pathological possibilities [12]. MDR1 can develop resistance to cytotoxic chemotherapeutics and targeted drugs [13]. The study of Kong et al. [14] has shown that the expression of MDR1 inhibits the sensitivity of gastric cancer cells to certain chemotherapy regimens. By jointly detecting the levels of the above three apoptotic proteins, the status of tumor cells can be evaluated, and the degree of malignancy can be reflected in the drug resistance and invasiveness.
2. Materials and Methods
2.1. Reagents
All cases are from the Affiliated Hospital of Qinghai University, and the pathological tissues were taken from the pathology department for research. The clinical samples were entrusted to Urumqi Ouyi Biomedical Technology Co., Ltd. for testing. The other experimental parts were completed at Beijing Tsinghua Changgung University. The reagents and kits used in the present study were purchased as follows: cisplatin-resistant human gastric cancer cells (DDP) were purchased from Beina Bio (BNCC342230), DH5a competent Escherichia coli (c1100), ampicillin (A7490), puromycin (P8230) LB medium (L1010), T4 ligase (T1410), and annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) detection kit (CA1020) were purchased from Beijing Soleibao Technology Co., Ltd. Fetal Bovine Serum (Gibco, 10099-141, Australia), CCK8 (Tongren, Japan / Toyohito, Japan, CK04), Trypsin (Gibco, R001100, Shanghai First Biochemical Pharmaceutical Co., Ltd.), STAT3 Antibody (9139, Osaka, Japan), MDR1 Antibody (CST, 13342, Shanghai Ltd.), BAX antibody MMP-9 (CST,13667, Abcam China), β-actin polyclonal antibody (APPLY GEN, C1828, AmyJet Scientific Inc, China).
2.2. Instruments
General electrophoresis, horizontal and vertical electrophoresis tank, and semidry transfer blotter were purchased from Bio-Rad Laboratories Inc., (Hercules, CA, USA). Inverted fluorescence microscope was purchased from Olympus (CK53, Japan). A microplate reader was purchased from Tecan Group Ltd. (Männedorf, Switzerland); and the automatic developing instrument (chemo doc) was purchased from BioRAD.Remove the wax block of the gastric cancer patient and the paraffin block from the pathology department and send them to the partner company for testing after taking the paraffin slice.
2.3. Cell Culture
The human gastric cancer drug-resistant DDP cell was cultured in RPMI-1640 + 10% FBS at 37°C with 5% CO2. The DDP-resistant cells were cultured to the logarithmic growth phase after recovery, and the cells were plated in a 24-well plate at 1.2 × 105. Different concentration gradients of cisplatin (DDP) were sequentially added, and the drug concentration was gradually increased daily (1 μg/mL) until up to 10 μg/mL. We observed the growth of the cells every 12 hours after treatment. If the cells shrink and float more, replace the medium without cisplatin. The concentration of DDP was refined according to the floating situation of the cells, and the final concentration of DDP was 10 μg/mL.Crisper-cas9 technology specifically knocks out STAT3:Design sgRNA: Design according to the CDS sequence of the target gene, and enter the human STAT3 to get the highest-scoring single-stranded sequence (Oligo), which is 5' caccG GCAGCTTGACACACGGTACC'3. Oligo(2μL)+ double distilled water(8μL), PCR machine 95℃ for 5 min, slowly cooling to room temperature for 1h, 1:200 double-spiked. Then, lentiCRISPR(2 μg) plasmid + 1μBsmBI+2 μl 20x butter + Xμl double distilled water (20 μL in total). T4 DNA ligase(1 μL) + 5 × DNA ligase butter(2 μL) + digest lentiCRISPR plasmid(1 μL) + diluted duplex(6 μL). All were reacted at room temperature for 6 h. The fragments were placed into the cultured DH5a competent E. coli, and the bacteria was shaken fully. Then, the plasmid was extracted according to the instructions. The last step was single cell separation. The cells were spread in a 96-well plate (1 cell/well) by a cell counter. The remaining cells were frozen. When cell clusters similar to colonies were visible to the naked eye, they were digested from the 96-well plate and transferred to the 12-well plate to continue the expansion and culture. Also, a negative control group was set. Finally, the total cell protein was extracted.CCK8 method is used to detect the cell proliferation activity. The normal cisplatin-resistant gastric cancer cells and cisplatin-resistant gastric cancer cells STAT3(-) were inoculated into a 96-well plate at a density of 1.2 × 105 cells/ml in 100µl cell suspension per well and 3 wells in each group at 37°C incubator culture medium, and the supernatant was discarded at 6 h, 12 h, 24 h, 48 h, and 72 h. The medium containing 10% CCK8 was prepared, which was added to the above cell wells for 2 h (preliminary exploration), and then the OD value was determined immediately by a microplate reader.The apoptosis-related proteins were determined by western blotting. The cells of each group were collected, and the protein was extracted according to the instructions for extracting the cells from APPLYGENi, and the BCA method was applied to detect the protein concentration. The protein loading volume is 30 μg, the mass fraction of SDS polyacrylamide gel electrophoresis concentrated gel was 4%, the mass fraction of separation gel for BAX was 10%, and the mass fraction of separation gel for MDR1 and MMP-9 was 8%. At a constant flow of 25 mA, the electrophoresis was stopped 2 hours after bromophenol blue reached the bottom of the glass plate. The coition of transfer membrane was 90 mA electrophoresis for 1 hour. ImageJ software was used to analyze the bands; calculate the gray value, and the ratio of the target band gray value to the corresponding β-actin gray value was applied to measure the expression of MDR1, MMP-9, and BAX.Dual-flow method is used to detect cell apoptosis. The cells were digested and 300 μL 1x binding buffer was added to make the cells suspend. Annexin V-FITC labeling: added 5 μL of Annexin V-FITC and mixed well, avoiding light and were incubated at room temperature for 15 minutes. PI labeling: added 5 μL of 1x binding buffer 5 minutes before the machine PI staining; before using the machine, added 200 μL of 1x binding buffer.Flow cytometry is used to detect cell growth cycle. PBS solution (2.5 mL) was added to the 10 ml test tube (resuspend the cells, then slowly add 7.5 ml of 95% alcohol precooled at −20°C, and ice bath for 30 min). The cells were filtered with a 300-mesh nylon filter after being scattered. RNase solution (100 μL 5 mg/mL) was added incubating at 37°C for 30 minutes, and then, the enzyme action was stopped in an ice bath; PI dye solution (100 μg/mL) was added for 30 minutes without light and test on the machine.
2.4. Data Analysis
All data were expressed as mean ± standard deviation (), and SPSS19.0 software was used to perform statistical analysis on the content of each protein in each group. If the data conform to the normal distribution, the T-test analysis method was applied for statistics. P < 0.05 indicated a significant difference. If the data did not conform to the normal distribution, the rank-sum test method was used for statistics, P < 0.05 indicated a significant difference.
3. Results
3.1. The Different Expression of STAT3 in Gastric Cancer Tissues and Adjacent Tissues by Western Blot
Figure 1(a) is the expression result of STAT3 by western blot. It was obvious that the expression of STAT3 was higher in cancer tissues. Figure 1(b) is the statistical result of the gray value. Compared with adjacent tissues, STAT3 expression is higher in cancer tissues (P < 0.05), and the difference was statistically significant.
Figure 1
STAT3 expression and statistical results in gastric cancer and adjacent tissues. (a) Protein bands. (b) Statistical graphs of protein bands. P < 0.01, cancer tissue group vs. adjacent tissue group. Note: 1 is cancer tissue, and 2 is adjacent tissue.
3.2. The Different Expression of STAT3 by Immunohistochemistry
According to the instructions, the tissue was subject to baking, dewaxing, hydrating, antigen retrieval, primary antibody incubation, washing, secondary antibody incubation, dehydrating, etc. The expression of STAT3 protein was stronger in gastric cancer and adjacent tissues under the microscope, and the expression of STAT3 protein in gastric cancer tissue is slightly stronger than that in adjacent tissues, as shown in Figure 2.
Figure 2
STAT3 expression in gastric cancer and adjacent tissues (40x, 100x, 200x, and 400x).
The clinical experiment part indicated that STAT3 may play an important role in the progression of gastric cancer. Therefore, we carried out corresponding basic experiments to explore the mechanism of STAT3 in the proliferation and apoptosis of gastric cancer cells.
3.3. STAT3 Was Knocked by CRISPR-Cas9
According to the above steps of CRISPR-Cas9, the expression of STAT3 was detected by western blot. We can conclude that STAT3 was completely knocked out, as shown in Figure 3.
Figure 3
The statistics after STAT3 being knocked out. (a) Protein bands. (b) Statistical graphs of protein bands. P < 0.01, STAT3 knockout group vs. negative control group. Note: A is the STAT3 knockout group, and B is the negative control group.
3.4. The Cell Proliferation Was Detected by the CCK8 Method
We found that at 6 h and 12 h, the proliferation ability of the DDP STAT3(-) group was lower than that of the DDP group at 6 h and 12 h, and the difference was statistically significant; the proliferation ability of DDP STAT3(-) was significantly lower than that of the DDP group at 24 h, 48 h, and 72 h, and the difference was statistically significant, as shown in Figure 4.
Figure 4
OD values of the two groups of cells at different time points. P < 0.05 and P < 001, DDP STAT3(-) group vs. DDP group.
3.5. Apoptosis-Related Protein Detection
The expressions of MDR1, BAX, and MMP-1 in the DDP STAT3(-) group were all higher than those of the negative control group, and the differences are statistically significant which told us that knockout of STAT3 may change and promote the apoptosis of gastric cancer cells, as shown in Figure 5.
Figure 5
Comparison of MDR1, MMP-9, and BAX and gray value of two groups of cells. (a) Protein bands. (b) Statistical graphs of protein bands. P < 0.05 and P < 0.01, DDP STAT3(-) group vs. negative control group. Note: A is a DDP STAT3(-) group, and B is a negative control group.
3.6. The Detection of Cell Apoptosis and Growth Cycle by Flow Cytometry
Figure 6 shows us that the apoptosis percent in DDP STAT3(-) group was lower than that in the DDP group. Figure 7 shows us that the G2/M period in the DDP STAT3(-) group was longer, so it explained the fact why the DDP group grew faster than the DDP STAT3(-) group.
Figure 6
Apoptosis of each group. (a–i) Flow cytometry apoptotic quadrant diagram. (j) Statistical graph of apoptosis rate. P < 0.05, DDP STAT3(-) group vs. negative control group. Note: A means negative control; B means FITC negative control; C means PI negative control; D,E, and F means the DDP group, G,H, and I was the DDP STAT3(-) group. Q1: annexin V-FITC-/PI+; the cells in this area are necrotic cells. There may also be a few late apoptotic cells; Q2: annexin V + FITC+/PI+; the cells in this area were late apoptotic cells; Q3: annexin V-FITC+/PI-; the cells in this area were early apoptotic cells; Q4: annexin V-FITC-/PI−; the cells in this area were living cells.
Figure 7
Two groups of cell growth cycles of two groups. (a, b) Schematic of the cell cycle. (c) Cell cycle statistics. P < 0.01, DDP STAT3(-) group vs. negative control group.
4. Discussion
Gastric cancer is the result of cumulative damage of multiple genes [15], but the burden of gastric cancer in my country is still very severe [16]. Therefore, there have been numerous studies on gastric cancer-related genes and their pathogenic mechanisms, [17] and continuous exploration and study of the functions of potential genes that regulate the progression of gastric cancer [18, 19] and their regulatory mechanisms are useful for exploring the pathological changes at the molecular level of gastric cancer and guiding clinical rationality. Treatment and prognosis are of great research significance to further improve the diagnosis and treatment of gastric cancer.The expression of STATs in tumor cells and cancer tissues has been extensively studied. STAT3 can promote tumor progression by regulating the cell cycle and the expression of proinflammatory genes [20]. After consulting related literature, it is found that the expression of STAT3 is related to the occurrence and development of solid tumors such as head and neck squamous cell carcinoma, lung cancer, and ovarian cancer [21-27].Under normal circumstances, STAT3 in tumor cells is overactivated, and this inhibits the cell apoptosis process, which may include the weakening or activation of certain related factors. In short, a continuous STAT3 expression state is the most. It is possible to protect tumor cells against apoptosis [28]. There is evidence that a variety of cell products are involved in the process of cell apoptosis, and these products can also influence each other. In addition, the effectors of many apoptosis pathways also perform functions other than apoptosis, such as regulating the cell cycle, participating in DNA repair, and tumor suppression [29]. Under physiological conditions, there is a dynamic balance between proapoptotic proteins and antiapoptotic proteins, and the process of cell apoptosis is controlled. In contrast, the development of tumors is one of the most prominent examples of underapoptosis, and changes in the apoptotic state in addition to tumor progression can also lead to treatment resistance [30]. Downregulation of proapoptotic proteins (such as BAX) is one of the important mechanisms of cancer cell antiapoptosis.
5. Conclusion
In this study, we verified clinically that STAT3 was higher in gastric cancer tissues than in adjacent tissues by western blotting and immunohistochemistry. Subsequently, we carried out corresponding cell experiments and successfully constructed a cisplatin resistance model. STAT3 was knocked out successfully on drug-resistant cells by the CRISPR-Cas9 technology. We found that the cell's STAT3(-) proliferation slowed down and apoptosis increased. The apoptosis-associated protein (MDR1, BAX, and MMP9) was lowed in DDP STAT3(-). Flow cytometry also showed similar results about apoptosis and growth cycle. These told us that STAT3 may be a potential therapeutic target to improve the resistance of gastric cancer patients in the future.
Authors: Teppei Morikawa; Yoshifumi Baba; Mai Yamauchi; Aya Kuchiba; Katsuhiko Nosho; Kaori Shima; Noriko Tanaka; Curtis Huttenhower; David A Frank; Charles S Fuchs; Shuji Ogino Journal: Clin Cancer Res Date: 2011-02-10 Impact factor: 12.531