Maryamsadat Shahidi1, Omid Abazari1, Parisa Dayati2, Ali Bakhshi1, Javad Zavarreza1, Mohammad Hossein Modarresi3, Fateme Haghiralsadat4, Mehdi Rahmanian5, Seyed Morteza Naghib6, Davood Tofighi7. 1. Department of Clinical Biochemistry, School of Medicine, Shahid Sadoughi University of Medical Sciences and Health Services, Yazd, Iran. 2. Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran. 3. Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. 4. Department of Advanced Medical Sciences and Technologies, School of Paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran. 5. Biomaterials and Tissue Engineering Department, Breast Cancer Research Center, Motamed Cancer Institute, ACECR, Tehran, Iran. 6. Nanotechnology Department, School of Advanced Technologies, Iran University of Science and Technology (IUST), Tehran, Iran. 7. Department of Psychology, Epidemiology, and Research Design Support (BERD), Clinical and Translational Science Center, University of NM, Albuquerque, NM, United States.
Abstract
Bladder cancer is one of the concerning urological malignant diseases in the world, which has a clinical need for effective targeted therapy. The development of nanotechnology-based gene delivery to bladder tumor sites is an effective strategy for targeted cancer therapy with low/no toxicity. With this view, in the present work, the mesoporous silica nanoparticles (MSNs) modified with c(RGDfK)-PLGA-PEG [c(RGDfK)-MSN NPs] were constructed for co-delivery of miR-34a and siPD-L1 within bladder cancer cells and tissues. Our findings showed that miR-34a is downregulated while PD-L1 is up-regulated in cell lines and animal studies. This nano-carrier is biocompatible in the serum environment and effectively protects miR-34a and siPD-L1 against serum degradation. However, we showed that c(RGDfK)-MSN NPs could simultaneously downregulate PD-L1 expression and up-regulate miR-34a in the T24 cells and T24 mice model and enhance anti-tumor effects both in vivo and in vitro. In conclusion, these findings presented new suggestions for improving targeted therapeutic strategies with specified molecular objectives for bladder cancer treatment.
Bladder cancer is one of the concerning urological malignant diseases in the world, which has a clinical need for effective targeted therapy. The development of nanotechnology-based gene delivery to bladder tumor sites is an effective strategy for targeted cancer therapy with low/no toxicity. With this view, in the present work, the mesoporous silica nanoparticles (MSNs) modified with c(RGDfK)-PLGA-PEG [c(RGDfK)-MSN NPs] were constructed for co-delivery of miR-34a and siPD-L1 within bladder cancer cells and tissues. Our findings showed that miR-34a is downregulated while PD-L1 is up-regulated in cell lines and animal studies. This nano-carrier is biocompatible in the serum environment and effectively protects miR-34a and siPD-L1 against serum degradation. However, we showed that c(RGDfK)-MSN NPs could simultaneously downregulate PD-L1 expression and up-regulate miR-34a in the T24 cells and T24 mice model and enhance anti-tumor effects both in vivo and in vitro. In conclusion, these findings presented new suggestions for improving targeted therapeutic strategies with specified molecular objectives for bladder cancer treatment.
Urinary bladder carcinoma is ranked as the 10th most frequent concerning neoplasms worldwide in 2020. It has serious medical and social concerns due to its high-cost diagnosis and treatment services and high recurrence rate (Sung et al., 2021). At the early diagnosis, non-muscle-invasive bladder cancer (NMIBC) is the predominant histopathologic form of bladder carcinoma, including around 75% of all patients with bladder cancer. In comparison, the remaining cases (about 25%) are assorted as muscle-invasive bladder cancer (MIBC) (Grayson, 2017). The NMIBC patients are often treated by transurethral resection of the bladder (TURB), but nearly 70% of such tumors recur within 5 years and progress to MIBC (Sanli et al., 2017). However, one of the main challenges is that many MIBC patients with bladder cancer do not respond to chemotherapy. Adverse side effects can seriously harm the patients due to the low accuracy of these chemotherapeutic agents (Liu et al., 2017). Although the intravesical instillation strategy is frequently utilized for bladder cancer therapy, it has many challenges in patients with metastatic tumors. The injected therapeutic agent can remain in the bladder cavity for only a little time and often does not penetrate the thick muscular layer of the bladder wall (Seidl, 2020). This view suggests systemic administration with targeted tumor localization and few adverse effects.Previous evidence introduces programmed death-ligand 1 (PD-L1) as a biomarker predicting response to chemotherapy and clinical outcome in MIBC patients after radical cystectomy (Bellmunt et al., 2017). PD-L1 is a ligand found on tumor cell surfaces. It blocks T-cell receptor signaling by binding to its receptor, PD-1, and protecting tumor cells against T-cell (Han et al., 2020). Immune checkpoint blockade, such as PD-1/-PD-L1 inhibitor, exhibits remarkable clinical responses in several solid tumors, including bladder cancer (Topalian et al., 2015). In the last years, synthetic antibodies blocking immune checkpoints have been developed (Hargadon et al., 2018). However, the clinical benefits of checkpoint blockade have been restricted in many cancer patients, possibly owing to the unfavorable immune system activities related to the treatment (Chen et al., 2018). The existence of immunosuppressive compounds in the microenvironment of tumors, including tumor-associated fibroblasts and macrophages, immunosuppressor cytokines, and regulatory T cells (Tregs), indicated some limitations in the cytotoxic T cells infiltration into the tumor site (Musetti and Huang, 2018). Hence, developing novel strategies to overcome the disadvantages of immune checkpoint therapy is required.MicroRNAs (miRs) are a subfamily of short endogenous non-coding RNAs that exert gene silencing effect through binding to the 3′-untranslated regions (3′-UTR) of multiple target messenger RNAs (mRNAs), which make them an attractive tool in the context of cancer gene therapy (Lu and Rothenberg, 2018). miRs can be functionally divided into tumor suppressor miRs and oncogenic miRs (oncomiRs) subgroups in cancer investigations. miRs dysregulation is proved implicated in the pathogenesis of almost all solid tumors (Ali Syeda et al., 2020). Therefore, using miRs mimics for restoring the tumor suppressor miRs activity and antisense miRs for inhibiting the oncomiR function are two major strategies to modulate the miR activity (Wang et al., 2019). MiR-34a, as a “star” miR in the oncology field, generally acts as a tumor suppressor miR and is downregulated in a broad of human malignant diseases (Slabáková et al., 2017). However, much evidence described that the downregulation of miR-34a is correlated with cell proliferation, angiogenesis, migration, and metastasis (Yu et al., 2014). In addition, miR-34a can be a promising candidate for cancer therapy because of its ability to downregulate the CD44 expression in cancer cells and sensitize the tumor cells to chemotherapeutic agents (Li et al., 2014).Therefore, the combination of miR-34a and PD-L1 siRNA (siPD-L1) effectively downregulates PD-L1 and CD44 expression in tumor cells and increases tumor cells’ sensitivity to apoptotic signals. This function prevents invasion and drug resistance which may decrease treatment doses of therapeutic agents (Pichler et al., 2017; Liu et al., 2018). However, effective delivery of miR-34a and siPD-L1 to the bladder cells and tissue is an important issue for cancer gene therapy. Cancer researchers have designed many vehicles to deliver miRNAs or siRNAs to the target sites in the recent decade (Wang et al., 2021a). Among these, mesoporous silica nanoparticles (MSNs) have attracted enormous interest as promising candidates because of their biocompatibility, tunable pore size, good stability, high surface area, and easy surface modification (Jafari et al., 2019; Wang et al., 2021b). In the current work, miR-34a/siPD-L1 was loaded on MSNs modified with poly (lactic-co-glycolic acid) and c(RGDfK) peptide [c(RGDfK)-MSN NPs] for the targeted treatment of bladder cancer (Scheme 1). Because of its biodegradability and biocompatibility, PLGA is one of the several FDA-approved materials used in gene/drug delivery systems. This compound can function as a steric layer for RNAs protection against serum enzymes to increase blood safety of nanoparticles (Miao et al., 2019; Ghitman et al., 2020). Therefore, we used PLGA coating on the surface of MSNs as a protective layer to improve the miR34a/siPD-L1 delivery system. On the other hand, the overexpression of αvβ3 integrins on the surface of bladder cancer cells functions as a receptor for facilitating c(RGDfK) attachment and nanoparticle retention in the tumor site (Godugu et al., 2021). Subsequently, the in vitro and in vivo anticancer activities of synthesized nanoparticles were studied by different techniques such as flow cytometry, fluorescence imaging, western blotting, and q-RT-PCR.
Cell culture materials consisting of Fetal bovine serum (FBS), RPMI1640, and penicillin-streptomycin were prepared from Gibco. Dimethyl sulfoxide (DMSO), 4′,6-diamidino-2-phenylindole (DAPI), N-Hydroxysuccinimide (NHS), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), and PLGA (Mw 24,000–38,000) were procured from Sigma-Aldrich (St. Louis, MO). All antibodies against PD-L1, CD44, E-cadherin, Vimentin, N-cadherin, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were concurred by Cell Signaling Technology. Hsa-miR-34a and PD-L1 siRNA sequences were synthesized and obtained from Metabion.
Clinical tissue samples
We collected the tumor and normal bladder tissues from 32 patients at the Shahid Rahnemon Hospital in Yazd province, Iran, between 2019 and 2021. The research ethics committee of Shahid Sadoughi University of Medical Sciences (Yazd, Iran) approved all procedures involved in human bladder tumor experiments, and all patients signed the informed consent. The fresh specimens were frozen in liquid nitrogen at −196°C and kept at −80°C until molecular analyses.
Cell culture
The bladder’s normal (SV-HUC-1) and cancer (T24 and 5637) cell lines were acquired from the Institute Pasteur of Iran. The cell lines routinely were cultivated and grown in RPMI 1640 containing 10% of FBS and 1% of streptomycin-penicillin and maintained in an incubator with 37°C and 5% CO2 (Liang et al., 2021).
Preparation and characterization of nanoparticles
Amine-functionalized MSNs (MSN-NH2) were obtained from Sigma with an average pore size and particle size of 4 nm and 100–200 nm, respectively. To load both siRNA and miRNA in the silica nanoparticles, small RNAs (0.5 μg) were mixed with MSNs at different ratios (w/w) from 1:1 to 1:8 in RNase-free water and incubated on a magnetic stirrer at 25°C for 30 min and finally run on a 2% agarose gel for 30 min at 100 V. After electrophoresis, the gel was stained using ethidium bromide and observed under a Gel Doc system. The MSNs–miRs + siRNAs (MSNs-RNAs) were subsequently obtained by centrifugation.Briefly, 500 mg of PLGA was mixed in methylene chloride, and then EDC (80 mg) and NHS (100 mg) were added to it and stirred for 24 h at room temperature. Finally, the activated mixture and 2,2′-(Ethylenedioxy)bis(ethylamine) were added into anhydrous methylene chloride and incubated overnight at room temperature. The resultant was precipitated using diethyl ether and further dried over a vacuum. The c(RGDfK)-PLGA-PEG was prepared by reacting 1.1% w/w c(RGDfK) with PLGA-PEG conjugate in DEPC water and stirred for 2 h at room temperature. To qualify completed nanoparticle [c(RGDfK-MSN NPs], c(RGDfK)-PEG-PLGA conjugate was added into dichloromethane-DMSO and sonicated for 5 min. Subsequently, this solution was mixed with MSNs-RNAs and sonicated for 2 min to obtain a microemulsion. The hydrodynamic diameter and zeta potential of nanoparticles were determined by Dynamic Light Scattering (DLS) using a Zetasizer Nano (Malvern, United Kingdom). The morphological analysis of nanoparticles was evaluated by transmission electron microscopy (TEM) (H7600, Hitachi, Japan) and scanning electron microscope (SEM) (S-4700, Hitachi, Japan). Fourier-transform infrared (FTIR) spectroscopy (Madison, WI, United States) was employed to determine the chemical properties of nanoparticles.
siRNA/miRNA serum stability
C (RGDfK)-MSN NPs containing small RNAs were exposed to 50% serum (1:1 volume ratio) for 12 h at 37°C and subsequently run on the 2% agarose gel electrophoresis at different time points to investigate nano-carriers ability to protect siRNA and miRNA against serum degradation.
In vitro siRNA/miRNA release
To assess the release profile of siRNA/miRNA, c(RGDfK)-MSN NPs at a ratio of 4:1 were dispersed in 10 mM 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) buffer at pH 7.4 and pH 5.4 and then incubated in an incubator. Subsequently, a small volume of samples was collected at different time points, and then the concentration of siRNA and miRNA was measured by a spectromax quick drop spectrophotometer at 260 nm.
Cellular uptake study
Briefly, T24 cells at a density of 2 × 105 per well were cultivated in a 24-well plate on coverslips and incubated for 24 h. C (RGDfK)-MSN NPs and MSN NPs containing Cy3-tagged siRNA were added to cancer cells and maintained for 6 h. After incubation, cells were rinsed twice with PBS, fixed in 4% paraformaldehyde (PFA) for 20 min, mounted on a glass slide, and visualized under a confocal microscope (Zeiss AG). DAPI was employed for nuclear staining. According to standard protocols, fluorescence-activated cell sorting (FACS) analysis was also conducted to evaluate the cellular uptake (Richard et al., 2003).
MTT assay
To investigate the cytotoxicity of c(RGDfK)-MSN NPs loaded with siPD-L1 and miR-34a on T24 cells, about 2 × 104 cancer cells/per well were cultured onto 96-well plates and grown for 24 h before the treatment with nanoparticles. Further, T24 cells were exposed to the different doses of blank MSN NPs (without siRNA and miRNA), MSN NPs (without c(RGDfK)), c(RGDfK)-MSN NPs (completed nanoparticle), and incubated for another 24 h. MTT assay was conducted to study the cellular viability by measuring the optical density (OD) at 575 nm.
Transwell assay
According to the instructions, the migration and invasion ability of T24 cells were determined using the transwell assay. Briefly, T24 cells at a density of 5 × 104 were suspended in 200 μl of serum-free DMEM and then added into upper transwell chambers (Costar, United States) and incubated at 37°C for 24 h. The lower chambers were filled with 600 μl DMEM containing 20% FBS. After incubation time, T24 cells were fixed with 4% paraformaldehyde, stained with crystal violet solution, and five fields of the cells on the lower surface were randomly counted in under a light microscope.
In vitro wound healing analysis
The wound-healing assay was performed to determine cell migration. In brief, T24 cells (5 × 104/well) were seeded in12-well plate and incubated overnight to reach 100% confluence. Subsequently, the layer of cells was scratched by a 10-µl pipette tip. The residual cells were rinsed with PBS and incubated in a 3% culture medium. T24 cells were exposed to MSN NPs or c(RGDfK)-MSN NPs for 24 h. Photographing of the scratched monolayer cells was taken at 0 h and 24 h. Finally, the migration rate was calculated by the following formula:Cell motility (%) = 100 × (the average wound distances at 0 h−the average wound distance at 24 h)/the average wound distance at 0 h.
Briefly, total RNA, including miRNA, was extracted from tissue and cell samples using TRIzol Reagent (Invitrogen), following the provider’s protocols. The concentration of extracted RNAs were estimated by measuring the OD at 260 nm by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, United States). The integrity of RNA samples was also assessed by 1% agarose gel electrophoresis. Complementary DNA (cDNA) was synthesized from 500 ng of total RNA using the suitable cDNA kits (TAKARA, Japan). After that, qPCR analysis was applied using a suitable SYBR Green qPCR Mix (Yekta Tajhiz Azma, Iran), selected primers, and a cDNA template on a real-time PCR system (Applied Biosystems). The sequences of miR-34a (MS00003318), and U6 as internal reference for miR-34a (600750) were from Qiagen (Germany). Primer sequences of PD-L1 and GAPDH as internal reference for PD-L1 are listed in Table 1. The 20 µl reaction mixture was contained SYBR Green qPCR Mix (10 μl), forward primers (10 μM; 0.5 μl), reverse primers (10 μM; 0.5 μl), nuclease-free water (7 μl), template DNA (20 ng; 2 μl). Real-time PCR cycling conditions used were as follows: initial denaturation at 94°C for 3 min, followed by 40 cycles consisting of denaturation at 94°C for 10 s, annealing at 65°C for 10 s, and a final extension at 72°C for 10 s. Data was normalized to the GAPDH and U6 genes. Relative expression was analyzed using the 2−ΔΔCT method (Livak and Schmittgen, 2001).
TABLE 1
Primer sequences used for qRT-PCR.
Gene names
Primer sequence (5ʹ to 3ʹ)
PD-L1
Forward: TGCCGACTACAAGCGAATTACTG
Reverse: CTGCTTGTCCAGATGACTTCGG
GAPDH
Forward: GTCTCCTCTGACTTCAACAGCG
Reverse: ACCACCCTGTTGCTGTAGCCAA
Primer sequences used for qRT-PCR.
Western blot analysis
Protein extracts of tissue samples and cultured cells (30 µg protein/each well) were loaded, run on 10% SDS-PAGE runs at 150 V for 60 min, and then electrophoretically transported into polyvinylidene difluoride (PVDF) membranes. Later, membranes were blocked by 5% milk at room temperature for 1 h and incubated at 4°C overnight with anti-PD-L1 (#13684; 1: 1000), anti-CD44 (#37259; 1: 1000), anti-E-cadherin (#3195; 1: 1000), anti-N-cadherin (#4061; 1: 1000), and anti-Vimentin (#3932; 1: 1000), followed by HRP-conjugated secondary antibodies (Abcam; 1: 5000) at room temperature for 1 h. The membranes were then reprobed with anti-GAPDH (#5174; 1:1000) as loading control. Protein bands were visualized by the enhanced chemiluminescence (ECL) detection system and quantified using ImageJ software. GAPDH protein was utilized as an internal control.
In vivo study
All procedures on mice were approved by the Ethics Committee of Shahid Sadoughi University of Medical Sciences (Yazd, Iran) and performed per ethical standards and the care of animal guidelines. T24 cells (1 × 105 cells per 200 µl PBS) were implanted intraperitoneally (i.p.) into the mice to produce tumors. The treatment began 2 weeks after i.p. injected the T24 cells into the mice. The female mice (n = 5 per group, 5 weeks old) were checked daily for adverse therapeutic effects. For the anti-tumor activity of c(RGDfK)-MSN NPs, animals were randomized into three groups, including the saline group (control), c(RGDfK)-MSN NPs group (experimental group), and MSN NPs (negative group). MSN NPs or c(RGDfK)-MSN NPs were injected twice weekly. Body weight and tumor weight were recorded every 3 days. After 21 days, all mice were killed, and bladder, kidney, spleen, and liver organs were resected for further molecular analyses and immunostaining. The kidney, spleen, and liver indexes were calculated with the ratio of the organ weight to the body weight.
In vivo delivery of c(RGDfK)-MSN NPs
c(RGDfK)-MSN NPs@Cy3-RNAs were injected into each mouse (n = 3) via an intravenous (i.v.) injection through its tail vein. Then the fluorescence signal was detected using an IVIS imaging system (IVIS Spectrum, MA) at the appropriate wavelength (640 nm) and emission wavelength (680 nm).
Immunohistochemical study
Immunohistochemical (IHC) staining of PD-L1 and Ki67 proteins was conducted on the tumor tissue from the mice or clinical samples (Bigelow et al., 2013). Five fields in each tissue sample were randomly observed under light microscopy at ×400 magnification.
Statistical analysis
Data were analyzed by GraphPad Prism® software (version 8.0; GraphPad Software, Inc.) and showed as the mean ± standard deviation (SD) from at least duplicate experiments. The Student’s t-test was used to compare the two groups’ differences. The differences between continuous variables in the experimental groups were compared by one-way Analysis of variance (ANOVA), followed by Tukey’s test. p-value ˂ 0.05 was statistically significant.
Results and discussion
Examination of miR-34a and PD-L1 expression in bladder cancer
Previous reports have cleared that higher expression of PD-L1 and lower expression of miR-34a were closely associated with higher tumor grades and advanced stages and lower treatment response rates in bladder cancer patients (Andrew et al., 2015; Wu et al., 2016). Therefore, these markers appear to be promising targets in bladder cancer diagnosis and treatment. In this work, we firstly investigated the expression levels of miR-34a and PD-L1 in 32 clinical tissue specimens from bladder cancer patients by immunohistochemical staining, western blotting, and q-RT-PCR assays. As shown in Figures 1A,B, immunohistochemical images and western blotting analysis revealed that PD-L1 was greatly expressed in the cancer tissues relative to their neighboring non-cancer tissues (Figures 1A,B). Afterward, the qRT-PCR study showed that the miR-34a level was lower in the bladder tumor tissues than in the corresponding normal tissues (Figure 1C).
FIGURE 1
Expression of PD-L1 and miR-34a in bladder cancer. (A) Immunohistochemical staining of PD-L1 in 32 bladder tumors and adjacent normal bladder tissues (scale bars: 20 µm). (B) Determination of PD-L1 protein level in 32 tumor and adjacent normal bladder tissue specimens using western blotting. (C) Determining miR-34a expression in 32 tumor and adjacent normal bladder tissue specimens using q-RT-PCR. (D,E) Measuring PD-L1 and miR-34a expression in T24, 5637, and SV-HUC-1 by q-RT-PCR. All quantification levels were normalized to GAPDH and U6. (*p < 0.05, **p < 0.01). Abbreviations: PD-L1: programmed death-ligand 1; q-RT-PCR: quantitative reverse transcription PCR; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.
Expression of PD-L1 and miR-34a in bladder cancer. (A) Immunohistochemical staining of PD-L1 in 32 bladder tumors and adjacent normal bladder tissues (scale bars: 20 µm). (B) Determination of PD-L1 protein level in 32 tumor and adjacent normal bladder tissue specimens using western blotting. (C) Determining miR-34a expression in 32 tumor and adjacent normal bladder tissue specimens using q-RT-PCR. (D,E) Measuring PD-L1 and miR-34a expression in T24, 5637, and SV-HUC-1 by q-RT-PCR. All quantification levels were normalized to GAPDH and U6. (*p < 0.05, **p < 0.01). Abbreviations: PD-L1: programmed death-ligand 1; q-RT-PCR: quantitative reverse transcription PCR; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.Besides that, T24 (poorly differentiated), 5637 (differentiated), and SV-HUC-1 (normal) cell lines were screened. As demonstrated in Figures 1D,E, we found that the T24 cell line had the highest expression of PD-L1 and the lowest level of miR-34a than the 5637 and SV-HUC-1 cell lines. According to these findings, the T24 cell line was chosen for further in vitro studies.
Synthesis and characterization of nano-system
Using siRNA or miRNA to silicate target genes has gained great attention in the tumor therapy (Chakraborty et al., 2017). More importantly, the simultaneous delivery of siRNA and miRNA to target tumor tissues can produce potent combinational effects on the tumor growth repression (Gandhi et al., 2014). In the current project, since low miR-34a and high PD-L1 expression levels were found in the clinical samples and cell lines of bladder cancer, we hypothesized that PD-L1 silencing and miR-34a restoration could improve the therapeutic efficacy in bladder cancer patients. However, efficient combined siRNA and miRNA delivery to cancerous cells is a great challenge to (Wang et al., 2021c). To efficiently deliver PD-L1 and miR-34a, we manufactured MSN nanoparticles which further stabilized with a supporting layer (PEG-PLGA) decorated with c(RGDfK) for targeted co-delivery of miR-34a and siPD-L1 in vitro and in vivo (Scheme 1). For this purpose, porous MSNs were firstly prepared and subsequently functionalized by adding positively amine groups (MSN-NH2). SEM and TEM pictures exhibited uniform and spherical shapes and porous structures within the MSNs with a particle size of around 100–120 nm (Figures 2A,B). FTIR spectrum was also performed to investigate the successful formation of MSN-NH2 nanoparticles. The FTIR spectrum of MSN showed a strong peak around 1,120 cm−1, corresponding to the Si-OH spectrum. Interestingly, cationic MSN nanoparticles indicated a peak around 1,600 cm−1 due to the presence of the NH2 group (Figure 2C).
FIGURE 2
(A) Structural characterization of nano-system. (A) SEM, (B) TEM, and (C) FTIR of MSN NPs. (D) The RNAs mobility using gel retardation assay. (E) TEM image of c(RGDFK)-MSN NPs. (F) Zeta potential of the nanoparticles and the nanocarriers.
(A) Structural characterization of nano-system. (A) SEM, (B) TEM, and (C) FTIR of MSN NPs. (D) The RNAs mobility using gel retardation assay. (E) TEM image of c(RGDFK)-MSN NPs. (F) Zeta potential of the nanoparticles and the nanocarriers.To investigate the ability of the positively-charged MSN-NH2 nanoparticles to form a complex with negatively-charged small RNAs, we prepared Nitrogen/Phosphate (N/P) ratios of MSN-NH2 and miRNA–siRNA combination. We monitored the retardation of RNAs migration using a gel retardation assay. As seen in Figure 2D, siRNAs + miRNAs were immobilized onto the MSN-NH2 nanoparticles at an optimal N/P ratio of 4:1. The decrease in ethidium bromide fluorescence might highlight a strong interaction between the siRNAs + miRNAs and the nano-carrier. After loading miR-34a and PD-L1 siRNA into MSN-NH2 nanoparticles, PLGA-PEG decorated with c(RGDfK) were coated onto the MSNs surfaces. Therefore, the success of PLGA-PEG-c(RGDfK) coating on the surface of MSN was characterized by various techniques. As depicted in Figure 2E, TEM images show nanoparticle size after coating with PLGA-PEG-c(RGDfK), which raised the nanoparticle size to 140–170 nm.In the next experiment, DLS was employed to determine the zeta potential and the average hydrodynamic diameter of the synthesized nano-system. The MSNs-NH2 zeta potential was shifted from +36.41 ± 3.45 mV to −30.56 ± 2.68 mV after loading miRNA + siRNA (Figure 2F). After encapsulation with PLGA-PEG-c(RGDfK) copolymer, the resulting nano-system had a zeta potential of +25.72 ± 5.37 mV, indicating that PLGA-PEG-c(RGDfK) was successfully adsorbed on MSNs surface (Figure 2F). The average hydrodynamic diameters of MSNs, miRNA + siRNA, loaded MSNs and completed MSN NPs were reported to be about 110.23 ± 3.46, 120.75 ± 5.65, and 170.43 ± 6.53 nm, respectively, which were in the suitable size range for migrating easily in the vasculature system of tumors. In addition, the size distribution of c(RGDfK)-MSN NPs was stable in PBS buffer (pH 7.4), and the average size had no significant change for 15 days (Figure 3A).
FIGURE 3
Stability and release study of nano-system. (A) The average size of c(RGDfK)-MSN NPs after incubation with PBS solution for time intervals. (B) The average size of c(RGDfK)-MSN NPs after incubation with 50% serum for time intervals. (C) The ability of c(RGDfK)-MSN NPs to protect miR-34a and siPD-L1 against degradation after incubation with 50% serum for time intervals. (D)
In vitro release of siPD-L1 from c(RGDfK)-MSN NPs in different pH values (pH 7.4 and 5.4). (E)
In vitro release of miR-34a from c(RGDfK)-MSN NPs in different pH values (pH 7.4 and 5.4). Abbreviations: MSNs, mesoporous silica nanoparticles; PBS, phosphate-buffered saline. *p < 0.05 and **p < 0.01 vs. pH 7.4 group.
Stability and release study of nano-system. (A) The average size of c(RGDfK)-MSN NPs after incubation with PBS solution for time intervals. (B) The average size of c(RGDfK)-MSN NPs after incubation with 50% serum for time intervals. (C) The ability of c(RGDfK)-MSN NPs to protect miR-34a and siPD-L1 against degradation after incubation with 50% serum for time intervals. (D)
In vitro release of siPD-L1 from c(RGDfK)-MSN NPs in different pH values (pH 7.4 and 5.4). (E)
In vitro release of miR-34a from c(RGDfK)-MSN NPs in different pH values (pH 7.4 and 5.4). Abbreviations: MSNs, mesoporous silica nanoparticles; PBS, phosphate-buffered saline. *p < 0.05 and **p < 0.01 vs. pH 7.4 group.The desired stability of nano-systems in the systemic circulation is a significant characteristic in the cancer therapy (Li et al., 2021). The nanoparticles interact with blood proteins, and the protein corona is formed on their surface, resulting in the loss of biological activity of nanoparticles and rapid clearance of them from the systemic circulation (Ou et al., 2018). As shown in Figure 3B, MSN NPs indicated suitable stability in 50% serum, and no remarkable changes were observed in the particle size up to 48 h after incubation. These findings suggested that the presence of PEG-PLGA on the surface of MSN NPs could limit the interaction of nanoparticles with serum proteins, which was a vital feature for keeping their stability and activity upon intravenous injection. On the other hand, the naked siRNAs or miRNAs are generally unstable in the blood and rapidly degraded because of nucleases (Chen et al., 2015; Tatiparti et al., 2017). Therefore, the ability of prepared MSN NPs to protect miR-34a and siPD-L1 against degradation in the serum was checked. After incubation in 50% serum, the gel electrophoresis images exhibited that naked miR-34a and naked siPDL-1 were quickly degraded during 1 h of incubation. After incorporating in MSN NPs, the stability of miR-34a and siPD-L1 was increased up to 12 h in serum, revealing that our constructed nano-carriers could protect miR-34a and siPD-L1 against degradation and is appropriate for in vivo delivery of miR-34a and siPD-L1 (Figure 3C).
The pH-sensitive release of siRNA/miRNA
To investigate whether the release of small RNAs from c(RGDfK)-MSN NPs reveals pH-sensitive performance, we evaluated the release capacity of siRNA and miRNA from small RNAs at pH values of 5.4 (acidic lysosomes microenvironment) or 7.4 (physiological environment) (Mendes et al., 2019). Figures 3D,E revealed that the release rate of siRNA and miRNA at pH 7.4 was lower than that at pH 5.4 at 15 h. The rapid release of these small RNAs from c(RGDfK)-MSN NPs nanoparticles could explain that acidic conditions might weaken the interactions between c(RGDfK)-MSN NPs and small RNA, which facilitated the release of siRNAs and miRNAs. Therefore, the acid-sensitive siRNA release feature of c(RGDfK)-MSN NPs could exhibit a favorable advantage in cancer therapy.
In vitro cellular internalization
Because of the specific attachment between αvβ3 integrin and RGD peptide, the RGD tagged NPs have the potent targeting ability towards tumor cells overexpressing αvβ3 integrin (Fu et al., 2019). In recent years, cyclic RDG peptide ligands c(RGD) like c(RGDfK) have been developed for the interaction with integrin αvβ3 expressed on the surface of tumor cells (Liu, 2009). The current study explored the ability of MSN NPs tagged with c(RGDfK) to enter a human T24 cell line. For cellular internalization, the Cy3-labeled siRNA was employed to examine the selectivity of MSN NPs to distinguish normal cells and cancer cells. Confocal pictures indicated that the siRNA was effectively internalized within T24 cells. As can be observed from Figures 4A c(RGDfK)-MSN NPs group exerted a greater green fluorescence signal than that of the MSN NPs group in T24 cells at 6 h. The flow cytometry data analysis also displayed that c(RGDfK)-MSN NPs had greater fluorescence signals than MSN NPs (Figure 4B). These observations showed that c(RGDfK)-MSN NPs could be successfully taken by T24 cells.
FIGURE 4
(A) Confocal microscopy images of T24 cells after incubation with MSNs-Cy3-siRNA and c(RGDfK)-MSNs-Cy3-siRNA for 6 h (green, Cy3; blue, DAPI), scale bar = 20 μm. (B) Flow cytometry analysis of the cellular internalization of (RGDfK)-MSNs-Cy3-siRNA and MSNs-Cy3-siRNA in T24 cells after incubation for 6 h. Abbreviations: MSNs, mesoporous silica nanoparticles; DAPI, 4′,6-diamidino-2-phenylindole.
(A) Confocal microscopy images of T24 cells after incubation with MSNs-Cy3-siRNA and c(RGDfK)-MSNs-Cy3-siRNA for 6 h (green, Cy3; blue, DAPI), scale bar = 20 μm. (B) Flow cytometry analysis of the cellular internalization of (RGDfK)-MSNs-Cy3-siRNA and MSNs-Cy3-siRNA in T24 cells after incubation for 6 h. Abbreviations: MSNs, mesoporous silica nanoparticles; DAPI, 4′,6-diamidino-2-phenylindole.
miR-34a and siPD-L1 expression in vitro analysis
The miR-34a and siPD-L1 expression levels were further investigated. The q-RT-PCR analyses of siPD-L1 and miR-34a indicated lower expression levels of siPD-L1 and higher levels of miR-34a in the c(RGDfK)-MSN NPs treated group compared to MSN NPs treated group and untreated groups (Figures 5A,B). Subsequently, to peruse effects of miR-34a restoration and PD-L1 silencing on cell proliferation, T24 cells were treated with various doses of blank c(RGDfK)-MSN NPs, MSN NPs, and c(RGDfK)-MSN NPs for 24 h and then cell viability was evaluated by an MTT assay kit. As demonstrated in Figure 5C, there were no remarkable changes in cell viability between blank c(RGDfK)-MSN NPs treated cells and untreated groups, suggesting that c(RGDfK)-MSN NPs have almost no cytotoxicity on cells. However, c(RGDfK)-MSN NPs suppressed cell viability with increasing concentration, while MSN NPs had no remarkable effect on cell viability (Figure 5D).
FIGURE 5
Effects of c(RGDfK)-MSNs NPs on the cytotoxicity of T24 cell line. (A) Expression of PD-L1 in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (B) Expression of miR-34a in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (C) Cytotoxicity of blank c(RGDfK)-MSNs NPs detected by MTT assays. (D) Cytotoxicity of T24 cells after incubation with different concentrations of c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (E) Expression of CD44 protein in T24 and SV-HUC 1. (F) Expression of CD44 protein in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. Abbreviations: MSNs, mesoporous silica nanoparticles; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
Effects of c(RGDfK)-MSNs NPs on the cytotoxicity of T24 cell line. (A) Expression of PD-L1 in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (B) Expression of miR-34a in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (C) Cytotoxicity of blank c(RGDfK)-MSNs NPs detected by MTT assays. (D) Cytotoxicity of T24 cells after incubation with different concentrations of c(RGDfK)-MSNs NPs and MSN NPs for 24 h. (E) Expression of CD44 protein in T24 and SV-HUC 1. (F) Expression of CD44 protein in T24 cells after incubation with c(RGDfK)-MSNs NPs and MSN NPs for 24 h. Abbreviations: MSNs, mesoporous silica nanoparticles; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
CD44 expression
To better understand the effects of miR-34a and siPD-L1 on T24 cells, it is necessary to understand the downstream regulation mechanisms of miR-34a and siPD-L1. Notably, miR-34a modulates drug resistance and immune resistance in the human malignancies (Slabáková et al., 2017). In the past years, the anti-metastatic activity of miR-34a has also been corroborated, particularly in the breast cancer (Rui et al., 2018). It has also been found that miR-34a could suppress cell migration and tumor invasion in bladder cancer through down-regulating CD44 expression (Yu et al., 2014). CD44 has been recognized as a stem cell marker and a key gene in diverse aspects of the bladder tumor pathogenesis (Hu et al., 2020). Therefore, we analyzed CD44 expression in the T24 cell line and reported that CD44 was up-regulated in the T24 cell line compared to the SV-HUC-1 cell line (Figure 5E). We further evaluated whether the c(RGDfK)-MSN NPs could repress the expression of CD44 in T24 cells. T24 cells were exposed to c(RGDfK)-MSN NPs and MSN NPs for 24 h, and the expression of CD44 were monitored by Western blotting. As shown in Figure 5F c(RGDfK)-MSN NPs could notably repress the expression of CD44 in T24 cells compared to MSN NPs and untreated cells.
Investigating cell migration and invasion capability
Effective suppression of cancer cell migration and invasion is an effective approach for delaying tumor growth. (Xia et al., 2018). In the current research, T24 cells were treated with c(RGDfK)-MSN NPs or MSN NPs to investigate cell migration and invasion. As seen in Figure 6A, the wound healing findings exhibited that MSN NPs and c(RGDfK)-MSN NPs suppressed the migration of T24 cells for 24 h. Moreover, c(RGDfK)-MSN NPs exhibited a greater capacity to inhibit the migration of T24 cells relative to MSN NPs. Compared to untreated and MSN NPs treated cells, c(RGDfK)-MSN NPs led to a 55% and 45% reduction of migration and invasion in T24 cells, respectively (Figure 6B). MSN NPs revealed a poor capability to suppress migration and invasion, similar to the untreated group.
FIGURE 6
c(RGDfK)-MSN NPs suppressed the migration and invasion of T24 cells. (A) The wound width of T24 cells was photographed after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h (Scale bar is 100 µm). (B) Invasion and migration of T24 cells after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h (Scale bar is 200 µm). (C) EMT-associated protein levels in T24 cells after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h. Data are reported as mean ± SD (**p < 0.01). Abbreviation: MSNs, mesoporous silica nanoparticles.
c(RGDfK)-MSN NPs suppressed the migration and invasion of T24 cells. (A) The wound width of T24 cells was photographed after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h (Scale bar is 100 µm). (B) Invasion and migration of T24 cells after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h (Scale bar is 200 µm). (C) EMT-associated protein levels in T24 cells after incubation with c(RGDfK)-MSN NPs and MSN NPs for 24 h. Data are reported as mean ± SD (**p < 0.01). Abbreviation: MSNs, mesoporous silica nanoparticles.We also measured the EMT-related genes using the western blotting technique, including N-cadherin, Vimentin, and E-Cadherin. Results indicated that cell treatment with c(RGDfK)-MSN NPs could enhance the E-cadherin level and decline the N-cadherin and Vimentin protein levels (Figure 6C) in T24 cells. These findings showed that c(RGDfK)-MSN NPs could suppress EMT in T24 cell lines.
In vivo tumor targeting
To achieve tumor-targeted therapy, the nano-systems should be able to deliver therapeutic agents to the tumor site selectively. Here, we investigated bladder tumor retention of c(RGDfK)-MSN NPs in nude mice bearing T24 cells after tail vein injection. As indicated in Figure 7A, no fluorescence signal was observed in the whole body of PBS-treated mice. However, the moderate fluorescence signals were spread everywhere for 1 h due to the circulation of the nano-system after tail vein injection. At 6 h, a strong fluorescence signal in the tumor site persisted. However, the signal intensity disappeared throughout the body except at the tumor site, possibly due to nanoparticle uptake by the reticuloendothelial system and fluorescence dye release followed by rapid clearance (Kumar et al., 2010; Waegeneers et al., 2018).
FIGURE 7
(A)
In vivo fluorescence imaging from mice injected intravenously with saline and c(RGDfD)-MSN NPs. (B) Tumor volume images, (C) tumor volume curve, (D) body weight curve, and (E) H&E staining and IHC image (×400 magnification) of Ki67 of mice after treatment with PBS, c(RGDfD)-MSN NPs, and MSN NPs. The scale bar is 50 µm.
(A)
In vivo fluorescence imaging from mice injected intravenously with saline and c(RGDfD)-MSN NPs. (B) Tumor volume images, (C) tumor volume curve, (D) body weight curve, and (E) H&E staining and IHC image (×400 magnification) of Ki67 of mice after treatment with PBS, c(RGDfD)-MSN NPs, and MSN NPs. The scale bar is 50 µm.
In vivo anti-tumor effects
Regarding effective in vitro anti-tumorigenesis findings by c(RGDfK)-MSN NPs, we analyzed the in vivo anti-tumor effects of these NPs in the bladder cancer tumor model. The animals were randomly distributed into three groups. They were treated 2 weeks after bladder tumor transplant by receiving intravenous injection via tail once every 3 days as follows: 1) PBS as the control group, 2) MSN NPs, and 3) c(RGDfK)-MSN NPs. After incubation for 21 days, there were significant differences in tumor volume between c(RGDfK)-MSN NPs with PBS and MSN NPs groups (Figures 7B,C). However, the treatment with c(RGDfK)-MSN NPs showed no obvious bodyweight loss relative to the MSN NPs and untreated mice (Figure 7D). Later, we evaluate tumor tissue histology in different groups. Compared to PBS and MSN NPs groups, tumor tissue from c(RGDfK)-MSN NPs treated mice not only had the lowest number of Ki67-positive cells and tumor cells (H&E staining) (Figure 7E).On the other hand, our data also indicated that miR-34a level remarkably increased in mice treated with c(RGDfK)-MSN NPs compared to mice receiving MSN NPs or PBS (Figure 8A). Meanwhile, we examined the effects of c(RGDfK)-MSN NPs treatment on the expression of PD-L1 and CD44 proteins. Relative to PBS and MSN NPs treatment groups, c(RGDfK)-MSN NPs treatment decreased the expression of PD-L1 and CD44 proteins (Figure 8B).
FIGURE 8
Expression of (A) miR-34a, (B) PD-L1 and CD44 protein levels, and (C) EMT-related proteins in the mice after treatment with PBS, c(RGDfD)-MSN NPs, and MSN NPs. (D) Organ indexes of kidney, liver, and spleen.
Expression of (A) miR-34a, (B) PD-L1 and CD44 protein levels, and (C) EMT-related proteins in the mice after treatment with PBS, c(RGDfD)-MSN NPs, and MSN NPs. (D) Organ indexes of kidney, liver, and spleen.The western blotting method determined EMT-related protein levels to detect the delivery efficiency further. The protein level of Vimentin and N-cadherin was significantly lower, and the protein level of E-cadherin was higher in the c(RGDfK)-MSN NPs group than in the PBS group. There was no notable change between the MSN NPs experimental group and the PBS group (Figure 8C).Finally, the indexes of main organs (including liver, kidney, and spleen) were calculated. There were no significant differences in the tissue weight to the body weight ratio of these organs between the experimental and PBS groups (Figure 8D). These results showed that c(RGDfK)-MSN NPs could block tumor growth in vivo without obvious organ toxicity.
Conclusion
In summary, we developed a c(RGDfK) modified MSN NPs to co-deliver miR-34a and siPD-L1 to treat bladder cancer. Moreover, this nano-carrier showed good blood stability and the effective release of loaded miRNAs and siRNAs within tumor cells. With releasing miRNAs and siRNAs, PD-L1 silencing and miR-34a overexpression attenuate the CD44 expression, proliferation, migration, and invasion. In vivo findings verified our hypotheses and indicated effective tumor growth attenuation in a bladder tumor model with insignificant side effects, revealing that our nano-carrier system may lead to great encouragement for treating bladder cancer.
Authors: Jean Philippe Richard; Kamran Melikov; Eric Vives; Corinne Ramos; Birgit Verbeure; Mike J Gait; Leonid V Chernomordik; Bernard Lebleu Journal: J Biol Chem Date: 2002-10-30 Impact factor: 5.157
Authors: Elaine Bigelow; Katherine M Bever; Haiying Xu; Allison Yager; Annie Wu; Janis Taube; Lieping Chen; Elizabeth M Jaffee; Robert A Anders; Lei Zheng Journal: J Vis Exp Date: 2013-01-03 Impact factor: 1.355