| Literature DB >> 35991192 |
Yu Liu1,2,3, Yumeng Zhang1,2,3, Jiongting Fan1,2,3, Hang Zhou1,2,3, Huajing Huang1,2,3, Yixiong Cao1,2,3, Wen Jiang1,2,3, Wei Zhang1,2,3, Junming Deng1,2,3, Beiping Tan1,2,3.
Abstract
An 8-week feeding trial was conducted to investigate the effects of different viscous guar gums on the growth performance, apparent nutrient digestibility, intestinal development and morphology of juvenile largemouth bass. Four isoproteic and isolipidic diets (crude protein 42.5%, crude lipid 13.7%) were formulated to contain 8% cellulose (Control group), 8% low viscous guar gum with 2,500 mPa s (Lvs-GG group), 8% medium viscous guar gum with 5,200 mPa s (Mvs-GG group) and 8% high viscous guar gum with 6,000 mPa s (Hvs-GG group), respectively. Each diet was fed to quadruplicate groups of 40 fish (6.00 ± 0.01 g) per repetition. Dietary guar gum inclusion significantly decreased the weight gain rate, specific growth rate, protein efficiency ratio, protein productive value and lipid deposition rate, and these parameters decreased considerably with increasing guar gum viscous and were lowest in the Hvs-GG group. Dietary guar gum inclusion significantly decreased the apparent digestibility of dry matter, crude protein and crude lipid, and these parameters decreased considerably with increasing guar gum viscous and were lowest in the Hvs-GG group. Intestinal protease, lipase and creatine kinase activities in the guar gum groups were significantly lower than those in the control group, and intestinal protease and lipase activities decreased considerably with increased guar gum viscous. Intestinal alkaline phosphatase activity in the Hvs-GG group and intestinal Na+/K+-ATPase activity in the Mvs-GG and Hvs-GG groups were significantly lower than those in the Lvs-GG and control groups. Serum high-density lipoprotein, total cholesterol and triglyceride concentrations and superoxide dismutase activity in the guar gum groups were significantly lower than those in the control group. Intestinal villus height and muscular thickness in the guar gum groups were considerably higher than those in the control group, whereas the goblet cell relative number in the Mvs-GG and Hvs-GG groups and the microvillus height in the Lvs-GG and Hvs-GG groups were significantly lower than those in the control group. The expression level of IGF-1 in the guar gum groups and the expression level of GLP-2 in the Mvs-GG and Hvs-GG groups were significantly higher than those in the control group. These results indicated that guar gum diets adversely affected intestinal morphology, decreased intestinal digestive and absorptive enzyme activities, and caused poor nutrient digestibility and growth performance in juvenile largemouth bass. Moreover, the adverse effects of guar gum are closely related to its viscous, and high viscous guar gum produces more extreme negative impacts on juvenile largemouth bass.Entities:
Keywords: Micropterus salmoides; apparent digestibility; growth performance; guar gum; intestinal morphology; viscous
Year: 2022 PMID: 35991192 PMCID: PMC9388778 DOI: 10.3389/fphys.2022.927819
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
The formulation and approximately composition of experimental diets (%).
| Group | C | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| Ingredients | ||||
| Fish meal | 45.00 | 45.00 | 45.00 | 45.00 |
| Corn gluten meal | 10.00 | 10.00 | 10.00 | 10.00 |
| Soy protein isolate | 15.00 | 15.00 | 15.00 | 15.00 |
| Fish oil | 4.50 | 4.50 | 4.50 | 4.50 |
| Soy oil | 3.40 | 3.40 | 3.40 | 3.40 |
| Soy lecithin | 1.00 | 1.00 | 1.00 | 1.00 |
| Starch | 10.00 | 10.00 | 10.00 | 10.00 |
| Cellulose | 8.00 | |||
| Lvs-GG | 8.00 | |||
| Mvs-GG | 8.00 | |||
| Hvs-GG | 8.00 | |||
| Ca(H2PO4)2 | 1.00 | 1.00 | 1.00 | 1.00 |
| NaCl | 0.20 | 0.20 | 0.20 | 0.20 |
| Choline chloride | 0.30 | 0.30 | 0.30 | 0.30 |
| Vitamin C | 0.03 | 0.03 | 0.03 | 0.03 |
| Vitamin and Mineral premix | 1.50 | 1.50 | 1.50 | 1.50 |
| Ethoxyquin | 0.02 | 0.02 | 0.02 | 0.02 |
| Yttrium (III) oxide | 0.05 | 0.05 | 0.05 | 0.05 |
| Proximate composition | ||||
| Moisture | 10.69 | 10.76 | 10.73 | 10.80 |
| Crude protein | 42.59 | 42.53 | 42.50 | 42.54 |
| Crude lipid | 13.75 | 13.70 | 13.69 | 13.72 |
| Ash | 9.70 | 9.62 | 9.68 | 9.71 |
| Viscosity (mPa•s) | 5.14 | 102.26 | 221.75 | 385.80 |
Supplied by Zhanjiang Haibao Feed Co., Ltd. (Zhanjiang, China); fish meal, 65.81% crude protein, 7.69% crude lipid.
Supplied by Guangrao Liuhe Chemical Co., Ltd. (Dongying, China).
Supplied by Qingdao Master Biotech (Qingdao, China).
Primer sequences for real-time PCR.
| Gene | Primer type | Sequence 5′-3′ | E-value (%) | Tm (°C) | Accession no. |
|---|---|---|---|---|---|
| Ef1α | Fa | TGCTGCTGGTGTTGGTGAGTT | 97.99 | 61.2 | XM_038724777.1 |
| Ra | TTCTGGCTGTAAGGGGGCTC | ||||
| IGF1 | F | CTTCAAGAGTGCGATGTGC | 97.96 | 59.3 | XM_038736342.1 |
| R | GCCATAGCCTGTTGGTTTACTG | ||||
| GLP-2 | F | CCGAGCAACACTGGTACTGA | 115.63 | 56.6 | XM_038738328.1 |
| R | GCTGAGAGTGAGGTTGACGA |
Fa, forward primer; Ra, reverse primer.
IGF1, insulin-like growth factors -1; GLP-2, Glucagon-like peptide 2.
Effects of different viscous guar gum on growth performance and feed utilization of juvenile largemouth bass.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| FBW (g) | 67.23 ± 1.26 | 56.40 ± 1.42 | 49.60 ± 0.97 | 50.96 ± 1.49 |
| SR | 98.75 ± 1.25 | 98.13 ± 1.20 | 99.38 ± 0.63 | 99.38 ± 0.63 |
| WGR | 1118.50 ± 20.53 | 942.42 ± 24.59 | 852.14 ± 28.32 | 848.99 ± 24.87 |
| SGR | 4.31 ± 0.03 | 4.00 ± 0.05 | 3.82 ± 0.06 | 3.82 ± 0.05 |
| FI | 2.85 ± 0.05 | 3.34 ± 0.08 | 3.69 ± 0.14 | 3.65 ± 0.09 |
| FCR | 0.95 ± 0.02 | 1.16 ± 0.03 | 1.31 ± 0.06 | 1.30 ± 0.04 |
| PER | 2.46 ± 0.05 | 2.04 ± 0.06 | 1.74 ± 0.06 | 1.82 ± 0.06 |
| PDR | 38.57 ± 0.77 | 31.42 ± 0.89 | 27.21 ± 0.93 | 27.53 ± 0.92 |
| LDR | 67.91 ± 1.29 | 44.41 ± 1.21 | 31.87 ± 1.08 | 29.57 ± 0.97 |
FBW, final body weight; SR, survival rate; WGR, weight gain rate; SGR, specific growth rate; FI, feed intake; FCR, feed conversion ratio; PER, protein efficiency ratio; PDR, protein deposition rate; LDR, lipid deposition rate.
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
SR (%) = 100 × the final fish number/the initial fish number.
WGR (%) = 100 × (final body weight—initial body weight)/initial body weight.
SGR (%/d) = 100 × ((ln final body weight)—(ln initial body weight))/d.
FI (% BW/d) = 100 × final body weight/[(final body weight + initial body weight)/2 × d].
FCR, total feed intake (dry matter)/(final biomass—initial biomass + biomass of dead fish).
PER = (final body weight—initial body weight)/total protein intake.
PDR (%) = 100 × (final body weight × final body protein—initial body weight × initial body protein)/total protein intake.
LDR (%) = 100 ×final body weight × final body lipid—initial body weight × initial body lipid)/total lipid intake.
Effects of different viscous guar gum on morphological parameters of juvenile largemouth bass.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| Morphological parameters | ||||
| CF | 2.20 ± 0.04 | 2.12 ± 0.04 | 2.12 ± 0.03 | 2.10 ± 0.03 |
| OI | 8.04 ± 0.13 | 7.64 ± 0.12 | 7.60 ± 0.22 | 7.39 ± 0.12 |
| HSI | 1.86 ± 0.06 | 0.98 ± 0.08 | 0.86 ± 0.04 | 0.76 ± 0.03 |
| VSI | 0.69 ± 0.02 | 1.09 ± 0.03 | 1.21 ± 0.03 | 1.26 ± 0.03 |
| ILI | 0.86 ± 0.01 | 0.96 ± 0.14 | 0.94 ± 0.01 | 0.95 ± 0.02 |
| Body composition, % | ||||
| Moisture | 72.01 ± 1.06 | 72.59 ± 0.92 | 72.70 ± 1.12 | 73.73 ± 1.27 |
| Crude protein | 15.66 ± 0.20 | 15.29 ± 0.18 | 15.73 ± 0.17 | 15.79 ± 0.04 |
| Crude lipid | 8.53 ± 0.09 | 7.39 ± 0.08 | 7.33 ± 0.20 | 6.68 ± 0.03 |
| Ash | 4.06 ± 0.20 | 3.97 ± 0.12 | 4.10 ± 0.15 | 4.10 ± 0.12 |
CF, condition factor; OI: organ index; HSI, hepasomatic index; VSI, viserosomatic index; ILI, intestinal length index.
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
CF (g/cm3) = body weight/(body length)3.
OI (%) = 100 × visceral weight/body weight.
HSI (%) = 100 × hepatic weight/body weight.
VSI (%) = 100 × intestinal weight/body weight.
ILI (%) = 100 × intestinal length/body length.
Effects of different viscous guar gum on nutrient apparent digestibility of juvenile largemouth bass.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| Dry matter (%) | 85.52 ± 1.24c | 80.32 ± 0.60b | 74.42 ± 0.26a | 73.98 ± 0.45a |
| Crude protein (%) | 91.32 ± 0.36c | 84.36 ± 1.07b | 80.10 ± 0.25a | 80.65 ± 0.75a |
| Crude lipid (%) | 90.88 ± 0.2c | 82.66 ± 0.48b | 71.54 ± 0.40a | 72.05 ± 0.56a |
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
Apparent digestibility coefficient of dry matter (%) = 100 × [1– (dietary Y2O3 level/feces Y2O3 level)].
Apparent digestibility coefficient of nutrients (%) = 100 × [1– (dietary Y2O3 level/feces Y2O3 level) × (feces nutrient level/dietary nutrient level)].
Effects of different viscous guar gum on intestinal digestive and absorptive enzyme activities.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| Protease (U/g protein) | 4.55 ± 0.14c | 4.09 ± 0.13b | 3.53 ± 0.26a | 3.37 ± 0.17a |
| Lipase (U/g protein) | 0.85 ± 0.04c | 0.77 ± 0.05bc | 0.71 ± 0.03b | 0.53 ± 0.02a |
| Amylase (U/g protein) | 0.33 ± 0.04 | 0.35 ± 0.04 | 0.32 ± 0.03 | 0.28 ± 0.03 |
| Creatine kinase (U/mg protein) | 0.16 ± 0.02b | 0.12 ± 0.02a | 0.12 ± 0.01a | 0.11 ± 0.01a |
| Na+/K+-ATPase (U/mg protein) | 24.37 ± 1.44b | 22.54 ± 0.72b | 22.11 ± 0.81ab | 19.42 ± 0.37a |
| Alkaline phosphatase (U/g protein) | 145.63 ± 5.69b | 158.22 ± 5.29b | 133.04 ± 3.01a | 132.11 ± 5.01a |
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
Effects of different viscous guar gum on serum biochemical parameters of juvenile largemouth bass.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| HDL-C (mmol/L) | 5.11 ± 0.63b | 3.66 ± 0.37a | 3.50 ± 0.23a | 3.40 ± 0.19a |
| LDL-C (mmol/L) | 3.53 ± 0.23 | 3.24 ± 0.34 | 3.26 ± 0.06 | 3.26 ± 0.41 |
| T-CHO (mmol/L) | 10.75 ± 0.60b | 7.41 ± 0.54a | 7.26 ± 0.29a | 7.53 ± 0.50a |
| TG (mmol/L) | 10.17 ± 0.75c | 8.88 ± 0.34b | 7.18 ± 0.17a | 6.94 ± 0.23a |
| ALT (U/L) | 3.84 ± 0.15a | 4.40 ± 0.42a | 3.77 ± 0.37a | 6.64 ± 0.34b |
| AST (U/L) | 15.75 ± 0.40 | 15.68 ± 1.09 | 14.90 ± 1.84 | 15.79 ± 0.97 |
| SOD (U/mL) | 217.72 ± 10.52b | 174.30 ± 6.55a | 180.47 ± 5.28a | 169.16 ± 6.50a |
| MDA (nmol/ml) | 19.23 ± 1.20a | 19.37 ± 1.62a | 35.14 ± 1.56b | 34.23 ± 0.90b |
| CAT(U/ml) | 6.23 ± 0.26 | 6.61 ± 0.25 | 6.46 ± 0.28 | 6.79 ± 0.25 |
| POD (U/ml) | 1.31 ± 0.04 | 1.29 ± 0.04 | 1.25 ± 0.03 | 1.30 ± 0.03 |
HDL-C, high-density lipoprotein; LDL-C, low-density lipoprotein; T-CHO, total cholesterol; TG, triglyceride; MDA, malondialdehyde: ALT, alanine aminotransferase; AST, aspartate aminotransferase; POD, peroxidase; CAT, catalase; SOD, superoxide dismutase.
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
FIGURE 1Effects of increasing dietary guar gum viscous on hindgut morphology of juvenile largemouth bass (H&E staining, magnification ×200). Yellow double-side arrow: villus width; Red double-side arrow: villus height; green double-side arrow: muscularis thickness; blue double-side arrow: crypt depth; blue arrow: goblet cell.
FIGURE 2Effects of increasing dietary guar gum viscous on hindgut morphology of juvenile largemouth bass (Transmission electron microscope observation, magnification ×7,000). Yellow double-side arrow: microvillus height; black arrow: epithelial cell death; red arrow: epithelial cell interval.
Effects of different viscous guar gum on hindgut morphology of juvenile largemouth bass.
| Group | Control | Lvs-GG | Mvs-GG | Hvs-GG |
|---|---|---|---|---|
| Villus height (μm) | 518.35 ± 24.40a | 646.97 ± 18.27b | 625.79 ± 26.57b | 629.12 ± 22.00b |
| Villus width (μm) | 103.45 ± 13.28 | 98.47 ± 5.42 | 99.60 ± 10.54 | 107.94 ± 7.05 |
| crypt depth (μm) | 25.59 ± 3.14 | 23.69 ± 1.62 | 23.26 ± 1.58 | 23.89 ± 1.50 |
| Muscularis thickness (μm) | 110.06 ± 6.48a | 132.71 ± 6.07b | 147.71 ± 7.88b | 133.82 ± 4.45b |
| Goblet cell relative number (per 100 μm) | 17.00 ± 0.50b | 16.29 ± 0.72b | 12.50 ± 0.65a | 13.20 ± 0.49a |
| Microvillus height (μm) | 1.31 ± 0.03b | 1.16 ± 0.04a | - | 1.22 ± 0.05a |
Values are presented as means ± S.E.M (n = 4). Different superscript letters in the same row means there was a significant difference between data (p < 0.05).
FIGURE 3Effects of increasing dietary guar gum viscous on the expression levels of intestinal IGF1 and GLP-2 in juvenile largemouth bass fed different viscous guar gum. Bars represent the mean ± SEM (n = 4), and different superscript letters represent significant differences between treatments (p < 0.05).