Literature DB >> 35983991

HLJ1 amplifies endotoxin-induced sepsis severity by promoting IL-12 heterodimerization in macrophages.

Wei-Jia Luo1, Sung-Liang Yu1,2,3, Chia-Ching Chang1, Min-Hui Chien1, Ya-Ling Chang1,2, Keng-Mao Liao4, Pei-Chun Lin3, Kuei-Pin Chung3, Ya-Hui Chuang1, Jeremy J W Chen5, Pan-Chyr Yang6,7, Kang-Yi Su1,2,3,4.   

Abstract

Heat shock protein (HSP) 40 has emerged as a key factor in both innate and adaptive immunity, whereas the role of HLJ1, a molecular chaperone in HSP40 family, in modulating endotoxin-induced sepsis severity is still unclear. During lipopolysaccharide (LPS)-induced endotoxic shock, HLJ1 knockout mice shows reduced organ injury and IFN-γ (interferon-γ)-dependent mortality. Using single-cell RNA sequencing, we characterize mouse liver nonparenchymal cell populations under LPS stimulation, and show that HLJ1 deletion affected IFN-γ-related gene signatures in distinct immune cell clusters. In CLP models, HLJ1 deletion reduces IFN-γ expression and sepsis mortality rate when mice are treated with antibiotics. HLJ1 deficiency also leads to reduced serum levels of IL-12 in LPS-treated mice, contributing to dampened production of IFN-γ in natural killer cells but not CD4+ or CD8+ T cells, and subsequently to improved survival rate. Adoptive transfer of HLJ1-deleted macrophages into LPS-treated mice results in reduced IL-12 and IFN-γ levels and protects the mice from IFN-γ-dependent mortality. In the context of molecular mechanisms, HLJ1 is an LPS-inducible protein in macrophages and converts misfolded IL-12p35 homodimers to monomers, which maintains bioactive IL-12p70 heterodimerization and secretion. This study suggests HLJ1 causes IFN-γ-dependent septic lethality by promoting IL-12 heterodimerization, and targeting HLJ1 has therapeutic potential in inflammatory diseases involving activated IL-12/IFN-γ axis.
© 2022, Luo et al.

Entities:  

Keywords:  DNAJB4; HLJ1; IFN-γ; IL-12; cell biology; immunology; inflammation; lipopolysaccharide; mouse; sepsis

Mesh:

Substances:

Year:  2022        PMID: 35983991      PMCID: PMC9457701          DOI: 10.7554/eLife.76094

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection (Singer et al., 2016). In intensive care patients, sepsis is the single most encountered cause of death (Mayr et al., 2014). Although sepsis is a biphasic disorder characterized by an initial hyperinflammatory phase followed by an immunosuppressive phase, studies have shown both pro- and anti-inflammatory responses occur early and simultaneously where the net effect of the competing process is typically dominated by a hyperinflammatory phase featuring shock and fever (Hotchkiss et al., 2013; Munford and Pugin, 2001; Kurosawa et al., 2011). Investigators have recently proposed that immune response in sepsis features protracted, unabated inflammation driven by the innate immune system, leading to organ dysfunction and even mortality (Xiao et al., 2011). Septic shock contributing to failure of vital organs and hypotension is the common cause of death in ICU and is usually caused by systemic Gram-negative bacterial infection (Chiche et al., 2011). Engagement of lipopolysaccharide (LPS), the membrane component of bacteria, to TLR4 in macrophages transduces signals to intracellular proteins, resulting in downstream expression of proinflammatory cytokines such as IL-1, IL-6, IL-12, and IL-18 (Beutler and Rietschel, 2003). Produced by APCs (antigen-presenting cells), IL-12 activates natural killer (NK) cells and induces the differentiation of naive CD4+ T cells to become IFN-γ-producing Th1 effector cells in responses to pathogens (Schenten and Medzhitov, 2011). In a positive feedback loop, secreted IFN-γ augments IL-12 production by priming IL-12p40 gene promoter in APCs (Grohmann et al., 2001). The IL-12/IFN-γ axis-mediated communication between innate and adaptive immunity plays an important role in the control of infections by mycobacteria and other intracellular bacteria such as Salmonella (Ramirez-Alejo and Santos-Argumedo, 2014). In models of sterile sepsis and chronic bacterial infection, the IL-12/18-IFN-γ axis is controlled by ARTD1 in myeloid cells, contributing to TH1 response and immune control of the bacteria (Kunze et al., 2019). However, the pathogenic role of IFN-γ has been implicated during CLP-induced septic shock where IFN-γ knockout mice showed lower levels of IL-6 and MIP-2 in the circulation and are resistant to CLP-induced mortality when treated with systemic antibiotics (Romero et al., 2010). The inhibition of IFN-γ activity by neutralizing antibodies improves survival and attenuates CLP-induced sepsis in rat, while it does not reduce CLP-related mortality in mice (Romero et al., 2010; Yin et al., 2005). Despite abundant studies describe IFN-γ as immune modulator in sepsis, little is known about the precise pathogenic role of IL-12/IFN-γ axis, and the underlying molecular mechanisms responsible for IL-12-mediated septic shock remains to be clarified. Heat shock proteins (HSPs) can be upregulated under cellular-stress conditions, such as oxidative stress, hypoxia, fever, and inflammation, and they act as chaperones to maintain the functions of cytosolic proteins (Georgopoulos and Welch, 1993; Rosenzweig et al., 2019). Human liver DnaJ-like protein (HLJ1) is a member of heat shock protein 40 family (HSP40) and is also known as DNAJB4. In humans, HLJ1 is a tumor suppressor in non-small-cell lung cancer and colorectal cancer, since its upregulation suppresses tumor invasion and high expression of HLJ1 is associated with prolonged survival of patients (Liu et al., 2014; Tsai et al., 2006; Wang et al., 2005). However, the actual immunomodulatory role of HLJ1 in sepsis remains unclear. Recently, chaperones have emerged as mediators of IL-12 family protein folding, assembly, and degradation (Meier et al., 2019; Reitberger et al., 2017). DnaJ HSP40 member C10 (DNAJC10), also known as ERdj5, has been shown to reduce disulfide bonding in non-native homodimeric IL-12p35 to low-molecular-weight (LMW) IL-12p35 monomers (Reitberger et al., 2017). Despite a growing understanding of chaperone-mediated IL-12 family protein folding and assembly, the precise mechanisms by which HLJ1 regulates IL-12 biosynthesis and the subsequent immune response during sepsis have not yet been elucidated. We demonstrated that HLJ1 knockout in mice protects against LPS- and CLP-induced organ injury and mortality through IFN-γ downregulation. With single-cell RNA sequencing (scRNA-seq) analysis, we uncovered the immune profile affected by HLJ1 under LPS stress and found the alteration of IFN-γ-related gene signature in NK cells where HLJ1 had been deleted. In macrophages, LPS-inducible HLJ1 reduced the accumulation of misfolded IL-12p35 homodimer and enhanced IL-12p70 dimerization, leading to augmented IFN-γ production and sepsis-related mortality. The study reveals the previously unknown role of HLJ1 in promoting IFN-γ-dependent sepsis death through regulating IL-12 folding and biosynthesis in macrophages. Therefore, targeting HLJ1 provides a strategy for developing therapeutic approaches to inflammatory diseases involving activated IL-12/IFN-γ axis.

Results

HLJ1 deficiency protected mice against lethal endotoxic shock

To address the question of whether HLJ1 participates in regulating LPS-induced systemic inflammatory responses, HLJ1-deficient (Dnajb4) mice and wild-type littermates (Dnajb4) were intraperitoneally injected with LPS derived from Gram-negative bacteria. Dnajb4 and Dnajb4 mice showed similar survival rates when LD50 dose of LPS (10 mg/kg) was used (Figure 1A), but Dnajb4 mice were significantly more resistant to LPS-induced sepsis and exhibited longer survival than Dnajb4 mice when subjected to a higher lethal dose of LPS (20 mg/kg) (Figure 1B). Since LPS is known to induce systemic immune responses, we analyzed complete blood counts (CBCs) of peripheral blood and pathological changes in the mice injected with LPS. The two genotypes had similar counts and percentages of white blood cells, neutrophils, lymphocytes, monocytes, and eosinophils at 4 and 8 hr post-LPS injection (Figure 1—figure supplement 1A). Although LPS is known to cause liver dysfunction and damage, serum aspartate transaminase (ALT) levels, an indicator of liver damage, were slightly reduced in Dnajb4 mice at 8 hr after LPS injection (Figure 1—figure supplement 1B). Since LPS possesses a high affinity for high-density lipoprotein (HDL) and low-density lipoprotein (LDL), causing it to be carried in the circulation and transported to the liver, we also examined serum levels of HDL and LDL. The quantities of both lipoproteins were slightly reduced at 4 hr postinjection, but there was no difference between the two genotypes (Figure 1—figure supplement 1C).
Figure 1.

HLJ1 deletion protects against lipopolysaccharide (LPS)-induced organ injury and mortality.

Dnajb4 mice survive better than Dnajb4 mice after high-dose LPS injection. Kaplan–Meier analysis of the overall survival of 6- to 8-week-old Dnajb4 mice and Dnajb4 mice injected with (A) LD50 (10 mg/kg, n = 10–11 mice/group) or (B) high-dose (20 mg/kg, n = 19 mice/group) LPS. Log-rank Mantel-Cox test was used to compare survival curve. (C) Mice were i.p. injected with low-dose LPS (4 mg/kg) and after 24 hr serum levels of organ dysfunction markers BUN, creatinine, ALT, and AST were analyzed from n = 5–6 mice group. BUN, p = 0.037; creatinine, p = 0.048; ALT, p = 0.049; AST, p = 0.060. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05; ns, not significant. (D) Representative images of H&E staining of kidney sections from mice treated with 4 mg/kg LPS. Scale bar: 200 μm. Black arrows indicate kidney injury.

(A) Six to eight weeks Dnajb4 and Dnajb4 mice were injected with lipopolysaccharide (LPS) of high dose (20 mg/kg). After 4 and 8 hr, blood was collected for analyzing percentage and counts of neutrophils (NEUT), lymphocytes (LYMPH), monocytes (MONO), eosinophils (EOS), and white blood cells (WBC) (n = 5–7 mice). (B) Serum from LPS-injected mice (n = 5–9) were analyzed for ALT levels. (C) Serum from n = 5–10 LPS-injected mice were analyzed for HDL and LDL levels. Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Figure 1—figure supplement 1.

CBC counts, serum ALT, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) levels of Dnajb4 and Dnajb4 mice.

(A) Six to eight weeks Dnajb4 and Dnajb4 mice were injected with lipopolysaccharide (LPS) of high dose (20 mg/kg). After 4 and 8 hr, blood was collected for analyzing percentage and counts of neutrophils (NEUT), lymphocytes (LYMPH), monocytes (MONO), eosinophils (EOS), and white blood cells (WBC) (n = 5–7 mice). (B) Serum from LPS-injected mice (n = 5–9) were analyzed for ALT levels. (C) Serum from n = 5–10 LPS-injected mice were analyzed for HDL and LDL levels. Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

HLJ1 deletion protects against lipopolysaccharide (LPS)-induced organ injury and mortality.

Dnajb4 mice survive better than Dnajb4 mice after high-dose LPS injection. Kaplan–Meier analysis of the overall survival of 6- to 8-week-old Dnajb4 mice and Dnajb4 mice injected with (A) LD50 (10 mg/kg, n = 10–11 mice/group) or (B) high-dose (20 mg/kg, n = 19 mice/group) LPS. Log-rank Mantel-Cox test was used to compare survival curve. (C) Mice were i.p. injected with low-dose LPS (4 mg/kg) and after 24 hr serum levels of organ dysfunction markers BUN, creatinine, ALT, and AST were analyzed from n = 5–6 mice group. BUN, p = 0.037; creatinine, p = 0.048; ALT, p = 0.049; AST, p = 0.060. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05; ns, not significant. (D) Representative images of H&E staining of kidney sections from mice treated with 4 mg/kg LPS. Scale bar: 200 μm. Black arrows indicate kidney injury.

CBC counts, serum ALT, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) levels of Dnajb4 and Dnajb4 mice.

(A) Six to eight weeks Dnajb4 and Dnajb4 mice were injected with lipopolysaccharide (LPS) of high dose (20 mg/kg). After 4 and 8 hr, blood was collected for analyzing percentage and counts of neutrophils (NEUT), lymphocytes (LYMPH), monocytes (MONO), eosinophils (EOS), and white blood cells (WBC) (n = 5–7 mice). (B) Serum from LPS-injected mice (n = 5–9) were analyzed for ALT levels. (C) Serum from n = 5–10 LPS-injected mice were analyzed for HDL and LDL levels. Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. The effect of HLJ1 deletion on organ dysfunction was also demonstrated by using a non-lethal dosage of LPS (4 mg/kg) which was able to cause moderate endotoxemia and resemble human endotoxemia. At 24 hr after LPS administration, Dnajb4 mice exhibited significantly lower serum levels of BUN, creatinine, and ALT when comparing to Dnajb4+/+ mice (Figure 1C). H&E staining showed kidney injury at the histology level after LPS treatment, while Dnajb4 mice showed less severe kidney injury than Dnajb4 mice (Figure 1D). These results indicated the organ dysfunction caused by LPS can be alleviated after HLJ1 deletion.

HLJ1 deletion alleviates IFN-γ-dependent septic death

Cytokine overproduction caused by a dysregulated immune response to infection is a cause of septic shock and multiple organ failure, and can contribute to sepsis-associated death. It is thus important to quantify cytokine levels during the endotoxemia. We thus used a bead-based immunoassay to determine serum levels of multiple LPS-induced cytokines and chemokines. IL-1α levels decreased significantly in Dnajb4 mice (Figure 2A). Notably, Dnajb4 mice showed significantly lower serum levels of IFN-γ when compared with Dnajb4 mice. We further confirmed the result via ELISA and found that, indeed, serum IFN-γ levels were significantly lower in Dnajb4 mice than in Dnajb4 mice (Figure 2B), whereas no difference was observed in IL-1α levels between the two genotypes after LPS induction (Figure 2—figure supplement 1A). The effect of HLJ1 deletion on IFN-γ production was also demonstrated by using a lower dose of LPS (4 mg/kg) which was able to cause moderate endotoxemia. In line with the effects found during severe endotoxemia, HLJ1 deletion led to reduced serum levels of IFN-γ when mice were challenged with a non-lethal dose of LPS (Figure 2C). To confirm that the mitigation of LPS-induced septic death in Dnajb4 mice was not due to a change in their susceptibility to IFN-γ, we analyzed the correlation between serum levels of IFN-γ and survival status (Figure 2D). As it turned out, mice bearing high serum levels of IFN-γ died, while those with low levels survived, regardless of genotype, suggesting that HLJ1 deletion does not confer increased susceptibility to IFN-γ. When Dnajb4 mice were injected with anti-IFN-γ neutralizing antibodies prior to LPS treatment, they exhibited significantly improved survival (Figure 2E). However, the survival rate of Dnajb4 mice was only slightly improved after IFN-γ neutralization. These results indicated that HLJ1 enhanced septic death by augmenting IFN-γ signaling.
Figure 2.

HLJ1 deletion alleviates IFN-γ-dependent sepsis death.

(A) Serum from Dnajb4 and Dnajb4 mice administered with lipopolysaccharide (LPS) was analyzed at the indicated time points to quantify 11 cytokines via a cytokine bead array. IL-1α, p = 0.03; 4 hr IFN-γ, p = 0.027; 8 hr IFN-γ, p = 0.04; n = 5–8 per group. (B) Serum IFN-γ levels were quantified using ELISA 8 hr (n = 20–22) and 18 hr (n = 8–9) after LPS injection. 8 hr IFN-γ, p < 0.001; 18 hr IFN-γ, p = 0.039. (C) Mice (n = 8 biological replicates) were injected with lower dose 4 mg/kg LPS and after 8 hr serum was collected for quantification of IFN-γ levels. p = 0.005. (D) Correlation between survival status and serum IFN-γ levels in Dnajb4 and Dnajb4 mice injected with 20 mg/kg LPS (n = 6 mice/group). (E) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice (n = 9–10) injected with 100 μg anti-IFN-γ neutralizing antibodies 1 hr before LPS (20 mg/kg) challenge. Dnajb4 versus Dnajb4 mice, p = 0.015; Dnajb4 versus Dnajb4+anti-IFN-γ, p = 0.007. Data presented are means ± standard deviation (SD). Significance was calculated by using two-tailed, unpaired Student’t t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001.

(A) Serum IL-1α levels from n = 8–9 mice were quantified 8 hr after 20 mg/kg lipopolysaccharide (LPS) injection. (B) After 4 or 8 hr, the RNA from n = 6–8 total livers were isolated and gene expression levels were quantified via quantitative real-time PCR (qRT-PCR). IL-6, p = 0.033. (C) Serum levels of IL-6 in Dnajb4 and Dnajb4 mice were quantified via ELISA 4 hr (n = 11–14) and 8 hr (n = 4–7) after LPS administration. (D) Quantification of liver-resident macrophages in LPS-challenged mice. Representative photographs of F4/80 immunofluorescence staining from liver sections of phosphate-buffered saline (PBS) or LPS-injected Dnajb4 and Dnajb4 mice. Eight hours after LPS injection, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (E) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Data are mean ± standard deviation (SD). Significance was calculated by using two-tailed, unpaired Student’t t-test. *p < 0.05.

Figure 2—figure supplement 1.

Inflammatory cytokine expression and macrophage numbers were unchanged in the liver of sepsis mice.

(A) Serum IL-1α levels from n = 8–9 mice were quantified 8 hr after 20 mg/kg lipopolysaccharide (LPS) injection. (B) After 4 or 8 hr, the RNA from n = 6–8 total livers were isolated and gene expression levels were quantified via quantitative real-time PCR (qRT-PCR). IL-6, p = 0.033. (C) Serum levels of IL-6 in Dnajb4 and Dnajb4 mice were quantified via ELISA 4 hr (n = 11–14) and 8 hr (n = 4–7) after LPS administration. (D) Quantification of liver-resident macrophages in LPS-challenged mice. Representative photographs of F4/80 immunofluorescence staining from liver sections of phosphate-buffered saline (PBS) or LPS-injected Dnajb4 and Dnajb4 mice. Eight hours after LPS injection, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (E) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Data are mean ± standard deviation (SD). Significance was calculated by using two-tailed, unpaired Student’t t-test. *p < 0.05.

HLJ1 deletion alleviates IFN-γ-dependent sepsis death.

(A) Serum from Dnajb4 and Dnajb4 mice administered with lipopolysaccharide (LPS) was analyzed at the indicated time points to quantify 11 cytokines via a cytokine bead array. IL-1α, p = 0.03; 4 hr IFN-γ, p = 0.027; 8 hr IFN-γ, p = 0.04; n = 5–8 per group. (B) Serum IFN-γ levels were quantified using ELISA 8 hr (n = 20–22) and 18 hr (n = 8–9) after LPS injection. 8 hr IFN-γ, p < 0.001; 18 hr IFN-γ, p = 0.039. (C) Mice (n = 8 biological replicates) were injected with lower dose 4 mg/kg LPS and after 8 hr serum was collected for quantification of IFN-γ levels. p = 0.005. (D) Correlation between survival status and serum IFN-γ levels in Dnajb4 and Dnajb4 mice injected with 20 mg/kg LPS (n = 6 mice/group). (E) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice (n = 9–10) injected with 100 μg anti-IFN-γ neutralizing antibodies 1 hr before LPS (20 mg/kg) challenge. Dnajb4 versus Dnajb4 mice, p = 0.015; Dnajb4 versus Dnajb4+anti-IFN-γ, p = 0.007. Data presented are means ± standard deviation (SD). Significance was calculated by using two-tailed, unpaired Student’t t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001.

Inflammatory cytokine expression and macrophage numbers were unchanged in the liver of sepsis mice.

(A) Serum IL-1α levels from n = 8–9 mice were quantified 8 hr after 20 mg/kg lipopolysaccharide (LPS) injection. (B) After 4 or 8 hr, the RNA from n = 6–8 total livers were isolated and gene expression levels were quantified via quantitative real-time PCR (qRT-PCR). IL-6, p = 0.033. (C) Serum levels of IL-6 in Dnajb4 and Dnajb4 mice were quantified via ELISA 4 hr (n = 11–14) and 8 hr (n = 4–7) after LPS administration. (D) Quantification of liver-resident macrophages in LPS-challenged mice. Representative photographs of F4/80 immunofluorescence staining from liver sections of phosphate-buffered saline (PBS) or LPS-injected Dnajb4 and Dnajb4 mice. Eight hours after LPS injection, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (E) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Data are mean ± standard deviation (SD). Significance was calculated by using two-tailed, unpaired Student’t t-test. *p < 0.05. Since LPS-induced inflammatory liver injury features activation of the NF-κB pathway and the production of multiple inflammatory cytokines for subsequent IFN-γ activation, we next focused on the cytokines and chemokines generated by hepatic macrophages after LPS stimulation. Transcription levels of proinflammatory cytokines IL-1β, TNF-α, and MCP-1 did not differ significantly between genotypes, but IL-6 was downregulated in Dnajb4 livers compared with Dnajb4 livers (Figure 2—figure supplement 1B). Serum levels of IL-6 were slightly lower in Dnajb4 mice than in Dnajb4 mice after LPS challenge (Figure 2—figure supplement 1C). Kupffer cells are the macrophages of the liver, and they are responsible for clearing bacteria and endotoxins from the blood stream. In response to LPS stimulation, liver-resident Kupffer cells release proinflammatory cytokines and nitric oxide to initiate the inflammatory cascade. We therefore examined the number of Kupffer cells and liver mononuclear cells via F4/80 fluorescent staining, which showed no significant difference between Dnajb4 and Dnajb4 mice (Figure 2—figure supplement 1D, E). This suggested that HLJ1 deficiency has little impact on macrophage infiltration before and after LPS administration.

HLJ1 deficiency resulted in reduced IFN-γ-related signatures in scRNA-seq analysis

To comprehensively identify HLJ1 as a potential immune modulator in specific immune cells, as well as to understand the underlying mechanism by which HLJ1 regulates LPS-induced immune responses in the liver, we performed a scRNA-seq analysis of hepatic nonparenchymal cells. We acquired a t-distributed stochastic neighbor embedding (t-SNE) map of 11,651 single-cell transcriptomes from the livers of Dnajb4 and Dnajb4 mice injected with either LPS or saline (Figure 3A). Since apoptotic mammalian cells express mitochondrial genes and export the gene transcripts to the cytoplasm, we performed quality control to exclude cells with high levels of mtDNA expression and retain only high-quality cells (Figure 3—figure supplement 1A, right panel). We also excluded cells with excessive unique molecular identifier (UMI) counts and genes (Figure 3—figure supplement 1A, left and middle panel). The 1917 excluded cells appeared to uniformly distributed across genotypes (Figure 3—figure supplement 1B). Distinct clusters on the t-SNE visualization revealed nine cell types that were identified based on well-known marker genes published in previous studies (Xiong et al., 2011; Zhao et al., 2011; Figure 3, Figure 3—figure supplement 1C, D). LPS stimulation significantly altered gene expression and cell clustering patterns in both genotypes (Figure 3A). HLJ1 was abundant in all cell types, without significant differences among clusters (Figure 3C). We analyzed differentially expressed genes with absolute log-fold changes greater than 0.25 and p values less than 0.05 after LPS induction based on their cell type. In LPS-treated mice, HLJ1 deletion led to most genes being significantly upregulated in dendritic cells, followed by macrophages, and then B cells; on the other hand, downregulated genes were mainly found in macrophages, dendritic cells, and neutrophils (Figure 3D). We therefore selected genes with significant changes in macrophages and dendritic cells for pathway analysis.
Figure 3.

Single-cell RNA sequencing (scRNA-seq) reveals activated IFN-γ-mediated signaling pathways in macrophages and dendritic cells.

(A) Mice were injected with 20 mg/kg lipopolysaccharide (LPS), or phosphate-buffered saline (PBS) as a control, and after 8 hr hepatic nonparenchymal cells were isolated for scRNA-seq analysis. The plot shows the t-distributed stochastic neighbor embedding (t-SNE) visualization of liver nonparenchymal cell clusters based on 11,651 single-cell transcriptomes. B, B cells; T, T cells; NK, NK cells; HSC, hepatic stellate cells; Div, dividing cells; DC, dendritic cells; Mac, macrophages; Neut, neutrophils; PLT, platelets. (B) Expression levels of representative known marker genes for each cluster. (C) Visualization of expression distribution of the Dnajb4 gene in each cluster of cells in PBS-treated Dnajb4 mice. Data presented are means ± standard deviation (SD). (D) Cell-type distribution and log-transformed expression fold change (logFC) for upregulated (red) and downregulated (blue) genes from a comparison of LPS-treated Dnajb4 mice with LPS-treated Dnajb4 mice. The Wilcoxon rank-sum test was used to identify differentially expressed genes (p < 0.05, |logFC| > 0.25). Enrichment analysis showing ranked pathway signatures associated with up- and downregulated genes (p < 0.05, |logFC| > 0.25) from a comparison of macrophages (E) and dendritic cells (F) from LPS-injected Dnajb4 mice with those from Dnajb4 mice.

(A) Cells with unique molecular identifier (UMI) count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes were excluded. (B) t-Distributed stochastic neighbor embedding (t-SNE) visualization of 1917 excluded cells in which UMI count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes. (C) Heat map and (D) dot plot of known marker genes expression in each cell cluster.

Figure 3—figure supplement 1.

Quality control of single-cell RNA sequencing (scRNA-seq) data.

(A) Cells with unique molecular identifier (UMI) count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes were excluded. (B) t-Distributed stochastic neighbor embedding (t-SNE) visualization of 1917 excluded cells in which UMI count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes. (C) Heat map and (D) dot plot of known marker genes expression in each cell cluster.

Single-cell RNA sequencing (scRNA-seq) reveals activated IFN-γ-mediated signaling pathways in macrophages and dendritic cells.

(A) Mice were injected with 20 mg/kg lipopolysaccharide (LPS), or phosphate-buffered saline (PBS) as a control, and after 8 hr hepatic nonparenchymal cells were isolated for scRNA-seq analysis. The plot shows the t-distributed stochastic neighbor embedding (t-SNE) visualization of liver nonparenchymal cell clusters based on 11,651 single-cell transcriptomes. B, B cells; T, T cells; NK, NK cells; HSC, hepatic stellate cells; Div, dividing cells; DC, dendritic cells; Mac, macrophages; Neut, neutrophils; PLT, platelets. (B) Expression levels of representative known marker genes for each cluster. (C) Visualization of expression distribution of the Dnajb4 gene in each cluster of cells in PBS-treated Dnajb4 mice. Data presented are means ± standard deviation (SD). (D) Cell-type distribution and log-transformed expression fold change (logFC) for upregulated (red) and downregulated (blue) genes from a comparison of LPS-treated Dnajb4 mice with LPS-treated Dnajb4 mice. The Wilcoxon rank-sum test was used to identify differentially expressed genes (p < 0.05, |logFC| > 0.25). Enrichment analysis showing ranked pathway signatures associated with up- and downregulated genes (p < 0.05, |logFC| > 0.25) from a comparison of macrophages (E) and dendritic cells (F) from LPS-injected Dnajb4 mice with those from Dnajb4 mice.

Quality control of single-cell RNA sequencing (scRNA-seq) data.

(A) Cells with unique molecular identifier (UMI) count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes were excluded. (B) t-Distributed stochastic neighbor embedding (t-SNE) visualization of 1917 excluded cells in which UMI count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes. (C) Heat map and (D) dot plot of known marker genes expression in each cell cluster. Enrichment analysis of these significant genes from LPS-injected Dnajb4 and Dnajb4 mice revealed differential expression not only in IFN-γ-activated signaling pathways, but also in MHC class-I-related signals in macrophages (Figure 3E). In dendritic cells, the differentially expressed genes were mainly enriched in IFN-γ-stimulated immune-response pathways and macrophage migration inhibitory factor (MIF) signaling pathways (Figure 3F). Hence, we focused on IFN-γ expression levels in individual cells and found that there were indeed significantly fewer IFN-γ-positive cells in LPS-injected Dnajb4 mice than Dnajb4 mice (Figure 4—figure supplement 1A). The extent of IFN-γ induction depended on cell type: LPS treatment led to significantly elevated IFN-γ transcription in NK, T, and B cells, but not in other cell types (Figure 4—figure supplement 1B). The violin plot analysis was further split according to Dnajb4 and Dnajb4 genotypes as well as treatment (Figure 4A). IFN-γ expression patterns at the single-cell level among NK, T, and B cells indicated specific distinct clusters of IFN-γ-positive cells in the livers of LPS-injected mice compared to those of control mice (Figure 4B). T and B cells in LPS-treated Dnajb4 and Dnajb4 mice exhibited comparable levels of IFN-γ, but the number of IFN-γ-positive NK cells was lower in Dnajb4 mice (Figure 4A, B). Indeed, process network analysis showed that significantly differentially expressed genes from the NK cells of LPS-treated Dnajb4 and Dnajb4 mice were mainly enriched in inflammatory pathways involving IFN-γ signaling and IFN-γ-related NK cell cytotoxicity (Figure 4C). To further validate the results from the scRNA-seq analysis, we analyzed hepatic IFN-γ expression levels via quantitative real-time PCR (qRT-PCR). We found that there were lower levels of IFN-γ transcripts in Dnajb4 mice than in Dnajb4 mice 4 and 8 hr after LPS injection (Figure 4D). These results suggested that HLJ1 plays an important role in promoting severe systemic immune responses via the enhancement of IFN-γ production mediated by NK cells and the alteration of the IFN-γ-related gene signature in endotoxin-induced sepsis.
Figure 4—figure supplement 1.

IFN-γ gene expression analysis was split according to treatment, genotype or cell type.

(A) IFN-γ gene expression levels in each cell. Significance was calculated using the Wilcoxon rank-sum test; p = 0.009. (B) IFN-γ expression patterns in B (p < 0.001), T (p < 0.001), and natural killer (NK) (p < 0.001) cells and other clusters in lipopolysaccharide (LPS)-treated mice. Significance was calculated using the Wilcoxon rank-sum test. **p < 0.01, ***p < 0.001.

Figure 4.

HLJ1 deficiency leads to altered IFN-γ-related signatures in natural killer (NK) cells under lipopolysaccharide (LPS) stress.

(A) Violin plot showing IFN-γ expression levels in each type of cell. Significance was calculated using the Wilcoxon rank-sum test. (B) t-Distributed stochastic neighbor embedding (t-SNE) visualization of IFN-γ expression profiles in NK, T, and B cells isolated from Dnajb4 and Dnajb4 mice injected with LPS. Significance was calculated using the Wilcoxon rank-sum test. (C) Enrichment analysis showing ranked network signatures associated with up- and downregulated genes (p < 0.05, |logFC| > 0.25) from a comparison of NK cells from LPS-injected Dnajb4 mice with NK cells from Dnajb4 mice. (D) Dnajb4 and Dnajb4 mice (n = 4-9 mice/group) were injected with LPS and, at the indicated time points, whole liver mRNA was extracted for the measurement of hepatic IFN-γ expression levels via quantitative real-time PCR (qRT-PCR). p = 0.026 and p = 0.014 for the 4 and 8 hr groups, respectively. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05.

(A) IFN-γ gene expression levels in each cell. Significance was calculated using the Wilcoxon rank-sum test; p = 0.009. (B) IFN-γ expression patterns in B (p < 0.001), T (p < 0.001), and natural killer (NK) (p < 0.001) cells and other clusters in lipopolysaccharide (LPS)-treated mice. Significance was calculated using the Wilcoxon rank-sum test. **p < 0.01, ***p < 0.001.

HLJ1 deficiency leads to altered IFN-γ-related signatures in natural killer (NK) cells under lipopolysaccharide (LPS) stress.

(A) Violin plot showing IFN-γ expression levels in each type of cell. Significance was calculated using the Wilcoxon rank-sum test. (B) t-Distributed stochastic neighbor embedding (t-SNE) visualization of IFN-γ expression profiles in NK, T, and B cells isolated from Dnajb4 and Dnajb4 mice injected with LPS. Significance was calculated using the Wilcoxon rank-sum test. (C) Enrichment analysis showing ranked network signatures associated with up- and downregulated genes (p < 0.05, |logFC| > 0.25) from a comparison of NK cells from LPS-injected Dnajb4 mice with NK cells from Dnajb4 mice. (D) Dnajb4 and Dnajb4 mice (n = 4-9 mice/group) were injected with LPS and, at the indicated time points, whole liver mRNA was extracted for the measurement of hepatic IFN-γ expression levels via quantitative real-time PCR (qRT-PCR). p = 0.026 and p = 0.014 for the 4 and 8 hr groups, respectively. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05.

IFN-γ gene expression analysis was split according to treatment, genotype or cell type.

(A) IFN-γ gene expression levels in each cell. Significance was calculated using the Wilcoxon rank-sum test; p = 0.009. (B) IFN-γ expression patterns in B (p < 0.001), T (p < 0.001), and natural killer (NK) (p < 0.001) cells and other clusters in lipopolysaccharide (LPS)-treated mice. Significance was calculated using the Wilcoxon rank-sum test. **p < 0.01, ***p < 0.001.

Intracellular IFN-γ decreased in splenic NK cells after HLJ1 deletion

In the spleen, IFN-γ is mainly produced by NK and T cells, which led to systemic immune response and even mortality during acute inflammation as well as septic shock (Chiche et al., 2011; Kunze et al., 2019). We analyzed splenic T and NK cell populations in Dnajb4 and Dnajb4 mice and found the percentages (Figure 5—figure supplement 1A, B) and number (Figure 5—figure supplement 1C) of splenic CD4+, CD8+, NK, and B cell populations in LPS-treated Dnajb4 mice were similar to those in Dnajb4 mice. To further validate our scRNA-seq data showing that IFN-γ was mainly secreted by NK cells (Figure 4A, B) and identify the cell type responsible for the reduced IFN-γ levels in spleens of Dnajb4 mice, we performed flow cytometry analysis by intracellular staining for IFN-γ in B, T, and NK cells isolated from spleens. In LPS-treated mice, the percentage of IFN-γ+ CD4+ and IFN-γ+ CD8+ T cells was slightly lower in LPS-injected Dnajb4 mice than in Dnajb4 mice, while that of IFN-γ+ NK cells were significantly lower (Figure 5A), which is in accordance with our findings from the scRNA-seq analysis of mouse hepatic cells. Transcriptional levels of IFN-γ were also lower in the spleens of LPS-treated Dnajb4 mice than in Dnajb4 mice (Figure 5B), which implied weakened upstream signaling leading to reduced IFN-γ levels. We therefore tested the responsiveness of isolated NK cells to IL-12, an upstream stimulator inducing NK cells to produce IFN-γ, in vitro. The purity of primary NK cells from spleens of both genotypes was up to ~90% (Figure 5C). We then stimulated the cells with recombinant mouse IL-12p70 for 24 hr, and quantified the supernatant IFN-γ via ELISA. The result indicated that IFN-γ expression was induced in an IL-12p70-dependent manner, and the amount of supernatant IFN-γ produced by HLJ1-deleted NK cells was comparable to that produced by wild-type NK cells in response to IL-12p70 stimulation (Figure 5D). Combined, these results suggested that HLJ1 deletion leads to reduced IFN-γ production in not only hepatic but also splenic NK cells, whereas HLJ1 deficiency alters neither the sensitivity to IL-12p70 nor the ability to secrete IFN-γ of NK cells.
Figure 5—figure supplement 1.

Splenic immune cell population identification of Dnajb4 and Dnajb4 mice.

(A) CD4+, CD8+ T cell, and B cell population and (B) natural killer (NK) cell population are presented as percentage. Splenic immune cells were isolated from lipopolysaccharide (LPS)-treated Dnajb4 and Dnajb4 mice (n = 4 mice/group) and were identified with surface markers of B, CD4+ T, and CD8+ T cells by flow cytometry. (C) Immune cells population are presented as total number. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Figure 5.

Intracellular IFN-γ levels decreased in splenic natural killer (NK) cells after HLJ1 deletion.

(A) Dnajb4 and Dnajb4 mice (n = 4 per group) were injected intraperitoneally with 20 mg/kg lipopolysaccharide (LPS), and splenocytes were isolated after 2.5 hr. Expression of intracellular IFN-γ levels in Dnajb4 and Dnajb4 NK, CD4+ T, and CD8+ T cells were detected via flow cytometry analysis. NK cells, p = 0.004. Representative samples are shown. (B) RNA from n = 4 mice spleens were isolated 4 hr after LPS administration, and transcriptional levels of IFN-γ were quantified via quantitative real-time PCR (qRT-PCR); p = 0.014. (C) Expression of NK1.1 in primary NK cells isolated from Dnajb4 and Dnajb4 mice (n = 5 per group) was detected via flow cytometry. Representative samples are shown. (D) Primary NK cells purified from Dnajb4 and Dnajb4 mice spleens were treated with 10 ng/ml IL-12p70 for 24 hr and supernatant IFN-γ was quantified using ELISA (n = 4–5 biological replicates). Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05, **p < 0.01, n.s., not significant.

(A) CD4+, CD8+ T cell, and B cell population and (B) natural killer (NK) cell population are presented as percentage. Splenic immune cells were isolated from lipopolysaccharide (LPS)-treated Dnajb4 and Dnajb4 mice (n = 4 mice/group) and were identified with surface markers of B, CD4+ T, and CD8+ T cells by flow cytometry. (C) Immune cells population are presented as total number. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Intracellular IFN-γ levels decreased in splenic natural killer (NK) cells after HLJ1 deletion.

(A) Dnajb4 and Dnajb4 mice (n = 4 per group) were injected intraperitoneally with 20 mg/kg lipopolysaccharide (LPS), and splenocytes were isolated after 2.5 hr. Expression of intracellular IFN-γ levels in Dnajb4 and Dnajb4 NK, CD4+ T, and CD8+ T cells were detected via flow cytometry analysis. NK cells, p = 0.004. Representative samples are shown. (B) RNA from n = 4 mice spleens were isolated 4 hr after LPS administration, and transcriptional levels of IFN-γ were quantified via quantitative real-time PCR (qRT-PCR); p = 0.014. (C) Expression of NK1.1 in primary NK cells isolated from Dnajb4 and Dnajb4 mice (n = 5 per group) was detected via flow cytometry. Representative samples are shown. (D) Primary NK cells purified from Dnajb4 and Dnajb4 mice spleens were treated with 10 ng/ml IL-12p70 for 24 hr and supernatant IFN-γ was quantified using ELISA (n = 4–5 biological replicates). Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05, **p < 0.01, n.s., not significant.

Splenic immune cell population identification of Dnajb4 and Dnajb4 mice.

(A) CD4+, CD8+ T cell, and B cell population and (B) natural killer (NK) cell population are presented as percentage. Splenic immune cells were isolated from lipopolysaccharide (LPS)-treated Dnajb4 and Dnajb4 mice (n = 4 mice/group) and were identified with surface markers of B, CD4+ T, and CD8+ T cells by flow cytometry. (C) Immune cells population are presented as total number. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

HLJ1 deletion protect mice from CLP-induced organ dysfunction and septic death

To address the question whether HLJ1 also regulates IFN-γ-dependent septic shock in live infection model, we performed CLP (cecal ligation and puncture) surgery which more resembles clinical disease and human sepsis. CLP significantly induced transcriptional levels of IFN-γ in the liver of Dnajb4 mice comparing to mice receiving sham surgery while Dnajb4 mice showed significantly lower IFN-γ mRNA than Dnajb4 mice (Figure 6A). This phenomenon was not restricted to the liver since lower expression of splenic IFN-γ was also found in Dnajb4 mice (Figure 6B). The CLP surgery resulted in severe renal and liver damage while Dnajb4 mice showed alleviated organ dysfunction with significantly lower serum levels of BUN, creatinine, and AST (Figure 6C). H&E staining showed kidney injury at the histology level after CLP, while Dnajb4 mice showed less severe kidney injury than Dnajb4 mice (Figure 6D). However, there was no significant difference in survival between Dnajb4 and Dnajb4 mice (Figure 6E). We hypothesized that severe bacteremia contributed to mortality in mice that did not receive any treatment, so we treat mice with systemic antibiotics. As a result, Dnajb4 mice displayed significantly improved survival compared with Dnajb4 mice when they received daily systemic antibiotics after CLP surgery (Figure 6E). These results implicated that the agent responsible for bacteria clearance can be combined with immune modulation such as HLJ1-targeting strategy to improve the outcome of sepsis.
Figure 6.

HLJ1 deletion protect mice from CLP-induced organ dysfunction and septic death.

(A) CLP or sham surgery were performed on Dnajb4 and Dnajb4 mice, and after 18 hr whole liver mRNA was extracted for the measurement of IFN-γ expression levels via quantitative real-time PCR (qRT-PCR) (n = 5–6). p < 0.001. (B) Spleen mRNA was also extracted for the measurement of IFN-γ expression levels via qRT-PCR (n = 5–6). p = 0.031. (C) Serum levels of BUN, creatinine, ALT, and AST were analyzed 18 hr after sham (n = 3) or CLP surgery (n = 5–8). BUN, p = 0.024; creatinine, p = 0.005; ALT, p = 0.225; AST, p = 0.048. (D) Representative images of H&E staining of sham and CLP mouse kidney sections. Scale bar: 200 μm. Black arrows indicate kidney injury. (E) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice. Mice were i.p. injected with 25 mg/kg imipenem/cilastatin (Primaxin) immediately after CLP. Antibiotic treatment was continued twice per day throughout the observation period (n = 8–11 per group). Dnajb4 + CLP + Primaxin versus Dnajb4 + CLP + Primaxin, p = 0.013; Dnajb4 + CLP versus Dnajb4 + CLP + Primaxin, p = 0.010. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

HLJ1 deletion protect mice from CLP-induced organ dysfunction and septic death.

(A) CLP or sham surgery were performed on Dnajb4 and Dnajb4 mice, and after 18 hr whole liver mRNA was extracted for the measurement of IFN-γ expression levels via quantitative real-time PCR (qRT-PCR) (n = 5–6). p < 0.001. (B) Spleen mRNA was also extracted for the measurement of IFN-γ expression levels via qRT-PCR (n = 5–6). p = 0.031. (C) Serum levels of BUN, creatinine, ALT, and AST were analyzed 18 hr after sham (n = 3) or CLP surgery (n = 5–8). BUN, p = 0.024; creatinine, p = 0.005; ALT, p = 0.225; AST, p = 0.048. (D) Representative images of H&E staining of sham and CLP mouse kidney sections. Scale bar: 200 μm. Black arrows indicate kidney injury. (E) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice. Mice were i.p. injected with 25 mg/kg imipenem/cilastatin (Primaxin) immediately after CLP. Antibiotic treatment was continued twice per day throughout the observation period (n = 8–11 per group). Dnajb4 + CLP + Primaxin versus Dnajb4 + CLP + Primaxin, p = 0.013; Dnajb4 + CLP versus Dnajb4 + CLP + Primaxin, p = 0.010. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

HLJ1 contributes to IL-12-dependent IFN-γ production and lethality

Since we have found the transcriptional levels of IFN-γ were lower in Dnajb4 mice liver (Figure 4D) and, in addition, IL-12/18–IFN-γ axis has been reported to contributed to LPS-induced septic death, we therefore analyzed the transcriptional levels of IL-12 and IL-18 in the liver. Intriguingly, hepatic IL-12 were lower in Dnajb4 than in Dnajb4 mice, although IL-18 expression levels were similar in the two genotypes (Figure 7A). Serum levels of IL-12p70 were also dramatically decreased in HLJ1-deficient mice (Figure 7B). To investigate the impact of IL-12 on IFN-γ production in the context of HLJ1 deficiency, we administered anti-IL-12 neutralizing antibodies into both genotypes intraperitoneally 1 hr before the LPS challenge. The serum IL-12 induced by LPS was efficiently neutralized by the antibodies, and serum IFN-γ was also dramatically reduced in both genotypes (Figure 7C). It is noteworthy that the serum levels of IFN-γ in anti-IL-12 antibody-injected Dnajb4 mice were comparable to those in Dnajb4 mice during sepsis, indicating that HLJ1 enhances IFN-γ expression mainly through IL-12 regulation (Figure 7C). More importantly, IL-12 neutralization significantly reduced the mortality of Dnajb4 mice, which displayed similar survival to Dnajb4 mice when challenged with LPS (Figure 7D). However, IL-12 neutralization did not significantly improve the survival of Dnajb4 mice, indicating that HLJ1 enhanced sepsis death via IL-12 regulation. Combined, these results suggested that HLJ1 is required for LPS-induced IL-12 production, subsequent IFN-γ release, and eventual sepsis death.
Figure 7.

HLJ1 deletion alleviates IL-12-dependent septic death.

Dnajb4 and Dnajb4 mice were intraperitoneally injected with 20 mg/kg lipopolysaccharide (LPS). (A) After 4 or 8 hr, the RNA from n = 6–8 total livers were isolated and gene expression levels were quantified via qRT-PCR. IL-12b, p = 0.029. (B) Serum levels of IL-12p70 in LPS-treated Dnajb4 and Dnajb4 mice were quantified via ELISA 4 hr (n = 11–14) and 8 hr (n = 4–7) after LPS administration. 4 hr IL-12p70, p < 0.001; 8 hr IL-12p70, p = 0.033. (C) Dnajb4 and Dnajb4 mice were intraperitoneally injected with anti-IL-12 neutralizing antibodies 1 hr prior to the injection of 20 mg/kg LPS. After the administration of LPS and anti-IL-12 antibodies, the serum was collected at the indicated time points and analyzed for IL-12 and IFN-γ levels. (D) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice injected with 100 μg anti-IL-12 neutralizing antibodies 1 hr before the 20 mg/kg LPS challenge (n = 9–11 per group). Dnajb4 versus Dnajb4 mice, p = 0.014; Dnajb4 versus Dnajb4 + anti-IL-12, p = 0.007. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

HLJ1 deletion alleviates IL-12-dependent septic death.

Dnajb4 and Dnajb4 mice were intraperitoneally injected with 20 mg/kg lipopolysaccharide (LPS). (A) After 4 or 8 hr, the RNA from n = 6–8 total livers were isolated and gene expression levels were quantified via qRT-PCR. IL-12b, p = 0.029. (B) Serum levels of IL-12p70 in LPS-treated Dnajb4 and Dnajb4 mice were quantified via ELISA 4 hr (n = 11–14) and 8 hr (n = 4–7) after LPS administration. 4 hr IL-12p70, p < 0.001; 8 hr IL-12p70, p = 0.033. (C) Dnajb4 and Dnajb4 mice were intraperitoneally injected with anti-IL-12 neutralizing antibodies 1 hr prior to the injection of 20 mg/kg LPS. After the administration of LPS and anti-IL-12 antibodies, the serum was collected at the indicated time points and analyzed for IL-12 and IFN-γ levels. (D) Kaplan–Meier analysis of overall survival of Dnajb4 and Dnajb4 mice injected with 100 μg anti-IL-12 neutralizing antibodies 1 hr before the 20 mg/kg LPS challenge (n = 9–11 per group). Dnajb4 versus Dnajb4 mice, p = 0.014; Dnajb4 versus Dnajb4 + anti-IL-12, p = 0.007. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

HLJ1 functions in macrophages to maintain the IL-12/IFN-γ axis in vivo and promote septic death

When the host is exposed to bacterial endotoxins, macrophages initiate inflammatory responses by sensing microbial products and produce various proinflammatory cytokines, including IL-12. To understand whether HLJ1 functions in macrophages to mediate LPS-induced IL-12 secretion, we performed macrophage transplantation. This was achieved by depleting macrophages and Kupffer cells with clodronate liposomes, followed by adoptive transfer of macrophages from other mice. We injected bone marrow-derived macrophages (BMDMs) intravenously into the mice at 48 hr after the intravenous administration of clodronate liposomes. This was followed by LPS treatment at 72 hr and blood sampling at 76 and 80 hr (Figure 8A). The administration of clodronate liposomes efficiently depleted most of the liver-resident macrophages in both mice genotypes, since we observed few F4/80-positive cells after this process (Figure 8B). Serum levels of IL-12 and IFN-γ in the LPS-treated mice were significantly reduced as a result of this depletion (Figure 8C). After the depletion, the LPS-treated Dnajb4 mice into which Dnajb4 BMDMs had been transplanted exhibited higher serum levels of IL-12 and IFN-γ than those into which Dnajb4 BMDMs had been transplanted (Figure 8C). Similarly, macrophage-depleted Dnajb4 mice receiving Dnajb4 BMDM transplantation and LPS treatment showed lower serum levels of IL-12 and IFN-γ when compared to with those receiving Dnajb4 BMDMs. Adoptive transfer of Dnajb4 BMDMs into Dnajb4 mice led to dramatically elevated mortality rates following an LPS challenge compared to Dnajb4 mice transplanted with Dnajb4 BMDMs (Figure 8D). In contrast, the survival of LPS-treated Dnajb4+ mice was significantly improved when they were transplanted with Dnajb4 BMDMs (Figure 8D). To understand whether transplanted macrophages would function in the liver microenvironment, we stained F4/80+ cells in the liver of BMDM-transplanted mice. As a result, macrophages went to the liver when they were adoptively transferred back into mice (Figure 8—figure supplement 1A, B). Combined, these results indicated that HLJ1 in macrophages is indispensable for maintaining IL-12-mediated IFN-γ production and contributing to septic death in vivo.
Figure 8.

HLJ1 deletion in macrophages reduced serum levels of IL-12 and IFN-γ and mitigated septic death in vivo.

(A) 200 μl clodronate liposomes (Clo-Lip) were administered intravenously to Dnajb4 and Dnajb4 mice to deplete their endogenous macrophages. After 48 hr, the mice were intravenously injected with 1 × 106 bone marrow-derived macrophages (BMDMs) isolated from Dnajb4 or Dnajb4 mice. After BMDM transplantation, Dnajb4 and Dnajb4 mice were administered with 20 mg/kg lipopolysaccharide (LPS) and serum was collected at 4 or 8 hr for IL-12 or IFN-γ quantification, respectively. (B) Representative photographs of F4/80 immunofluorescence staining of liver sections from phosphate-buffered saline (PBS) liposome or clodronate liposome-injected Dnajb4 and Dnajb4 mice. The liver was fixed, dehydrated, embedded, cryosectioned into slices 8 μm thick, and incubated with anti-F4/80 antibodies to stain the mature macrophages (green). The scale bar represents 100 μm. (C) Mice transplanted with Dnajb4 BMDMs (Dnajb4 MΦ) or Dnajb4 BMDMs (Dnajb4 MΦ) were administered LPS, and serum from n = 4–5 mice was analyzed for IL-12p70 and IFN-γ levels via ELISA. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. (D) Kaplan–Meier analysis of the overall survival of LPS-injected Dnajb4 and Dnajb4 mice transplanted with Dnajb4 and Dnajb4 BMDMs (n = 9–10 per group). For Dnajb4 MΦ versus Dnajb4 MΦ, p = 0.037. For Dnajb4 MΦ versus Dnajb4 MΦ, p = 0.036. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001.

(A) Representative photographs of F4/80 immunofluorescence staining from liver sections of Dnajb4 and Dnajb4 mice with BMDMs adoptive transfer or with Clo-Lip alone. 24 hr after i.v. injection of BMDMs, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (B) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Figure 8—figure supplement 1.

Quantification of liver macrophages in bone marrow-derived macrophage (BMDM)-transplanted mice.

(A) Representative photographs of F4/80 immunofluorescence staining from liver sections of Dnajb4 and Dnajb4 mice with BMDMs adoptive transfer or with Clo-Lip alone. 24 hr after i.v. injection of BMDMs, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (B) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

HLJ1 deletion in macrophages reduced serum levels of IL-12 and IFN-γ and mitigated septic death in vivo.

(A) 200 μl clodronate liposomes (Clo-Lip) were administered intravenously to Dnajb4 and Dnajb4 mice to deplete their endogenous macrophages. After 48 hr, the mice were intravenously injected with 1 × 106 bone marrow-derived macrophages (BMDMs) isolated from Dnajb4 or Dnajb4 mice. After BMDM transplantation, Dnajb4 and Dnajb4 mice were administered with 20 mg/kg lipopolysaccharide (LPS) and serum was collected at 4 or 8 hr for IL-12 or IFN-γ quantification, respectively. (B) Representative photographs of F4/80 immunofluorescence staining of liver sections from phosphate-buffered saline (PBS) liposome or clodronate liposome-injected Dnajb4 and Dnajb4 mice. The liver was fixed, dehydrated, embedded, cryosectioned into slices 8 μm thick, and incubated with anti-F4/80 antibodies to stain the mature macrophages (green). The scale bar represents 100 μm. (C) Mice transplanted with Dnajb4 BMDMs (Dnajb4 MΦ) or Dnajb4 BMDMs (Dnajb4 MΦ) were administered LPS, and serum from n = 4–5 mice was analyzed for IL-12p70 and IFN-γ levels via ELISA. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. (D) Kaplan–Meier analysis of the overall survival of LPS-injected Dnajb4 and Dnajb4 mice transplanted with Dnajb4 and Dnajb4 BMDMs (n = 9–10 per group). For Dnajb4 MΦ versus Dnajb4 MΦ, p = 0.037. For Dnajb4 MΦ versus Dnajb4 MΦ, p = 0.036. Log-rank Mantel-Cox test was used to compare survival curve. *p < 0.05, **p < 0.01, ***p < 0.001.

Quantification of liver macrophages in bone marrow-derived macrophage (BMDM)-transplanted mice.

(A) Representative photographs of F4/80 immunofluorescence staining from liver sections of Dnajb4 and Dnajb4 mice with BMDMs adoptive transfer or with Clo-Lip alone. 24 hr after i.v. injection of BMDMs, mice were sacrificed and liver was fixed, dehydrated, embedded, cryosectioned into 8 μm thickness, and incubated with anti-F4/80 antibodies to stain mature macrophages (red). (B) Quantitation of F4/80+ macrophages. Positively stained cells were counted at ×400 magnification in 6 fields from 3 sections/mouse and from 5 mice/group. Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

HLJ1 helps IL-12p35 folding and heterodimeric IL-12p70 production

Macrophages are major innate immune cells responsible for IL-12 production in response to an endotoxin challenge, which leads to organ dysfunction and even septic shock. We isolated and differentiated BMDMs to investigate the underlying molecular mechanism of HLJ1-modulated IL-12 expression in macrophages. Up to 98% of BMDMs were obtained when differentiated under macrophage colony-stimulating factor (M-CSF) stimulation, demonstrating that the ability to differentiate did not differ between the genotypes (Figure 9—figure supplement 1A). When treated with LPS plus recombinant IFN-γ, Dnajb4 BMDMs generated significantly less supernatant IL-12p70 in culture medium than Dnajb4 BMDMs, but comparable quantities of IL-6 (Figure 9A, Figure 9—figure supplement 1B). Since intracellular IL-12 subunits were folded and assembled to allow secretion of biologically active heterodimeric IL-12, we assessed the ability to heterodimerization by using sandwich ELISA specifically detecting IL-12p70 heterodimer in BMDM cell lysate. Intracellular levels of heterodimeric IL-12p70 in Dnajb4 BMDM were also lower than in Dnajb4 BMDM (Figure 9B), suggesting that HLJ1 maintains the levels of IL-12p70 in macrophages.
Figure 9—figure supplement 1.

Transcriptional levels of proinflammatory cytokines in lipopolysaccharide (LPS)-treated bone marrow-derived macrophages (BMDMs).

(A) F4/80+ BMDMs analyzed with flow cytometry. Bone marrow cells were isolated from Dnajb4 and Dnajb4 mouse and differentiated with M-CSF (10 ng/ml) for 7 days. (B) Dnajb4 and Dnajb4 BMDMs isolated from n = 4 mice were treated with 100 ng/ml LPS and supernatants were collected at the indicated time points and IL-6 was analyzed by ELISA. (C) Transcriptional levels of il12a, il12b, il6, and il18 in BMDMs isolated from n = 4–5 mice were quantified by quantitative real-time PCR (qRT-PCR). Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Figure 9.

HLJ1 deletion leads to the accumulation of homodimeric IL-12p35 and reduced levels of heterodimeric IL-12p70.

(A) Bone marrow-derived macrophages (BMDMs) isolated from n = 6–7 Dnajb4 and Dnajb4 mice were treated with 10 ng/ml lipopolysaccharide (LPS) and 20 ng/ml IFN-γ. Supernatant was collected at the indicated time points, and IL-12p70 was quantified via ELISA. 12 hr, p = 0.003; 24 hr, p = 0.003. (B) LPS/IFN-γ-treated BMDMs from n = 4–5 mice were lysed at the indicated time points and intracellular IL-12p70 was quantified via ELISA. 5 hr, p = 0.006; 8 hr, p = 0.012. (C) IL-12a, IL-12b, IL-6, and IL-18 expression was determined via quantitative real-time PCR (qRT-PCR) in LPS/IFN-γ-treated BMDMs isolated from n = 5 mice. (D) Intracellular IL-12p40 and HLJ1 expression levels were analyzed in LPS/IFN-γ-treated BMDMs isolated from Dnajb4 (+/+) and Dnajb4 (−/−) mice. Representative samples of n = 3–5 biological replicates are shown. GAPDH served as a loading control. In comparisons with the 0 hr group (right panel): 2 hr, p = 0.001; 4 hr, p < 0.001; 8 hr, p = <0.001; 16 hr, p = 0.02. (E) The influence of human HLJ1 knockdown on the redox state of human IL-12p35 was analyzed via non-reducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). 293T cells were (co-)transfected with the indicated IL-12p35 subunits and shRNA targeting HLJ1. The percentage of high-molecular-weight (HMW) and low-molecular-weight (LMW) IL-12p35 species in the presence or absence of shHLJ1 was quantified (right panel, n = 4 biological repeats for shHLJ1- and control-transfected cultures; p = 0.001). Where indicated, samples were treated with β-mercaptoethanol (β-Me) after cell lysis to provide a standard for completely reduced protein. GAPDH served as a loading control. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

(A) F4/80+ BMDMs analyzed with flow cytometry. Bone marrow cells were isolated from Dnajb4 and Dnajb4 mouse and differentiated with M-CSF (10 ng/ml) for 7 days. (B) Dnajb4 and Dnajb4 BMDMs isolated from n = 4 mice were treated with 100 ng/ml LPS and supernatants were collected at the indicated time points and IL-6 was analyzed by ELISA. (C) Transcriptional levels of il12a, il12b, il6, and il18 in BMDMs isolated from n = 4–5 mice were quantified by quantitative real-time PCR (qRT-PCR). Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

(A, B) HLJ1 and STAT3 protein levels and phosphorylation levels in LPS-treated 6–8 weeks Dnajb4 (+/+) and Dnajb4 (−/−) mouse liver were determined. Representative samples are showed from n = 4 per group. Data are mean ± standard deviation (SD). Image J software was used to quantify the intensity and statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. n.s., not significant. (C) Dnajb4 and Dnajb4 mice were administrated with 20 mg/kg LPS and after 4 hr serum was collected for analysis of IL-12p70 and HLJ1 expression by ELISA and western blotting, respectively. For western blotting, 4 μl serum were used for each lane and total proteins in the acrylamide gel were stained as internal control. p value and r value were calculated from 14 samples by Spearman’s correlation coefficient testing.

HLJ1 deletion leads to the accumulation of homodimeric IL-12p35 and reduced levels of heterodimeric IL-12p70.

(A) Bone marrow-derived macrophages (BMDMs) isolated from n = 6–7 Dnajb4 and Dnajb4 mice were treated with 10 ng/ml lipopolysaccharide (LPS) and 20 ng/ml IFN-γ. Supernatant was collected at the indicated time points, and IL-12p70 was quantified via ELISA. 12 hr, p = 0.003; 24 hr, p = 0.003. (B) LPS/IFN-γ-treated BMDMs from n = 4–5 mice were lysed at the indicated time points and intracellular IL-12p70 was quantified via ELISA. 5 hr, p = 0.006; 8 hr, p = 0.012. (C) IL-12a, IL-12b, IL-6, and IL-18 expression was determined via quantitative real-time PCR (qRT-PCR) in LPS/IFN-γ-treated BMDMs isolated from n = 5 mice. (D) Intracellular IL-12p40 and HLJ1 expression levels were analyzed in LPS/IFN-γ-treated BMDMs isolated from Dnajb4 (+/+) and Dnajb4 (−/−) mice. Representative samples of n = 3–5 biological replicates are shown. GAPDH served as a loading control. In comparisons with the 0 hr group (right panel): 2 hr, p = 0.001; 4 hr, p < 0.001; 8 hr, p = <0.001; 16 hr, p = 0.02. (E) The influence of human HLJ1 knockdown on the redox state of human IL-12p35 was analyzed via non-reducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). 293T cells were (co-)transfected with the indicated IL-12p35 subunits and shRNA targeting HLJ1. The percentage of high-molecular-weight (HMW) and low-molecular-weight (LMW) IL-12p35 species in the presence or absence of shHLJ1 was quantified (right panel, n = 4 biological repeats for shHLJ1- and control-transfected cultures; p = 0.001). Where indicated, samples were treated with β-mercaptoethanol (β-Me) after cell lysis to provide a standard for completely reduced protein. GAPDH served as a loading control. Data presented are means ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. *p < 0.05, **p < 0.01, ***p < 0.001.

Transcriptional levels of proinflammatory cytokines in lipopolysaccharide (LPS)-treated bone marrow-derived macrophages (BMDMs).

(A) F4/80+ BMDMs analyzed with flow cytometry. Bone marrow cells were isolated from Dnajb4 and Dnajb4 mouse and differentiated with M-CSF (10 ng/ml) for 7 days. (B) Dnajb4 and Dnajb4 BMDMs isolated from n = 4 mice were treated with 100 ng/ml LPS and supernatants were collected at the indicated time points and IL-6 was analyzed by ELISA. (C) Transcriptional levels of il12a, il12b, il6, and il18 in BMDMs isolated from n = 4–5 mice were quantified by quantitative real-time PCR (qRT-PCR). Data are mean ± standard deviation (SD). Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test.

Expression levels of HLJ1 in the liver and serum from lipopolysaccharide (LPS)-injected mice.

(A, B) HLJ1 and STAT3 protein levels and phosphorylation levels in LPS-treated 6–8 weeks Dnajb4 (+/+) and Dnajb4 (−/−) mouse liver were determined. Representative samples are showed from n = 4 per group. Data are mean ± standard deviation (SD). Image J software was used to quantify the intensity and statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. n.s., not significant. (C) Dnajb4 and Dnajb4 mice were administrated with 20 mg/kg LPS and after 4 hr serum was collected for analysis of IL-12p70 and HLJ1 expression by ELISA and western blotting, respectively. For western blotting, 4 μl serum were used for each lane and total proteins in the acrylamide gel were stained as internal control. p value and r value were calculated from 14 samples by Spearman’s correlation coefficient testing. To understand how HLJ1 affects IL-12 expression, we performed qRT-PCR to evaluate the transcription levels of IL-12. Unexpectedly, we observed no difference in the mRNA levels of either IL-12p35 or IL-12p40 (subunits of IL-12p70) between Dnajb4 and Dnajb4 BMDMs upon treatment with either LPS/IFN-γ (Figure 9C) or LPS alone (Figure 9—figure supplement 1C), indicating that HLJ1 deletion has no effect on IL-12 transcriptional regulation. However, our previous in vivo result showed the transcriptional levels of IL-12 was reduced after HLJ1 deletion (Figure 7A). The reason for the discrepancy might be that Dnajb4 mice did not have enough IFN-γ to prime upstream IL-12p40 gene promoter in vivo, while in vitro isolated macrophages from both genotypes were treated with similar dosage of exogenous IFN-γ and LPS in the culture medium for priming and activating the cells. Therefore, in vitro macrophages transcribed IL-12 gene without being interfered by endogenous IFN-γ-producing NK cells. Next, we examined mRNA levels of the proinflammatory cytokines IL-6 and IL-18, which did not differ significantly between the two genotypes (Figure 9 and Figure 9—figure supplement 1C). We wondered if HLJ1 affects the quantity of IL-12 subunits, so we immunoblotted IL-12p40, a scaffold protein to maintain assembly induced folding and secretion of IL-12, from LPS/IFN-γ-stimulated BMDM cell lysate, but we observed no significant difference between the genotypes (Figure 9D). Because HSPs are proteins that can be induced upon cellular stress, we analyzed HLJ1 protein expression in response to LPS/IFN-γ cotreatment in BMDMs. HLJ1 protein levels increased in a time-dependent manner after LPS/IFN-γ stimulation in Dnajb4 BMDMs, and decreased gradually from 8 hr after the treatment (Figure 9D). However, hepatic HLJ1 expression remained unchanged in mouse liver, which is composed mainly of hepatocytes, after LPS injection (Figure 9—figure supplement 2A, B), indicating HLJ1 is induced in macrophages rather than in hepatocytes. Since serum levels of HSPs are reported to increase during sepsis, and analysis of survival outcomes of sepsis patients has revealed that increased mortality is associated with higher HSP serum levels, we postulated that HLJ1 may be secreted into the blood, and therefore quantified HLJ1 protein in serum from LPS-challenged mice. Indeed, we detected abundant HLJ1 in the serum of Dnajb4 but not Dnajb4 mice (Figure 9—figure supplement 2C). Interestingly, after the mice had received the LPS challenge, their serum levels of IL-12p70 were positively correlated to the amount of HLJ1 in their serum (Figure 9—figure supplement 2C).
Figure 9—figure supplement 2.

Expression levels of HLJ1 in the liver and serum from lipopolysaccharide (LPS)-injected mice.

(A, B) HLJ1 and STAT3 protein levels and phosphorylation levels in LPS-treated 6–8 weeks Dnajb4 (+/+) and Dnajb4 (−/−) mouse liver were determined. Representative samples are showed from n = 4 per group. Data are mean ± standard deviation (SD). Image J software was used to quantify the intensity and statistical analysis was performed by using the two-tailed, unpaired Student’s t-test. n.s., not significant. (C) Dnajb4 and Dnajb4 mice were administrated with 20 mg/kg LPS and after 4 hr serum was collected for analysis of IL-12p70 and HLJ1 expression by ELISA and western blotting, respectively. For western blotting, 4 μl serum were used for each lane and total proteins in the acrylamide gel were stained as internal control. p value and r value were calculated from 14 samples by Spearman’s correlation coefficient testing.

Since chaperones have recently emerged as mediators of IL-12 family protein folding, assembly, and degradation, we performed simultaneous human IL-12p35 overexpression and human HLJ1 knockdown in 293T cells (an established model cell line for studying IL-12 family assembly) to assess the role of HLJ1 in regulating IL-12 biosynthesis. β-Mercaptoethanol treatment breaks disulfide bonds and thus high-molecular-weight (HMW) IL-12p35 became completely reduced LMW IL-12p35 monomers, suggesting the HMW IL-12p35 was homodimer with intermolecular disulfide bridges between monomers (Figure 9E). Interestingly, HLJ1 knockdown shifted the HMW to LMW ratio of IL-12p35 to the dimeric species, suggesting that HLJ1 is able to prevent non-native homodimeric IL-12p35 accumulation and helps to reduce the disulfide bonds of homodimeric IL-12p35 to form LMW monomers (Figure 9E). These results indicated that LPS-inducible HLJ1 plays an important role in the regulation of IL-12p35 folding and the maintenance of IL-12p70 heterodimerization in endotoxin-stimulated primary macrophages. HLJ1-mediated production of IL-12p70 in macrophages has a substantial impact on the production of IFN-γ from NK cells and causes a persistent cytokine production contributing to endotoxin-induced mortality (Figure 10).
Figure 10.

Schematic diagram delineates how HLJ1 functions and controls IL-12 biosynthesis, IFN-γ production, and subsequent sepsis-related mortality.

HLJ1 protein, which can be induced when macrophages are stimulated with lipopolysaccharide (LPS), helps the conversion of high-molecular-weight (HMW) misfolded IL-12p35 homodimers to IL-12p35 monomers. Bioactive IL-12p70 heterodimers, composed of IL-12p35 and IL-12p40 subunits, are released into the circulation by macrophages and thereby stimulates natural killer (NK) cells. Eventually, activated NK cells in the liver and spleen release IFN-γ in sufficient quantities to lead to organ damage and even death during sepsis.

Schematic diagram delineates how HLJ1 functions and controls IL-12 biosynthesis, IFN-γ production, and subsequent sepsis-related mortality.

HLJ1 protein, which can be induced when macrophages are stimulated with lipopolysaccharide (LPS), helps the conversion of high-molecular-weight (HMW) misfolded IL-12p35 homodimers to IL-12p35 monomers. Bioactive IL-12p70 heterodimers, composed of IL-12p35 and IL-12p40 subunits, are released into the circulation by macrophages and thereby stimulates natural killer (NK) cells. Eventually, activated NK cells in the liver and spleen release IFN-γ in sufficient quantities to lead to organ damage and even death during sepsis.

Discussion

Sepsis is a growing health problem, with MODS developing in 30% of patients with sepsis. Purified LPS injected into mouse is widely used to resemble the physiology of severe sepsis and recapitulate human disease (Deitch, 2005). Pathologically, LPS triggers activation of host-derived humoral and cellular inflammatory systems leading to MODS and septic shock (Hamesch et al., 2015). We demonstrated that LPS-induced vital organ injury and mortality was attributable to HLJ1-mediated production of IL-12 and IFN-γ cytokines. Because mice are rather insensitive to LPS (Cauwels et al., 2013), we use high-dose LPS (20 mg/kg LPS) which can resemble sepsis-induced SIRS and severe endotoxemia (Silva et al., 2019) to induce endotoxic shock. Since non-lethal low-dose LPS is sufficient to cause systemic inflammation with rapidly increased serum cytokines such as TNF (tumor necrosis factor), IL-6, IFN-γ, and IL-10 (Seemann et al., 2017), we also treated both mice with 4 mg/kg of LPS which induced moderate endotoxemia (Kunze et al., 2019; Malgorzata-Miller et al., 2016). It resulted in lower serum levels of organ dysfunction markers and also IFN-γ in Dnajb4 mice comparing with wild-type mice (Figures 1C, D, 2C), suggesting the effect of HLJ1 deletion on reducing IFN-γ levels and alleviating organ injury can be found as well during moderate endotoxemia. Nonetheless, although LPS-induced endotoxemia is a simple model with higher reproducibility and reliability than other sepsis models, it indeed cannot represent actual sepsis as it is the host’s response to bacteria but not the pathogen itself that leads to mortality and organ failure (Deitch, 2005). We thus used CLP model resembling clinical disease and septic shock (Deitch, 2005) to reassure the importance of HLJ1 to human sepsis. During CLP-induced sepsis, mice deficient in HLJ1 showed reduced IFN-γ expression and alleviated organ injury, indicating similar role of HLJ1 in true sepsis. However, despite the fact that HLJ1 deletion alleviated LPS-induced mortality, it did not improve survival until antibiotics were used after CLP surgery (Figure 6E). It suggested that severe bacteremia contributed to mortality even in Dnajb4 mice before antibiotic administration. It is consistent with a previous study showing that only when IFN-γ knockout mice are administrated with systemic antibiotics do they show improved survival (Romero et al., 2010). Given that IFN-γ inhibition with neutralizing antibodies alone do not improve survival in CLP mouse model (Romero et al., 2010), HLJ1 inhibition combined with systemic antibiotics might be a promising strategy to treat sepsis. In the model of LPS-induced endotoxemia, the technique of macrophage depletion and reconstitution has been used to investigate the role of macrophages (Fu et al., 2020). Recent studies demonstrated that in vivo tracking of transplanted macrophages reveals specific homing in the liver (Bartneck et al., 2021; Nishiwaki et al., 2020), while little is known about the location where transplanted macrophages produce IL-12 and mediate IFN-γ production during sepsis. We depleted phagocytes with clodronate liposome and found when macrophage-depleted mice received BMDM isolated from same genotype, serum IL-12 and IFN-γ bounced back to the levels where endogenous macrophages have not yet been depleted (Figure 8C). This suggested adoptively transferred macrophages isolated from both genotypes were able to activate IL-12/IFN-γ axis in response to LPS challenge. To understand whether IL-12-producing macrophages occur in the liver microenvironment during endotoxemia, we analyzed the amount of hepatic F4/80+ cells in BMDM-transplanted mice. Indeed, macrophages went to the liver when they were adoptively transferred back into mice (Figure 8—figure supplement 1A, B). This indicates that the IL-12-producing macrophages may occur in the liver microenvironment during high-dose endotoxemia. Nonetheless, we cannot exclude the possibility that part of the transplanted macrophages would go to other organs as Nishiwaki et al. also found that macrophages have strong affinity for not only liver but also spleen and lung (Nishiwaki et al., 2020). Of note, the number of endogenous macrophages is 60 per field (Figure 2—figure supplement 1E), while that of transplanted macrophages is about 30 per field (Figure 8—figure supplement 1B). This indicated that part of the macrophages resided in the liver, while perhaps the rest of them would be at other organs. Although we know immune cells such as macrophages in the liver initiate immune response and secrete proinflammatory cytokines when infection occurs, our knowledge about the transcriptional profiles of individual hepatic immune cells during sepsis is limited. Also, liver dysfunction and failure, which are particularly serious complications of sepsis, contribute directly to disease progression and death (Canabal and Kramer, 2008). We thus used scRNA-seq to characterize the cellular landscapes of liver nonparenchymal cells in a mouse model of sterile sepsis, and found dramatically changed gene signatures between LPS and control group with t-SNE visualization. However, cell distributions were similar across genotypes (Figure 3A). We thus analyzed the excluded cells and found that the 1917 excluded cells were uniformly distributed across genotypes as well (Figure 3—figure supplement 1B), indicating there were factors except for the exclusion that would make the individual groups appear similar. The reason why it happened might be the strong effect of LPS that had a much greater impact on the distribution shifting than the effect of gene deletion. This would lead to significantly shifted pattern between control and LPS groups, whereas the distribution patterns across genotypes were similar with t-SNE visualization. Nevertheless, we still observed hundreds of differentially expressed genes between genotypes when both mice were treated with LPS (Figure 3D). Even if these differentially expressed genes may not contributed directly to the shifting of cell distribution or grouping in the t-SNE plot, it may have significant biological functions and be involved in signaling pathways (Figure 3E, F). Enrichment analysis of these genes revealed that HLJ1 mediated the crosstalk between hepatic immune cells through regulating IFN-γ signaling in NK cells. In the liver, studies have showed that IL-12 and other monokines such as IL-18 produced by LPS-stimulated macrophages activate liver NK cells to secrete IFN-γ (Bancroft et al., 1991; Takahashi et al., 1996; Trinchieri, 1995). Indeed, we found the transcriptional levels of IFN-γ and IL-12 were lower in the liver of Dnajb4 mice (Figures 4D and 7A). However, we observed no difference in IL-12 expression between two genotypes of isolated macrophages ex vivo (Figure 9C). The reason for discrepancy was that the transcription of IL-12 in vivo can be upregulated by downstream IFN-γ which acting on APCs in a positive feedback loop (Grohmann et al., 2001; Ma et al., 1996); therefore, Dnajb4 mice might not have sufficient IFN-γ to prime upstream IL-12p40 gene promoter, resulting in lesser transcriptional levels of IL-12 than Dnajb4 mice (Figure 7A). However, isolated macrophages from both genotypes were treated with similar dosage of exogenous IFN-γ and LPS in the culture medium for priming and activating the cells (Figure 9C), so macrophages transcribed IL-12 gene without being interfered by endogenous IFN-γ-producing NK cells. Little NK cells would affect BMDMs in the culture medium since we differentiated almost all bone marrow cells into F4/80+ macrophages. Even though these macrophages from both genotypes produced similar transcription levels of IL-12 in response to LPS/IFN-γ treatment (Figure 9C), protein levels of IL-12p70 were still lower in Dnajb4 BMDMs than in wild-type ones (Figure 9B). This finding prompted us to dig into the molecular mechanism. Bioactive IL-12 is a disulfide-bridged heterodimeric glycoprotein that consists of an α subunit (IL-12p35) and a β subunit (IL-12p40) (Yoon et al., 2011). We found HLJ1 deletion altered neither IL-12p35 nor IL-12p40 transcription, indicating that HLJ1 does not regulate IL-12 transcription directly. Nonetheless, we concluded that HLJ1 controlled the heterodimerization and maintained levels of the biologically active IL-12p70 protein, since HLJ1 deletion resulted in both reduced intracellular and extracellular levels of heterodimeric IL-12p70 in LPS/IFN-γ-stimulated BMDMs. Meier et al., 2019 have showed how chaperones regulate and control the assembly of heterodimeric IL-23, a member of the IL-12 family, through sequential checkpoints. ERdj5, another member of the DnaJ protein family, participates in the recognition and removal of non-native disulfides, as well as in the ERAD of misfolded proteins (Oka et al., 2013; Ushioda et al., 2008). It and have recently been found to reduce the quantity of IL-12p35 with non-native disulfide bonds and may even decelerate IL-12p35 degradation (Reitberger et al., 2017). Because the lack of HLJ1 reduces the amount of intracellular heterodimeric IL-12p70 detected by sandwich ELISA (Figure 9B) without changing the amount of intracellular IL-12p40 (Figure 9D) which functions as a scaffold to maintain the assembly induced folding of IL-12p35, we concluded that the HLJ1-mediated conversion of IL-12p35 homodimers to LMW monomers contributes directly to IL-12p70 heterodimerization. Accordingly, more detailed in vitro studies are needed to address questions about whether HLJ1 acts as a reductase to reduce non-native disulfide bonds in IL-12p35 dimers and whether HLJ1-mediated monomer formation contributes to the ERAD of misfolded IL-12p35 proteins. In conclusion, we have demonstrated the previously unknown role of HLJ1 as a regulator of IL-12 heterodimerization and biosynthesis. Our data suggest that upregulated HLJ1 induced by LPS enhances IL-12 production and secretion in macrophages, which leads to upregulated IFN-γ produced by NK cells and contributes to subsequent endotoxin-induced mortality. Given that HLJ1 plays an important role in mediating IL-12/IFN-γ axis-dependent sepsis severity, HLJ1 may serve as a molecular target for the development of novel antisepsis or immunomodulatory therapies. To our knowledge, some strategies have been shown to induce HLJ1 expression through transcriptional or epitranscriptomic mechanisms (Chen et al., 2008; Lai et al., 2013; Miao et al., 2019). However, so far neither antibodies nor small molecules inhibiting HLJ1 expression has yet been developed. Identification of novel potential drugs for HLJ1 modulation is still under investigation for future applications.

Materials and methods

Mice and animal experiments

The HLJ1 knockout (Dnajb4) mouse was generated by the gene targeting strategy to delete exon2 of Dnajb4 gene at the embryonic stage. The syngeneic genetic background of Dnajb4 was achieved by backcrossing to C57BL/6 mouse strain over ten generations. Mice deficient in HLJ1 exhibited elevated ER stress-mediated abnormal lipogenesis (paper submitted). All mice were hosted in a pathogen-free facility, maintained in filter-topped cages under standard 12 hr light–dark cycle, and fed standard rodent chow and water ad libitum. All experimental procedures performed were approved by the Institutional Animal Care and Use Committee (IACUC) with IACUC number 20120515, 20201050, and 20220115 at National Taiwan University Medical College. Liver and spleen were excised into adequate size for immunoblotting and qRT-PCR analysis. At the indicated time points, blood was collected from submandibular and complete blood counts were analyzed with IDEXX ProCyte Dx. Serum levels of HDL and LDL were analyzed with Cobas c111 (Roche).

LPS administration and analysis

The intraperitoneal LPS injection strategy of endotoxemia mouse model was based on previous studies (Samie et al., 2018; Silva et al., 2019; Starr et al., 2010). In survival analysis, 6- to 8-week-old mice were intraperitoneally injected with non-lethal dose (4 mg/kg) or LD50 dose (10 mg/kg) or higher dose (20 mg/kg) LPS (Sigma-Aldrich, L2630) from E. coli O111:B4. For organ pathology analysis, mice were injected with 4 mg/kg LPS and sacrificed 24 hr after injection. Mouse kidney and liver were fixed and parafilm-embedded and sectioned for H&E staining. Serum levels of BUN, creatinine, ALT, and AST were analyzed by AU680 (Beckman Coulter). For cytokine neutralization, mice were i.p. injected with 100 μg anti-IL-12 (C17.8) or anti-IFN-γ (XMG1.2) 1 hr before LPS administration.

Cecal ligation and puncture

CLP and sham surgery were performed according the protocol published in previous study (Au – Toscano et al., 2011). In brief, 6- to 8-week-old mice were anesthetized and practiced a 1-cm midline laparotomy and cecum was exposed with adjoining intestine. The cecum was tightly ligated with a 6.0 silk suture at >1 cm distance from the distal end and was perforated twice with 19 G needle. The cecum was gently squeezed to extrude a small amount of feces to produce sepsis outcome and was returned to the peritoneal cavity. Afterwards, mice were resuscitated with 1 ml of normal saline subcutaneously. Eighteen hours after CLP, mRNA levels of IFN-γ in liver and spleen were analyzed with qRT-PCR. Serum levels of BUN, creatinine, ALT, and AST were analyzed by AU680 (Beckman Coulter). For histological analysis, mouse kidney was fixed with 10% formalin for 48 hr, followed by dehydration, parafilm-embedding and section for H&E staining. For survival rate analysis, 25 mg/kg Primaxin (Merck) was used immediately after CLP and treatment were continued twice per day throughout the observation period.

Single-cell RNA sequencing

Dnajb4 and Dnajb4 mice were intraperitoneally injected with 20 mg/kg LPS and sacrificed 8 hr postinjection. Largest liver lobe of n = 3 mice from same group were pooled together and grinded with gentleMACS Dissociators. Mouse hepatic parenchymal cells were digested and nonparenchymal cells were isolated by Mouse Liver Dissociation Kit (Miltenyi Biotec). Isolated cells passed through 40 µm cell strainer were treated with Red Blood Cell Lysis Solution (Miltenyi Biotec) to lyse blood cells. To acquire cells with >90% viability, dead cells were removed with Dead Cell Removal Kit (Miltenyi Biotec). Briefly, cells were pelleted by centrifugation at 300 × g for 5 min and resuspended in buffer containing dead cell removal microbeads and incubated at room temperature for 15 min. Cell suspension was applied to the MS columns (MACS Cat# 130-042-201) and effluent containing live cells was collected. Live cells were then centrifuged at 300 × g for 5  min, resuspended in cold 0.04% bovine serum albumin (BSA)/phosphate-buffered saline (PBS) and counted with Bio-Rad’s TC20 automated cell counter. Live cells were prepared for scRNA-seq with the Chromium Single Cell 3′ Reagent Kits v3 (10× Genomics) according to the user guide. Briefly, ~4800 cells were wrapped into each gel bead in emulsion (GEMs, 10× Genomics) at a concentration of 500–1000 cells/μl on Single Cell 3′ Chips v3 (10× Genomics) by using 10× Chromium controller. For reverse transcription incubation, GEMs were transferred to Bio-Rad C1000 Touch Thermal Cycler, followed by post GEMs-RT Cleanup, cDNA Amplification according to the manufacturer’s instructions. Qubit dsDNA HS Assay Kit (Invitrogen) was used to quantified cDNA concentration and single-cell transcriptome libraries were constructed using the 10× Chromium Single Cell 3′ Library (10× Genomics, v3 barcoding chemistry). Quality control was performed with Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies). Libraries were then purified, pooled, and analyzed on Illumina NovaSeq 6000 S2 Sequencing System with 150 bp paired-end reads. scRNA-seq data analysis. More than two billion scRNA-seq reads were processed and analyzed with the default parameters of CellRanger single-cell software suite (v3.1.0). Base calling files generated by Illumina sequencer were demultiplexed according to the sample index. Sequences were then aligned to the mm10 reference for whole transcriptome analysis. Multiple samples were aggregated for the following analysis. Loupe browser and Seurat (v4.0.0) were used to perform visualization, quality control, normalization, scaling, PCA dimension reduction, clustering, and differential expression analysis (Stuart et al., 2019). Cells with UMI count of greater than 30,000, fewer than 500, or greater than 6000 genes, and >10% of total expression from mitochondrial genes were excluded (Figure 3—figure supplement 1A). The remaining 11,651 cells were unsupervised clustered after aligning the top 12 dimensions and setting resolution to 0.5. The identity for each cluster was assigned according to marker genes for known nonparenchymal cell types in the mouse liver (Xiong et al., 2011; Miao et al., 2019). Differentially expressed genes with absolute log-fold change greater than 0.25 and p value less than 0.05 were used for pathway and network enrichment analysis on the Metacore website. The scRNA-seq data were deposited to GEO as raw and processed files with accession number GSE182137.

Quantitative real-time PCR

RNA was isolated with TRI reagent (Sigma) and reverse transcribed with High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) according to the manufacturer’s instructions. The cDNA was used for qRT-PCR analysis with Power SYBR Green PCR Master Mix (Applied Biosystems) performed on the ABI-7500 Fast Real Time PCR system. The mRNA expression level was normalized to the amount of GAPDH gene expression, and the values were calculated using the comparative threshold cycle method (2−ΔCt).

Multiplex bead array and ELISA

Serum sample were taken at 0, 4, 8, 18, after 20 mg/kg LPS injection. Cytokine array was performed with LEGENDplex Mouse inflammation Panel (Biolegend) according to the manufacturer’s protocol. Data analysis was proceeded by using LEGENDplex Data Analysis Software. Mouse serum levels of IFN-γ, IL-1α, and IL-6 were quantified with Mouse IFN-γ ELISA MAX Deluxe Set (Biolegend), Mouse IL-1α ELISA MAX Deluxe Set (Biolegend), and Mouse IL-6 ELISA MAX Deluxe Set (Biolegend) according to the manufacturer’s protocol. Mouse serum, BMDMs supernatant, and intracellular IL-12p70 were quantified by using ELISA MAX Deluxe Set Mouse IL-12 (p70; Biolegend).

Flow cytometry

Mouse spleens were grinded and connective tissues were removed to obtain splenocytes. Pelleted cells were resuspended by 2 ml ACK lysis buffer and incubated for 1 min to lyse red blood cells, followed by a wash with 10 ml 0.2% BSA (bovine serum albumin) in PBS. Pelleted splenocytes were resuspended in 0.2% BSA in PBS containing anti-CD16/CD32 antibodies (Biolegend) to block the Fc receptors before staining. After incubation for 10 min at 4°C, 50 μl diluted antibodies including anti-CD19, CD3, CD4, CD8, and NK1.1 antibody (Biolegend) were added and incubated for 30 min in the dark. Stained cells were washed twice with 0.2% BSA in PBS, resuspended in 300 μl 0.2% BSA in PBS, and then analyzed by CytoFLEX flow cytometer (Beckman Coulter). For intracellular IFN-γ staining, mice were injected with 20 mg/kg LPS and after 2.5 hr splenocytes were isolated. Splenocytes were fixed and permeabilized with 100 μl BD cytofix/cytoperm (BD biosciences) for 20 min after surface staining. BD Perm/Wash Buffer (BD biosciences) was used to wash the cells. Pelleted cells were resuspended in BD Perm/Wash Buffer containing anti-IFN-γ antibodies (Biolegend) for 30 min and analyzed by CytoFLEX flow cytometer.

Cell culture and transfections

293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) (Merck Millipore), 100 units/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml Amphotericin B (Thermo Fisher Scientific) and 2 mM L-glutamine (Thermo Fisher Scientific) at 37°C and 5% CO2. Cells were free from Mycoplasma detected by Mycoplasma Detection Kit (BioSmart, BSMP101). HLJ1-shRNA-containing vectors were obtained from the National RNAi Core Facility (Academia Sinica, Taiwan). Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection, 2 × 105/well 293T cells were plated on 6-well dishes. Cotransfection was carried out in 6-well dishes using lipofectamine 2000 reagent (Thermo Fisher Scientific) by adding 1.2 μg of HLJ1-shRNA and 2 μg of IL-12p35 plasmid DNA according to the protocol of the manufacturer. For primary NK cell experiment, pelleted splenocytes isolated from mice spleen were resuspended in 0.2% BSA in PBS for NK cells purification with Mouse NK Cell Purification Kit (Miltenyi Biotec) according to the manufacturer’s protocol. Purified NK cells were surface-stained with anti-NK1.1 antibodies (Biolegend) for flow cytometry analysis, or were cultured in RPMI 1640 medium (Thermo Fisher Scientific) containing 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml Amphotericin B, and 2 mM L-glutamine and treated with 10 ng/ml recombinant IL-12p70 (Peprotech) for 24 hr for supernatant IFN-γ analysis.

BMDM isolation and activation

Bone marrow was flushed from murine femur and tibia and isolated cells were cultured in complete DMEM (Thermo Fisher Scientific) supplemented with 10 ng/ml M-CSF (Peprotech) (Trouplin et al., 2013). Three days after treatment, culture medium was replaced with fresh complete DMEM with 10 ng/ml M-CSF. At day 7, 106/well differentiated macrophages were seeded into 6-well dishes. The next day BMDMs were classically activated with LPS (10 ng/ml) plus recombinant IFN-γ (Peprotech) (20 ng/ml), or stimulated with LPS alone (100 ng/ml).

Macrophage depletion and reconstitution

Liposome-based macrophage depletion followed by BMDM reconstitution was described previously (Au – Weisser et al., 2012). Liposome-encapsulated clodronate (Liposoma) (100 μl per 10 g body weight) was i.v. administrated to deplete macrophages 3 days before LPS challenge. Adoptive transfer of macrophages was performed by i.v. injecting 1 × 106 BMDMs 2 days after macrophage depletion.

Immunoblotting experiments

Cells and mouse tissues were lysed in M-PER or T-PER Tissue Protein Extraction Reagent (Thermo Fisher Scientific) containing additional 1× PhosStop (Sigma) phosphatase inhibitor and 1× protease inhibitor cocktail (Sigma) and protein was extracted according to the manufacturer’s protocol. For non-reducing sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gels, 20 mM N-ethylmaleimide (NEM) (Sigma) was added to the lysis buffer. Samples were supplemented with 0.25 volumes of 4× sample buffer containing either 2-Me for reducing SDS–PAGE or 80 mM NEM for non-reducing SDS–PAGE. Samples were run on 10% SDS–PAGE gels, transferred to PVDF membranes, and blotted with anti-IL-12p35 (Abcam, Cat. ab133751), anti-IL-12p40 (Biolegend, Cat. 505310), anti-HLJ1 (Proteintech, Cat. 13064-1-AP), or anti-GAPDH (Proteintech, Cat. 60004-1-Ig) antibodies. ImageJ Software was used to semiquantify the western blotting results.

Statistical analysis

Statistical analysis was performed by using the two-tailed, unpaired Student’s t-test with equal variance assumed. Log-rank Mantel–Cox test was used to compare survival curve. Correlation between serum HLJ1 and IL-12 was analyzed by using nonparametric Spearman’s correlation test. In scRNA-seq, differentially expressed genes of specific cell types were identified by using a Wilcoxon rank-sum test. Differences were considered statistically significant when p < 0.05. This study investigates the processes by which HLJ1, a molecular chaperone in the heat shock protein 40 family, regulates mononuclear phagocyte processing and release of active IL-12 in response to a endotoxin. Specifically, in the liver, LPS induced HJL1-regulated secretion of active IL-12 that in turn stimulates CTL and NK cells to produce IFN culminating in endotoxin shock. Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work. Decision letter after peer review: Thank you for submitting your article "HLJ1 amplifies endotoxin-induced sepsis severity by promoting IL-12 heterodimerization in macrophages" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Jos van der Meer as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Essential revisions: The Introduction 1. Please include in the first sentence should contain the correct sepsis definition: life-threatening organ dysfunction caused by a dysregulated host response to infection. 2. The authors characterize sepsis as a biphasic disorder, but this is not entirely correct, as the inflammatory and immunosuppressive phases can coincide. Please amend this. 3. Sepsis is not really a "complication" of COVID-19. Severe COVID-19 is rather a form of sepsis, namely viral sepsis. 4. The introduction is very long and not to the point, it should be shortened by at least 30%. However, there is also critical information missing, such as the link between IL-12 and IFN-γ (i.e. the IL-12-IFN-γ axis). Therefore, please rewrite and shorten. The study: 5. 10 mg/kg can hardly be considered "low dose" as it is an LD50 dose for C57BL/6 mice. 6. Additional experiments are necessary to demonstrate that the authors' findings are not limited only to the highly-reductionist massive endotoxemia model used, which has limited relevance to human sepsis. Ideally, corroborative human studies/data would be used to reassure the importance of HLJ1 to human sepsis. If these human studies are not feasible, then key experiments should be repeated using a live infection model, for example, cecal ligation and puncture, pneumonia, etc. to confirm the generalization of the findings to multiple models of sepsis. Especially, as LPS induced inflammation (endotoxemia) is not actual sepsis. These models should approximate the severity of human sepsis (~30% mortality). Furthermore, indices of organ dysfunction (renal function, etc.) should be provided to confirm HLJ1 is associated with organ injury during sepsis. The studies showing that Hlj1 k/o mice have less interferon γ (Figure 3D) after 4 mg/kg LPS is insufficient, as organ dysfunction indices are necessary to determine if these changes in interferon expression are relevant to sepsis. 7. The tSNE plots in Figure 1B are strikingly similar (nearly identical) across genotypes. That is, there appears to be no difference at all between the distribution of cells sequenced; this is somewhat surprising as one would expect some heterogeneity by chance alone. The authors note that they excluded apoptotic cells (high mtDNA) and doublets. Were these exclusions uniformly distributed across groups? If they were most common in the LPS groups, this would suggest perhaps some bias that would make the individual groups appear similar. 8. The macrophage transfer experiments (Figure 6) are compelling. When macrophages are adoptively transplanted back into mice, do they go to the liver, or do they go to another organ? This could be explored using staining approaches as illustrated in Figure 6B. This would demonstrate if IL-12 producing macrophages (and responding interferon γ-producing natural killer T-cells) only occur in the liver microenvironment during high-dose endotoxemia. 9. In Figure 2B, this analysis should be split according to Hlj1+/+ and Hlj1−/−genotypes, so either depict the fold-change in induction of IFNγ expression in Hlj1−/− vs. Hlj1+/+ mice (both LPS-treated) or fold-change induction of IFNγ expression in Hlj1−/− LPS-treated vs. Hlj1−/− not LPS treated and Hlj1+/+ LPS-treated vs. Hlj1+/+ not LPS treated mice. 10. The sentence 'Since LPS has been reported to induce systemic inflammatory responses, we analyzed splenic T, NK, and B cell populations in Hlj1+/+ and Hlj1−/− mice.' Is a bit puzzling. Of course, LPS induces a systemic inflammatory response, this is universally known. But why is that the reason to study splenic T, NK, and B cell populations? 11. Results, why was IFNγ not included in the analyses presented in Figure 5A-B? 12. Results, how can the results in Figure 5B (reduced expression of IL-12 in Hlj1−/− cells) be reconciled with those presented in Figure 7A (no difference in IL-12 expression between the genotypes)? The Discussion 13. The discussion is far too long and not focused, this needs to be rewritten and reduced. General Questions 14. Can HLJ1 be targeted by antibodies or small molecule inhibitors? [Editors’ note: further revisions were suggested prior to acceptance, as described below.] Thank you for resubmitting your work entitled "HLJ1 amplifies endotoxin-induced sepsis severity by promoting IL-12 heterodimerization in macrophages" for further consideration by eLife. Your revised article has been evaluated by Jos van der Meer (Senior Editor) and a Reviewing Editor. The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below: 1. In the text, the authors refer to their knockout mouse as Dnajb4-/-; in the figures, they refer to it as Hlj1-/-. Please keep it consistent to minimize confusion for the reader. 2. The prose is clumsy in places, with some grammatical errors. While this does not interfere with the reader understanding the paper, it is a distraction. The discussion is mostly a series of disjointed paragraphs each addressing a separate concern with the paper, without much narrative flow. The paper would read much better if some additional editing/formatting were to occur. 3. The authors make some overconfident statements that aren't really necessary to get their point across. For example, line 149: "Cytokine storm caused by a dysregulated immune response to infection is the major cause of septic shock and multiple organ failure…". "Cytokine storm" is somewhat of a dated and overly simplistic concept that has failed to explain septic organ failure; thus, making that declarative statement invites the educated reader's ire. Better to say it is "a cause of septic shock…", as opposed to the major cause. One other slight irritant is the statement (line 525) that their data show "unequivocally that upregulated HLJ1". It's up to the reader to decide if the data are "unequivocal", not the authors! Essential revisions: The Introduction 1. Please include in the first sentence should contain the correct sepsis definition: life-threatening organ dysfunction caused by a dysregulated host response to infection. Thank the reviewer’s reminding. We should define it precisely. We had modified the first sentence to the correct definition in the first sentence (Page 3, line 49-50). Page 3, Line 49-50 “Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection (Singer et al., 2016).” 2. The authors characterize sepsis as a biphasic disorder, but this is not entirely correct, as the inflammatory and immunosuppressive phases can coincide. Please amend this. We agree the reviewer’s suggestion. The inflammatory and immunosuppressive phases can coincide in sepsis patients. We rewrote the sentence “Although sepsis is a biphasic disorder characterized by an initial hyper-inflammatory phase followed by an immunosuppressive phase, studies have shown that both pro- and anti-inflammatory responses occur early and simultaneously where the net effect of the competing process is typically dominated by a hyper-inflammatory phase featuring shock and fever (Hotchkiss et al., 2013; Munford and Pugin, 2001; Stearns-Kurosawa et al., 2011).” (Page 3, line 51-56). Page 3, line 51-56 “Although sepsis is a biphasic disorder characterized by an initial hyper-inflammatory phase followed by an immunosuppressive phase, studies have shown that both pro- and anti-inflammatory responses occur early and simultaneously where the net effect of the competing process is typically dominated by a hyper-inflammatory phase featuring shock and fever (Hotchkiss et al., 2013; Munford and Pugin, 2001; Stearns-Kurosawa et al., 2011).” 3. Sepsis is not really a "complication" of COVID-19. Severe COVID-19 is rather a form of sepsis, namely viral sepsis. We deeply apologize for this misunderstanding and statement. We have removed the sentence “In fact, in COVID-19 patients, sepsis comprises up to 60% of complications (Zhou et al., 2020)” from the article. Please check the revised manuscript with changes tracking. Thank reviewer for the reminding. 4. The introduction is very long and not to the point, it should be shortened by at least 30%. However, there is also critical information missing, such as the link between IL-12 and IFN-γ (i.e. the IL-12-IFN-γ axis). Therefore, please rewrite and shorten. We totally agree the reviewer’s suggestion. In order to pinpoint out the significance of background, we have rewritten the introduction according to the reviewer’s comment including shortening and concentration. In terms of word count, we reduced the original 903 words to 729 words. Please check the Introduction section of our revised manuscript. In addition, the information about the link between IL-12 and IFN-γ was emphasized and added to introduction according to the reviewer’s suggestion (Page 3-4, line 65-80). Thank you very much. Page 3-4, line 65-80 “Produced by APCs, IL-12 functions to activate NK cells and induces the differentiation of naive CD4+ T cells to become IFN-γ-producing Th1 effector cells in responses to pathogens (Schenten and Medzhitov, 2011). In a positive feedback loop, secreted IFN-γ augments IL-12 production by priming IL-12p40 gene promoter in APCs (Grohmann et al., 2001; Ma et al., 1996). The IL-12/IFN-γ axis-mediated communication between innate and adaptive immunity plays an important role in the control of infections by mycobacteria and other intracellular bacteria such as Salmonella (Ramirez-Alejo and Santos-Argumedo, 2014). In models of sterile sepsis and chronic bacterial infection, the IL-12/18-IFN-γ axis is controlled by ARTD1 in myeloid cells, which contributes to TH1 response and immune control of the bacteria (Kunze et al., 2019). However, the pathogenic role of IFN-γ has been implicated during CLP-induced septic shock where IFN-γ-knockout mice showed lower levels of IL-6 and MIP-2 in the circulation and are resistant to CLP-induced mortality when treated with systemic antibiotics (Romero et al., 2010). The inhibition of IFN-γ activity by neutralizing antibodies improves survival and attenuates CLP-induced sepsis in rat, while it did not reduce CLP-related mortality in mice (Romero et al., 2010; Yin et al., 2005).” The study: 5. 10 mg/kg can hardly be considered "low dose" as it is an LD50 dose for C57BL/6 mice. Thank reviewer for the comment. We agree that 10 mg/kg cannot be considered as low dose. Therefore, we had changed “low dose” to “LD50” in the revised manuscript (Page 5, line 118-121; Page 26, line 539-542). Page 5, line 118-121 “Hlj1 and Hlj1 mice showed similar survival rates when LD50 dose of LPS (10 mg/kg) was used (Figure 1A), but Hlj1 mice were significantly more resistant to LPS-induced sepsis and exhibited longer survival than Hlj1 mice when subjected to a higher lethal dose of LPS (20 mg/kg) (Figure 1B).” Page 26, line 539-542 “In survival analysis, 6–8-week-old mice were intraperitoneally injected with non-lethal dose (4 mg/kg) or LD50 dose (10 mg/kg) or higher dose (20 mg/kg) LPS (Σ-Aldrich, L2630) from E. coli O111:B4.” 6. Additional experiments are necessary to demonstrate that the authors' findings are not limited only to the highly-reductionist massive endotoxemia model used, which has limited relevance to human sepsis. Ideally, corroborative human studies/data would be used to reassure the importance of HLJ1 to human sepsis. If these human studies are not feasible, then key experiments should be repeated using a live infection model, for example, cecal ligation and puncture, pneumonia, etc. to confirm the generalization of the findings to multiple models of sepsis. Especially, as LPS induced inflammation (endotoxemia) is not actual sepsis. These models should approximate the severity of human sepsis (~30% mortality). Furthermore, indices of organ dysfunction (renal function, etc.) should be provided to confirm HLJ1 is associated with organ injury during sepsis. The studies showing that Hlj1 k/o mice have less interferon γ (Figure 3D) after 4 mg/kg LPS is insufficient, as organ dysfunction indices are necessary to determine if these changes in interferon expression are relevant to sepsis. Thank the reviewer raised these critical issues and provided valuable suggestions. Although the LPS-induced endotoxemia is a simple model with higher reproducibility and reliability comparing to other sepsis models, it indeed cannot represent actual sepsis and is based on the notion that it is the host’s response to bacteria but not the pathogen itself, that leads to mortality and organ failure (Deitch, 2005). Therefore, according to the reviewer’s suggestion, we performed additional model including cecal ligation and puncture (CLP) which resembles clinical disease and septic shock (Deitch, 2005) to reassure the importance of HLJ1 to human sepsis. In addition, we examined the organ dysfunction indices of mice treated with lower dose of LPS. Detail results were listed step by step in below: i. After mice received CLP surgery, we found the transcriptional levels of IFN-γ were lower in Hlj1 mice than Hlj1 mice livers and spleens. These new results were added as Figure 6A and 6B of the revised manuscript. Also, please check our revised Figure 6 (Figure 6). With this new result, we have also added descriptions in the Material and Method (Page 26, line 549-563) as well as Result (Page 11-12, line 271-275) section of our revised manuscript. ii. With CLP models, we found Hlj1 mice exhibited significantly more severe kidney and liver damage than Hlj1 mice, which is indicated by serum levels of BUN, creatinine, ALT and AST. This new result was added as Figure 6C of the revised manuscript. Also, please check our revised Figure 6 (Figure 6). With this new result, we had also added descriptions in the Material and Method (Page 26, line 549-563) as well as Result (Page 12, line 275-278) section of our revised manuscript. iii. H&E staining showed kidney injury at the histology level after CLP surgery, while Hlj1 mice showed less severe kidney injury than Hlj1. This new result was added as Figure 6D of the revised manuscript. Also, please check our revised Figure 6 (Figure 6). With this new result, we had also added descriptions in the Result (Page 12, line 278-279) section of our revised manuscript. iv. We observed the survival rate of CLP mice and found similar survival rate between Hlj1 and Hlj1 mice. We further found Hlj1 mice showed significantly improved survival compared to Hlj1 mice when mice were treated with systemic antibiotics. These results implied the agent responsible for bacteria clearance can be combined with immune modulation such as HLJ1 targeting to improve the outcome of sepsis. This new result was added as Figure 6E of the revised manuscript. Also, please check our revised Figure 6 (Figure 6). With this new result, we have also added descriptions in the Result (Page 12, line 279-286), and Discussions (Page 18-19, line 437-453) section of our revised manuscript. Thank you. v. Finally, to understand if the changes of IFN-γ expression after HLJ1 deletion under low dose of LPS are relevant to sepsis, we treated both genotypes with 4 mg/kg LPS and analyzed serum levels of BUN, creatinine, ALT, AST. Consequently, Hlj1 mice showed less severe organ damage than Hlj1 mice. This new result was added to Figure 1C and D of the revised manuscript. Also, please check our revised Figure 1 (Figure 1). With this new result, we had also added descriptions in the Result (Page 6, line 134-141), and Discussions section of our revised manuscript (Page 18, line 431-437). Thank you. vi. Furthermore, we also mentioned the reviewer’s comment in the Discussion section (Page 18-19, line 431-453). These comments and suggestions inspire us and let us more familiar with the role of HLJ1 in sepsis. Thank you very much. Page 26, line 549-563 Cecal ligation and puncture “CLP and sham surgery were performed according the protocol published in previous study (Au – Toscano et al., 2011). In brief, 6-8-week-old mice were anesthetized and practiced a 1 cm midline laparotomy and cecum was exposed with adjoining intestine. The cecum was tightly ligated with a 6.0 silk suture at >1 cm distance from the distal end and was perforated twice with 19-G needle. The cecum was gently squeezed to extrude a small amount of feces to produce sepsis outcome and was returned to the peritoneal cavity. Afterwards, mice were resuscitated with 1 mL of normal saline subcutaneously. 18 hours after CLP, mRNA levels of IFN-γ in liver and spleen were analyzed with qRT-PCR. Serum levels of BUN, creatinine, ALT, AST were analyzed by AU680 (Beckman Coulter). For histological analysis, mouse kidney was fixed with 10% formalin for 48 hours, followed by dehydration, parafilm-embedding and section for HandE staining. For survival rate analysis, 25 mg/kg Primaxin (Merck) was used immediately after CLP and treatment were continued twice per day throughout the observation period.” Page 11-12, line 271-275 “CLP significantly induced transcriptional levels of IFN-γ in the liver of Hlj1 mice comparing to mice receiving sham surgery while Hlj1 mice showed significantly lower IFN-γ mRNA than Hlj1 mice (Figure 6A). This phenomenon was not restricted to the liver since lower expression of splenic IFN-γ was also found in Hlj1 mice (Figure 6B).” Page 12, line 275-278 “The CLP surgery resulted in serious renal and liver damage while Hlj1 mice showed alleviated organ dysfunction with significantly lower serum levels of BUN, creatinine and AST (Figure 6C).” Page 12, line 278-279 “H&E staining showed kidney injury at the histology level after CLP, while Hlj1 mice showed less severe kidney injury than Hlj1 mice (Figure 6D).” Page 12, line 279-286 “However, there was no significant difference in survival when comparing Hlj1 and Hlj1 mice (Figure 6E). We hypothesized that severe bacteremia contributed to mortality in mice that did not receive any treatment, so we treat mice with systemic antibiotics. As a result, Hlj1 mice displayed significantly improved survival compared with Hlj1 mice when mice received daily systemic antibiotics after CLP (Figure 6E). These results implied the agent responsible for bacteria clearance can be combined with immune modulation such as HLJ1 targeting to improve the outcome of sepsis.” Page 18-19, line 437-453 “Although LPS-induced endotoxemia is a simple model with higher reproducibility and reliability comparing to other sepsis models, it indeed cannot represent actual sepsis and is based on the notion that it is the host’s response to bacteria but not the pathogen itself, that leads to mortality and organ failure (Deitch, 2005). Therefore, we performed additional model including CLP which resembles clinical disease and septic shock (Deitch, 2005) to reassure the importance of HLJ1 to human sepsis. We found HLJ1 deletion led to reduced IFN-γ expression and can alleviate renal and liver injury. Even though we found HLJ1 deletion could reduce LPS-induced mortality, in CLP model it did not improve survival rate until antibiotics were used (Figure 6E). In CLP model, it is possible that severe bacteremia contributed to mortality in mice that did not receive antibiotics in an IFN-γ-independent manner. It is consistent with previous findings showing that only when they were treated with systemic antibiotics do IFN-γ knockout mice showed improved survival rate (Romero et al., 2010). Based on the fact that IFN-γ inhibition with neutralizing antibodies did not improve the survival rate (Romero et al., 2010), HLJ1 inhibition combined with systemic antibiotics might be a promising strategy to treat sepsis.” Page 6, line 134-141 “The effect of HLJ1 deletion on organ dysfunction was also demonstrated by using a non-lethal dosage of LPS (4 mg/kg) which was able to cause moderate endotoxemia and resemble human endotoxemia. 24 hours after LPS administration, Hlj1 mice exhibited significantly lower serum levels of BUN, creatinine, and ALT when comparing to Hlj1+/+ mice (Figure 1C). HandE staining showed kidney injury at the histology level after LPS treatment, while Hlj1 mice showed less severe kidney injury than Hlj1 mice (Figure 1D). These results indicated the organ dysfunction caused by LPS can be alleviated after HLJ1 deletion.” Page 18, line 431-437 “To understand the effect of non-lethal lower dose of LPS, we also treated both mice with 4 mg/kg of LPS which induced moderate endotoxemia (Kunze et al., 2019; Malgorzata-Miller et al., 2016). As it turned out, 4 mg/kg LPS injection led to lower serum levels of organ dysfunction markers and also IFN-γ in Hlj1 mice comparing to wild-type mice (Figure 1C and D, 2C), suggesting the effect of HLJ1 on augmenting IFN-γ secretion can be also found during moderate endotoxemia.” 7. The tSNE plots in Figure 1B are strikingly similar (nearly identical) across genotypes. That is, there appears to be no difference at all between the distribution of cells sequenced; this is somewhat surprising as one would expect some heterogeneity by chance alone. The authors note that they excluded apoptotic cells (high mtDNA) and doublets. Were these exclusions uniformly distributed across groups? If they were most common in the LPS groups, this would suggest perhaps some bias that would make the individual groups appear similar. We apologized for our unclear illustration and explanation leading to misunderstanding. Indeed, exclusions may differently or uniformly distributions across genotypes as LPS treatment may cause fragile cell death. We therefore re-analyzed the excluded cells in which UMI count of greater than 30,000, fewer than 500 or greater than 6,000 genes, and >10% of total expression from mitochondrial genes. Shown in Figure 3—figure supplement 1B. As a result, the 1917 excluded cells seems to uniformly distributed across genotypes, which means perhaps there were little bias that make the individual groups appear similar. The reason why the tSNE plot in Figure 1B (now Figure 3A) are similar across genotypes might be the strong effect of LPS that impose a much greater impact on the distribution shift than the effect of gene deletion did. This would lead to significant shifted pattern across control and LPS groups, whereas the distribution patterns across genotypes are similar. Nevertheless, we observed hundreds of differentially expressed genes between genotypes treated with LPS (Figure 1E, now Figure 3D). Even if these differentially expressed genes may not contributed directly to cell distribution shift or grouping in the tSNE plot, these genes have significant biological functions and be involved in signaling pathways (Figure 1F and 1G, now Figure 3E and 3F). This additional analysis will generate new Figure 3—figure supplement 1B of Figure 3—figure supplement 1 (Revised Figure 3—figure supplement 1). After the modification, several corresponding descriptions in the Result (Page 9, line 198-199) and Discussion (Page 17, line 410-422) sections were revised. Please check it. Thank you for your reminding Page 9, line 198-199 “The 1917 excluded cells appeared to uniformly distributed across genotypes (Figure 3− figure supplement 1B).” Page 17-18, line 410-422 “With t-SNE visualization, we found cell distributions were similar across genotypes (Figure 3A). We therefore analyzed the excluded cells to see if they are differently or uniformly distributed (Figure 3− figure supplement 1B). As a result, the 1917 excluded cells uniformly distributed across genotypes, meaning perhaps there were little bias that would make the individual groups appear similar. The reason why the tSNE plot in Figure 3A are similar across genotypes might be the strong effect of LPS that impose a much greater impact on the distribution shifting than the effect of gene deletion did. This would lead to significant shifted pattern between control and LPS groups, whereas the distribution patterns across genotypes are similar. Nevertheless, we observed hundreds of differentially expressed genes between genotypes treated with LPS (Figure 3D). Even if these differentially expressed genes may not contributed directly to cell distribution shift or grouping in the tSNE plot, these genes may have significant biological functions and be involved in signaling pathways (Figure 3E and F).” 8. The macrophage transfer experiments (Figure 6) are compelling. When macrophages are adoptively transplanted back into mice, do they go to the liver, or do they go to another organ? This could be explored using staining approaches as illustrated in Figure 6B. This would demonstrate if IL-12 producing macrophages (and responding interferon γ-producing natural killer T-cells) only occur in the liver microenvironment during high-dose endotoxemia. Thank the reviewer’s affirmation. We also appreciate this interesting issue raised by the reviewer. Based on the suggestion, we thus performed immunofluorescence staining to clarify whether transplanted macrophages go to the liver. We found that the macrophages go to the liver when they are adoptively transferred back into mice. We also added this result in the revised manuscript as Figure 8—figure supplement 1 (Figure 8—figure supplement 1). It is consistent with previous studies demonstrating that transplanted macrophages have homing in the liver (Bartneck et al., 2021; Nishiwaki et al., 2020). This indicate that the IL-12-producing macrophages may occur in the liver microenvironment during high-dose endotoxemia. Nonetheless, we cannot exclude the possibility that part of the transplanted macrophages would go to other organs as Nishiwaki et al., also observed that macrophages have strong affinity for not only liver but also spleen and lung. We add this information into the parts of Result (Page 14, line 332-335) and Discussion (Page 19-20, line 469-482) of revised manuscript. Page 14, line 332-335 “To understand whether transplanted macrophages would function in the liver microenvironment, we stained F4/80+ cells in the liver of BMDMs-transplanted mice. As a result, macrophages went to the liver when they were adoptively transferred back into mice (Figure 8− figure supplement 1A and B).” Page 19-20, line 469-482 “To understand whether IL-12-producing macrophages occur in the liver microenvironment during endotoxemia, we stained F4/80 in the liver of BMDMs-transplanted mice. We found that the macrophages go to the liver when they are adoptively transferred back into mice (Figure 8− figure supplement 1A and B). This result is consistent with previous studies demonstrating that transplanted macrophages have homing in the liver (Bartneck et al., 2021; Nishiwaki et al., 2020). This indicate that the IL-12-producing macrophages may occur in the liver microenvironment during high-dose endotoxemia. Nonetheless, we cannot exclude the possibility that part of the transplanted macrophages would go to other organs as Nishiwaki et al., also observed that macrophages have strong affinity for not only liver but also spleen and lung. Furthermore, evidences are needed to address the interesting question whether liver-resident IL-12-producing macrophages activate NK cell to produce IFN-γ in a paracrine manner since we also found IFN-γ-producing NK cells in the spleen during sepsis (Figure 5A).” 9. In Figure 2B, this analysis should be split according to Hlj1+/+ and Hlj1−/−genotypes, so either depict the fold-change in induction of IFNγ expression in Hlj1−/− vs. Hlj1+/+ mice (both LPS-treated) or fold-change induction of IFNγ expression in Hlj1−/− LPS-treated vs. Hlj1−/− not LPS treated and Hlj1+/+ LPS-treated vs. Hlj1+/+ not LPS treated mice. We thank the reviewer for suggestion. Originally, Figure 2B (now Figure 4A—figure supplement 1B) would like to demonstrate the overall IFN-γ expression pattern regardless of genotypes. Based on the reviewer’s suggestion, we further plot an additional figure to avoid some misunderstandings. We had added this figure as Figure 4A of Figure 4 (Revised Figure 4). Furthermore, some descriptions had been added in the revised manuscript (Page 10, line 222-228). Please check it. Page 10, line 222-228 “The violin plot analysis was further split according to Hlj1 and Hlj1 genotypes as well as treatment (Figure 4A). IFN-γ expression patterns at the single-cell level among NK, T, and B cells indicated specific distinct clusters of IFN-γ–positive cells in the livers of LPS-injected mice compared to those of control mice (Figure 4B). T and B cells in LPS-treated Hlj1 and Hlj1 mice exhibited comparable levels of IFN-γ, but the number of IFN-γ–positive NK cells was lower in Hlj1 mice (Figure 4A and B).” 10. The sentence 'Since LPS has been reported to induce systemic inflammatory responses, we analyzed splenic T, NK, and B cell populations in Hlj1+/+ and Hlj1−/− mice.' Is a bit puzzling. Of course, LPS induces a systemic inflammatory response, this is universally known. But why is that the reason to study splenic T, NK, and B cell populations? We understand the doubts and confusion from the reviewer. Originally, we attempted to use flow cytometry to validate the scRNA-seq result in Figure 2 where B, T, and NK cells are the main IFN-γ-producing cells. The reason why we study spleen was that previous studies have showed that splenic NK and T cells express IFN-γ which led to systemic immune response and mortality during acute inflammation as well as septic shock (Chiche et al., 2011; Kunze et al., 2019). To identify the cell type responsible for the reduced IFN-γ levels in Hlj1 mice, we performed intracellular staining for IFN-γ in B, T and NK cells isolated from spleens. We apologize for that this may result in a bit puzzling for readers. Therefore, we had modified some descriptions in the revised manuscript (Page 10-11, line 240-253). Please check it. Thank you for the comments. Page 10-11, line 240-253 “IFN-γ is mainly produced by NK and T cells in the spleen, which led to systemic immune response and even mortality during acute inflammation as well as septic shock (Chiche et al., 2011; Kunze et al., 2019). We analyzed splenic T and NK cell populations in Hlj1 and Hlj1 mice and found the percentages (Figure 5− figure supplement 1A and B) and number (Figure 5− figure supplement 1C) of splenic CD4+, CD8+, NK, and B cell populations in LPS-treated Hlj1 mice were similar to those in Hlj1 mice. To further validate our scRNA-seq data showing that IFN-γ was mainly secreted by NK cells (Figure 4A and B) and identify the cell type responsible for the reduced IFN-γ levels in spleens of Hlj1 mice, we performed flow cytometry analysis by intracellular staining for IFN-γ in B, T and NK cells isolated from spleens. In LPS-treated mice, the percentage of IFN-γ+ CD4+ and IFN-γ+ CD8+ T cells was slightly lower in LPS-injected Hlj1 mice than in Hlj1 mice, while that of IFN-γ+ NK cells were significantly lower (Figure 5A), which is in accordance with our findings from the scRNA-seq analysis of mouse hepatic cells.” 11. Results, why was IFNγ not included in the analyses presented in Figure 5A-B? We deeply apologize for our unclear description and illustration. Actually, IFN-γ had been analyzed and qPCR result was shown as in Figure 2E (Figure 2E, now Figure 4D). To avoid such doubts, we also mentioned the result of IFN-γ in the result section refer to the part of Figure 5A-B (now Figure 7A-B) (page 12, line 289-292). Thank you for the reminding. Page 12, line 289-292 “Since we have found the transcriptional levels of IFN-γ were lower in Hlj1 mice liver (Figure 4D) and, in addition, IL-12/18–IFN-γ axis has been reported to contributed to LPS-induced septic death, we therefore analyzed the transcriptional levels of IL-12 and IL-18 in the liver.” 12. Results, how can the results in Figure 5B (reduced expression of IL-12 in Hlj1−/− cells) be reconciled with those presented in Figure 7A (no difference in IL-12 expression between the genotypes)? We apologized that we did not explain clearly. In Figure 5B (now 7A), we found the transcriptional levels of IL-12 was reduced in vivo, while in Figure 7C (now 9C) we observed no difference in IL-12 expression between two genotypes of isolated macrophages in vitro. The reason for discrepancy is that the transcription of IL-12 in vivo can be up-regulated by downstream IFN-γ which acting on APCs in a positive feedback loop (Grohmann et al., 2001; Ma et al., 1996); therefore, in Figure 5B (now 7A), Hlj1 mice might not have enough IFN-γ to prime upstream IL-12p40 gene promoter, resulting in lesser transcriptional levels of IL-12b than Hlj1 mice. However, in Figure 7C (now 9C), isolated macrophages from both genotypes were treated with similar dosage of exogenous IFN-γ and LPS in the culture medium for priming and activating the cells, respectively, so macrophages transcribed IL-12b gene without being interfered by endogenous IFN-γ-producing NK cells. There were little NK cells in the culture medium in Figure 7 (now Figure 9) since we differentiated almost all bone marrow cells into F4/80+ macrophages (now Figure 9—figure supplement 1A). These BMDMs produced similar transcription levels of IL-12p35 and IL-12p40 between Hlj1 and Hlj1 mice. That is the reason why in vivo data in Figure 5B (now 7A) is inconsistent with in vitro data in Figure 7C (now 9C). To avoid this misunderstanding, we emphasized the difference between these two data sets in the part of Result (Page 15, line 360-367) and Discussion (Page 19, line 454-468) of revised manuscript. Page 15, line 360-367 “However, our previous in vivo result showed the transcriptional levels of IL-12 was reduced after HLJ1 deletion (Figure 7A). The reason for the discrepancy might be that Hlj1 mice did not have enough IFN-γ to prime upstream IL-12p40 gene promoter in vivo, while in vitro isolated macrophages from both genotypes were treated with similar dosage of exogenous IFN-γ and LPS in the culture medium for priming and activating the cells. Therefore, in vitro macrophages transcribed IL-12 gene without being interfered by endogenous IFN-γ-producing NK cells.” Page 19, line 454-468 “We found the transcriptional levels of IL-12 were lower in Hlj1 in vivo (Figure 7A), while we observed no difference in IL-12 expression between two genotypes of isolated macrophages in vitro (Figure 9C). The reason for discrepancy may be that the transcription of IL-12 in vivo can be up-regulated by downstream IFN-γ which acting on APCs in a positive feedback loop (Grohmann et al., 2001; Ma et al., 1996); therefore, Hlj1 mice might not have enough IFN-γ to prime upstream IL-12p40 gene promoter, resulting in lesser transcriptional levels of IL-12 than Hlj1 mice (Figure 7A). However, isolated macrophages from both genotypes were treated with similar dosage of exogenous IFN-γ and LPS in the culture medium for priming and activating the cells (Figure 9C), so macrophages transcribed IL-12 gene without being interfered by endogenous IFN-γ-producing NK cells. There were little NK cells in the culture medium since we differentiated almost all bone marrow cells into F4/80+ macrophages which producing similar transcription levels of IL-12 between Hlj1 and Hlj1 mice in response to LPS/IFN-γ treatment (Figure 9C, Figure 9− figure supplement 1A).” The Discussion 13. The discussion is far too long and not focused, this needs to be rewritten and reduced. We agree the reviewer’s comments. The discussion is too long to follow up. In order to presented for better understanding by readers, we had rewritten the discussion based on significances. Generally, in terms of word count, we reduced the original 1651 words to 1347 words. In addition to reduction, we also added several important issues based on reviewers’ suggestions and comments. We highly appreciate the reminding from reviewers. Please check the revised discussion of revised manuscript (Page 17-21, line 406-518). Thank you very much. General Questions 14. Can HLJ1 be targeted by antibodies or small molecule inhibitors? Thank the reviewer’s comment. We totally agree it is a very important issue for clinical applications since in this study we found HLJ1 could be a therapeutic target for diseases related to IL-12/IFN-γ axis. Actually, there are some strategies to enhance HLJ1 expression (Chen et al., 2008). In addition, HSP90 inhibitors stimulate the translation of HLJ1 through an epitranscriptomic mechanism (Miao et al., 2019). However, to our knowledge, neither antibodies nor small molecules inhibiting HLJ1 expression has yet been developed to date. Identification of novel potential drugs for HLJ1 modulation is still under investigation. We appreciate the reviewer’s valuable comments and we have added these issues in the discussion of revised manuscript (Page 21, line 514-518). Page 21, line 514-518 “To our knowledge, some strategies have been shown to induce HLJ1 expression through transcriptional or epitranscriptomic mechanisms (Chen et al., 2008). However, so far neither antibodies nor small molecules inhibiting HLJ1 expression has yet been developed. Identification for novel potential drugs for HLJ1 modulation is still under investigation for future applications.” [Editors’ note: further revisions were suggested prior to acceptance, as described below.] The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below: 1. In the text, the authors refer to their knockout mouse as Dnajb4-/-; in the figures, they refer to it as Hlj1-/-. Please keep it consistent to minimize confusion for the reader. Thanks for the editor’s reminder. We apologize for the inconsistency. According to the expert suggestion about the nomenclature from eLife, we uniformly changed Hlj1 to Dnajb4 in our study. Therefore, all “Hlj1” in figures have been changed to “Dnajb4”. Please check our revised figures as well as figure supplements. Thank you very much. 2. The prose is clumsy in places, with some grammatical errors. While this does not interfere with the reader understanding the paper, it is a distraction. The discussion is mostly a series of disjointed paragraphs each addressing a separate concern with the paper, without much narrative flow. The paper would read much better if some additional editing/formatting were to occur. Thanks for the editor’s suggestion. We agree with the editor that it is important for us to create a friendly presentation to readers. To make the discussion part easier to read, we made some modifications by either changing the order of the paragraphs or adding some sentences. We also check and eliminate some grammatical errors. We hope it could improve quality of the article and meet the criteria. All the changes are recorded in the Word file with tracked changes. Please check the revised manuscript. Thank you very much. 3. The authors make some overconfident statements that aren't really necessary to get their point across. For example, line 149: "Cytokine storm caused by a dysregulated immune response to infection is the major cause of septic shock and multiple organ failure…". "Cytokine storm" is somewhat of a dated and overly simplistic concept that has failed to explain septic organ failure; thus, making that declarative statement invites the educated reader's ire. Better to say it is "a cause of septic shock…", as opposed to the major cause. One other slight irritant is the statement (line 525) that their data show "unequivocally that upregulated HLJ1". It's up to the reader to decide if the data are "unequivocal", not the authors! We apologize for making some overconfident statements which may lead to an overinterpretation. We agree with the fact that the interpretation is up to the readers rather than the authors. For precise description, the term “cytokine storm” was replaced by specific effectors in the manuscript. We revised not only the statements mentioned by the editors but also some overconfident sentences checked by ourselves. All the modifications have been recorded in the Word file with tracked changes. We modified the sentences that editors mentioned (Page 6, line 143–145 and page 22, line 531–534 in the version of clean file). Please check the revised manuscript. Thank you very much. Page 6, line 143–145. “Cytokine overproduction caused by a dysregulated immune response to infection is a cause of septic shock and multiple organ failure, and can contribute to sepsis-associated death. It is thus important to quantify cytokine levels during the endotoxemia.” Page 22, line 531–534. “Our data suggest that upregulated HLJ1 induced by LPS enhances IL-12 production and secretion in macrophages, which leads to upregulated IFN-γ produced by NK cells and contributes to subsequent endotoxin-induced mortality.”
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Mus musculus)HLJ1 (Dnajb4)GenBankMGI:1914285
Strain, strain background (Mus musculus)HLJ1 knockout mice (Dnajb4−/−) in C57BL/6 backgroundMedical College, National Taiwan UniversityN/ANational Core Facility for Biopharmaceuticals – A4, Ministry of Science and Technology, Taiwan (https://ncfb.nycu.edu.tw/en/a4.html)
Cell line (Homo sapiens)EpithelialKidney; EmbryoATCC293TTransfected with HLJ1-shRNA containing vectors
Transfected construct (Homo sapiens)HLJ1shRNANational RNAi Core Facility (Academia Sinica, Taiwan)TRCN0000419874 NM_007034Transfected construct to express the shRNA
Transfected construct(Homo sapiens)IL-12p35 overexpressionOrigeneRC211224NM_000882Transfected construct to express the human IL12A
Biological sample (Mus musculus)Primary NK cellsThis paperFreshly isolated from Mus musculus
Biological sample (Mus musculus)Bone marrow-derived macrophagesThis paperFreshly isolated from Mus musculus
AntibodyAnti-IL-12(Clone: C17.8)(Rat monoclonal)BiolegendCat# 505310WB (1:1000)Neutralization (100 and 500 μg/mouse)
AntibodyAnti-IFN-γ(Clone: XMG1.2)(Rat monoclonal)BioXCellCat# BE0055Neutralization (100 μg/mouse)
AntibodyAnti-IL-12A(Clone: EPR5736)(Rabbit monoclonal)AbcamCat# Ab133751WB (1:1000)
AntibodyAnti-Dnajb4 (HLJ1)(Rabbit polyclonal)ProteintechCat# 13064-1-APWB (1:5000)
AntibodyAnti-F4/80 [CI:A3-1](Rat monoclonal)AbcamCat# ab6640ICC/IF (1:100)
Sequence-based reagentIfng_FArterioscler Thromb Vasc Biol. 2005 Apr;25(4):791–6.qRT-PCR primer AGCAACAGCAAGGCGAAAA
Sequence-based reagentIfng_RArterioscler Thromb Vasc Biol. 2005 Apr;25(4):791–6.qRT-PCR primer CTGGAC CTGTGGGTTGTTGA
Sequence-based reagentIl12a_FPNAS July 10, 2012 109 (28) 11200–11205qRT-PCR primer AAGAACGAGAGTTGCCTGGCT
Sequence-based reagentIL12a_RPNAS July 10, 2012 109 (28) 11200–11205qRT-PCR primer TTGATGGCCTGGAACTCTGTC
Sequence-based reagentIl12b_FJ Immunol March 1, 2019, 202 (5) 1406–1416qRT-PCR primer GAAGTTCAACATCAAGAGCAGTAG
Sequence-based reagentIl12b_RJ Immunol March 1, 2019, 202 (5) 1406–1416qRT-PCR primer AGGGAGAAGTAGGAATGGGG
Peptide, recombinant proteinIFN-γPeprotechCat# 315-0520 ng/ml
Peptide, recombinant proteinM-CSFPeprotechCat# 315-0210 ng/ml
Commercial assay or kitMouse IFN-γ ELISABiolegendCat# 430804
Commercial assay or kitMouse IL-12 ELISABiolegendCat# 433604
Commercial assay or kitLEGENDplexBiolegendCat# 740446
Chemical compound, drugLiposome-encapsulated clodronateLiposomaCar# C-025100 μl/10 gbw
Software, algorithmMetaCore softwareClarivate https://portal.genego.com/Pathway analysis
Software, algorithmGraphPad Prism softwareGraphPad PrismVersion 8.0.0
Software, algorithmLoupe browser10× genomics https://www.10xgenomics.com/products/loupe-browser
OtherLipopolysaccharide (LPS) from E. coli O111:B4Sigma-AldrichCat# L2630Low-dose 4 mg/kgLD50 10 mg/kgHigh-dose 20 mg/kg
  49 in total

Review 1.  Innate immune sensing and its roots: the story of endotoxin.

Authors:  Bruce Beutler; Ernst Th Rietschel
Journal:  Nat Rev Immunol       Date:  2003-02       Impact factor: 53.106

2.  Bone marrow-derived macrophage production.

Authors:  Virginie Trouplin; Nicolas Boucherit; Laurent Gorvel; Filippo Conti; Giovanna Mottola; Eric Ghigo
Journal:  J Vis Exp       Date:  2013-11-22       Impact factor: 1.355

3.  The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3).

Authors:  Mervyn Singer; Clifford S Deutschman; Christopher Warren Seymour; Manu Shankar-Hari; Djillali Annane; Michael Bauer; Rinaldo Bellomo; Gordon R Bernard; Jean-Daniel Chiche; Craig M Coopersmith; Richard S Hotchkiss; Mitchell M Levy; John C Marshall; Greg S Martin; Steven M Opal; Gordon D Rubenfeld; Tom van der Poll; Jean-Louis Vincent; Derek C Angus
Journal:  JAMA       Date:  2016-02-23       Impact factor: 56.272

4.  Interferon-gamma inhibition attenuates lethality after cecal ligation and puncture in rats: implication of high mobility group box-1.

Authors:  Kingsley Yin; Elizabeth Gribbin; Haichao Wang
Journal:  Shock       Date:  2005-10       Impact factor: 3.454

5.  The role of interferon-γ in the pathogenesis of acute intra-abdominal sepsis.

Authors:  Christopher R Romero; Daniela S Herzig; Anthony Etogo; Jesus Nunez; Rod Mahmoudizad; Geping Fang; E D Murphey; Tracy Toliver-Kinsky; Edward R Sherwood
Journal:  J Leukoc Biol       Date:  2010-07-13       Impact factor: 4.962

Review 6.  The pathogenesis of sepsis.

Authors:  Deborah J Stearns-Kurosawa; Marcin F Osuchowski; Catherine Valentine; Shinichiro Kurosawa; Daniel G Remick
Journal:  Annu Rev Pathol       Date:  2011       Impact factor: 23.472

7.  Cecal ligation puncture procedure.

Authors:  Miguel G Toscano; Doina Ganea; Ana M Gamero
Journal:  J Vis Exp       Date:  2011-05-07       Impact factor: 1.355

Review 8.  Sepsis-induced immunosuppression: from cellular dysfunctions to immunotherapy.

Authors:  Richard S Hotchkiss; Guillaume Monneret; Didier Payen
Journal:  Nat Rev Immunol       Date:  2013-11-15       Impact factor: 53.106

9.  A novel triptolide derivative ZT01 exerts anti-inflammatory effects by targeting TAK1 to prevent macrophage polarization into pro-inflammatory phenotype.

Authors:  Junmin Fu; Yingda Zang; Yu Zhou; Chengjuan Chen; Shuai Shao; Min Hu; Gaona Shi; Lei Wu; Dongming Zhang; Tiantai Zhang
Journal:  Biomed Pharmacother       Date:  2020-03-11       Impact factor: 6.529

10.  Acute Increase in O-GlcNAc Improves Survival in Mice With LPS-Induced Systemic Inflammatory Response Syndrome.

Authors:  Josiane Fernandes Silva; Vania C Olivon; Fabiola Leslie A C Mestriner; Camila Ziliotto Zanotto; Raphael Gomes Ferreira; Nathanne Santos Ferreira; Carlos Alberto Aguiar Silva; João Paulo Mesquita Luiz; Juliano Vilela Alves; Rubens Fazan; Fernando Queiróz Cunha; Jose Carlos Alves-Filho; Rita C Tostes
Journal:  Front Physiol       Date:  2020-01-21       Impact factor: 4.566

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.