Matrix metalloproteinase-9-1562 C/T promoter gene polymorphism in chronic periodontitis: A cross-sectional observational study.

Background: Matrix metalloproteinases (MMPs) are a major group of enzymes, released in inflamed periodontal tissues in large quantities, resulting in connective tissue matrix breakdown. One of the most predominant MMPs is MMP-9. Association between chronic periodontitis (CP) and MMP-9 gene polymorphism (GP) in some ethnic populations has been already established. The aim of the current study was to assess the association of single-nucleotide polymorphism in the promoter region of MMP-9 gene with CP in Kolkata population, if any. Materials and
Methods: Forty eligible individuals were recruited for the study and grouped as A and B: Group A (twenty periodontally healthy individuals) and Group B (twenty CP patients). Venous blood samples collected from all the forty individuals were used to isolate the genomic DNA. GP for MMP-9 gene was detected using polymerase chain reaction and sequencing method. The data obtained were then analyzed statistically.
Results: A significantly different genotypic and allelic variation was observed in the control and test groups, with C/T genotype and T allele present in only CP group.
Conclusion: Within the limitations of this study, we can conclude that there was no significant association between patients with periodontitis and MMP-9-1562 C/T promoter GP. Copyright:

INTRODUCTION

Glossary of periodontal terms defines chronic periodontitis (CP) as “an infectious disease resulting in inflammation within the supporting tissues of the teeth, progressive attachment and bone loss and is characterized by pocket formation and/or gingival recession.”[1] It is the most commonly occurring type of periodontitis, generally seen in adults, but can also be found in all age groups. Studies over half a century have shown that CP is a complex inflammatory disease with multiple factors capable of affecting its manifestation, progression, and treatment outcome.[2345] These factors include microbial challenge, environmental factors like smoking, and patient-related factors such as host response and systemic diseases.[678] Gemellological studies and family studies found genetics as one such factor which have a strong role in the development of periodontitis.[910111213] Various genes and their variations have been associated with CP. Among which, genetic polymorphisms influencing the expression of various matrix metalloproteinases (MMPs) are widely studied.

MMPs are a group of neutral endopeptidases belonging to the family of matrixins proteinases.[14] Twenty-three structurally related zinc-depended MMPs have been discovered till now, which are grouped depending upon their sequence homology and also substrate specificity.[1415] They are capable of degrading the extracellular molecules such as laminin, elastin, and fibronectin.[161718] Usually, their activities are strictly regulated by endogenous inhibitors like tissue inhibitors of metalloproteinases and circulating inhibitors like α2-macroglobulin.[19] This delicate balance is disturbed in conditions like periodontitis where there is periodontal tissue destruction leading to attachment loss and tooth loss.[2021] Previous reports have shown that excess production of MMPs can occur because of gene polymorphisms (GPs) which can influence the incidence, course, and treatment outcome of periodontitis.[22] GPs are variations in the gene sequence located within the genome between persons which affects about 1% of all populations.[23] The most frequent type of GP is single-nucleotide polymorphism (SNP) where a single base pair is changed in the DNA sequence.[23] SNP can affect the structure and function of gene expression which can further lead to variation in the phenotypic expression.[23]

MMP-9 and MMP-2 come under the gelatinase group which are capable of degradation of Type IV and Type V collagen in basement membrane.[2425] The gene for MMP-9 (gelatinase B) is situated on human chromosome 20q11.2-q13.1.[26] SNP of MMP-9 gene transpires on promoter site at the position -1562 (rs3918242) relative to the transcription start site where the shift between C and T occurs (MMP-9-1562C>T).[27] Functionally, this SNP causes an increase in the transcription of mRNA, resulting in increased translation of MMP-9 resulting in higher enzymatic activity.[2728] Studies have shown an association between promoter GP of MMP-9-1562C>T with diseases such as multiple sclerosis,[29] prostate cancer,[30] and oral squamous cell carcinoma.[31] Studies and meta-analyses have also focused on the association between aggressive forms of periodontitis and CP with MMP-9-1562C>T promoter GP but found inconsistent results.[32333435] Few meta-analyses have even suggested that ethnicity might play some roles in susceptibility to CP in patients with promoter GP of MMP-9-1562C>T.[35] Hence, studying the influence of promoter GP of MMP-9-1562C>T in periodontitis in different ethnicities is of importance. The current study aims to find a correlation between SNP of MMP-9 gene and CP in Kolkata population.

MATERIALS AND METHODS

A total of 65 unrelated Bengali (Bangla speaking) individuals in and around Kolkata were considered for the study. After applying the inclusion and exclusion criteria (described below), twenty periodontally healthy individuals (Group A [GA]) and twenty CP patients (Group B [GB]) were recruited [Figure 1]. OpenEpi software was used to determine the sample size with a 95% confidence interval and 80% power. GA consisted of individuals with clinically healthy periodontium as described by Lang and Bartold.[36] They used the term “clinical periodontal health” to describe such well-maintained clinically healthy periodontium which can be characterized by minimal or no clinical inflammation and normal periodontal support. Pristine periodontal health, periodontal disease stability, and periodontal disease remission/control are other forms of healthy periodontium described by Lang and Bartold.[36] Individuals with these forms of periodontium were not included in the current study.

Figure 1

Flowchart showing the study population. GA = Group A; GB = Group B; n = number of study participants

GB comprised periodontitis patients with Stages II and III at Grades A and B. In Stages II and III, there is interdental clinical attachment loss (CAL) ≥3 mm and radiographic bone loss more than 15%. Bone loss can extend from the coronal third to the apical third of the root.[37] Periodontal probing depth (PPD) more than 5 mm was included in GB. Stage I which has ≤4 mm PPD and 1–2 mm interdental clinical attachment level was excluded from the present study. Stage IV was excluded from the study because the number of remaining teeth is <20. Grade A and B periodontitis which have slow and moderate rates of progression, respectively, were included in GB.[37] Grade modifiers (risk factor) like patients with smoking and diabetes were excluded from the study. Individuals with systemic diseases or taking any medications which can influence periodontium, pregnant or lactating mothers, and patients who were not willing to participate were not included in the study. A thorough medical history and dental examinations were performed, and written informed consent was obtained from all the forty participants. Intraoral radiographic series were taken to study bone loss in GB. Gingival index (GI)[38] and plaque index (PI)[39] were recorded for all the forty participants. PPD and CAL were recorded using University of North Carolina-15 probe. All these clinical parameters were obtained on the day of obtaining blood samples by a single examiner. The intra-examiner reliability parameters were assessed using SPSS software, and the Cronbach's alpha values for average measures included 0.86 for PPD and 0.84 for CAL which were found to reproduce excellent scores of reliability.

Five-milliliter peripheral blood was collected from the antecubital vein from all participants in a Vacutainer coated with ethylenediaminetetraacetic acid. The collected samples of blood were frozen at −20°C until they were processed and used for DNA extraction. Genomic DNA was extracted with the help of a genomic DNA mini kit (DSR Genome technologies DNA Extraction Kit). Spectrophotometer was used to determine the concentration of extracted DNA. Polymerase chain reaction (PCR) amplification ensued by restriction enzyme digestion was used to find the SNP at -1562 position of MMP-9. The promoter region comprising the polymorphic site of MMP-9 was PCR amplified using primers 5’ATCTCCATCTCACAGTCTCATTT3’ and 5’GCCTCCCTCACTCCTTTCTT3’. PCR amplification was carried out in a thermal cycler (Applied Biosystems) with initial denaturation at 96°C for 5 min. This was followed by thirty cycles of denaturation at 96°C for 30 s, annealing at 58.5°C for 2 min, elongation at 72°C for 1 min, and a final elongation at 72°C for 7 min. The amplified PCR products generated were digested with the SphI restriction enzyme at 37°C overnight. The digested products were then examined by electrophoresis on a 2% agarose gel. Sequencing in Applied Biosystems (ABI) automated DNA sequencing machine was done to validate the PCR-RFLP result [Table 1].

Table 1

Primer and polymerase chain reaction conditions for matrix metalloproteinase-9 gene

Gene	Primer	PCR condition
MMP-9-1562 C/T	5’ATCTCCATCTCACAGTCTCATTT 3’(forward) 5’GCCTCCCTCACTCCTTTCTT3’ (reverse)	96°C for 5 min, 30 cycles (at 96°C for 30 s each), 58.5°C for 2 min, 72°C for 1 min, final elongation at 72°C for 7 min

MMP-9 – Matrix metalloproteinase-9; PCR – Polymerase chain reaction; °C – Degree celsius; min – Minutes; sec – Seconds; C/T – Cytosine/thymine

The significance of the alterations in observed occurrences of the polymorphisms among the groups (healthy and diseased) was assessed using Epi Info (TM) 3.5.3 developed by the Centers for Disease Control and Prevention. Chi-square test, corrected Chi-square test, test of proportion (Z-test), and t-test were performed from the data collected using Info 3.5.3 software (Developed by Centers for Disease Control and Prevention, Atlanta, Georgia, US). P <0.05 was considered statistically significant.

RESULTS

The results can be discussed in two parts, MMP-9-1562 C/T genotype distribution and MMP-9-1562 C/T allele distribution [Figure 2]. In the genotype distribution part, the current study detected the occurrence of MMP-9-1562 C/T GP in GB. C/C, C/T, and T/T were the three genotypic variants seen. The C/C genotype was found at a frequency of 100% in GA and 75% in GB. The C/T genotype was present only in GB, with a frequency of 25%. The T/T genotype, which was thought to increase MMP-9 transcription, was absent in both the groups. There was no significant association between the GB and the incidence of C/T genotype (P = 0.06) [Table 2].

Figure 2

(a) Sequencing result with C/C genotype; (b) Sequencing result with C/T genotype. A – Adenine; G – Guanine; C – Cytosine; T – Thymidine

Table 2

Matrix metalloproteinase-9-1562 cytosine/ thymine genotype and allele distribution in Group A and Group B

	Group A, n (%)	Group B, n (%)	P
MMP-9 genotype
C/C	20 (100)	15 (75)	0.29*
C/T	0	5 (25)	0.06*
T/T	0	0	0
MMP-9 allele
C	40 (100)	35 (87.5)	0.63*
T	NI	5 (12)	0.18*

*Nonsignificant (P<0.05 was considered as significant). MMP-9 – Matrix metalloproteinase-9; n – Number of subjects; NI – Not identified; P – Probability value; C – Cytosine; T – Thymine

In the allele distribution part, the study found that the C-allele distribution was at a frequency of 87.4% in GB, whereas it was present at a frequency of 100% in GA. In the case of T-allele, it was absent in GA but was present in GB at a frequency of 12.5% and it was not statistically significant (P = 0.18) [Table 2]. The clinical periodontal parameters were compared among T-allele carrier and noncarrier individuals in GB. The mean (mean ± standard error) PI in GA was 1.48 ± 0.92 compared to 2.04 ± 0.18 in GB. For GI, it was 1.02 ± 1.21 in GA and 1.98 ± 0.17 in GB. PPD was 4.51 ± 2.67 in GA and 5.26 ± 0.75 in GB. CAL in GA individuals was 2.53 ± 3.10 and 4.79 ± 1.03 in GB. No significant differences were observed between T-allele carrier and noncarrier [Table 3].

Table 3

Comparison of clinical parameters in the T-allele carrier and noncarrier chronic periodontitis patients

Parameters	Mean±SD		P
	C/C (n=15)	C/T (n=5)
PI	1.48±0.92	2.04±0.18	0.18*
GI	1.02±1.21	1.98±0.17	0.08*
PPD	4.51±2.67	5.26±0.75	0.54*
CAL	2.53±3.10	4.79±1.03	0.11*

*Nonsignificant (P<0.05 was considered as significant). PI – Plaque index; GI – Gingival index; PPD – Probing pocket depth; CAL – Clinical attachment level; n – Number of subjects; SD - Standard deviation; P – Probability value; C – Cytosine; T – Thymine

DISCUSSION

CP is a complex multifactorial disease process, initiated and modulated by various microbial and other environmental factors. It has been seen that individuals respond differently to this challenge resulting in varying susceptibility to CP. Studies have attributed this differential host response to an individual's genetic profile, where a candidate GP leads to pathogenesis and severity of periodontitis.[10] One such candidate gene is MMP-9 gene. The promoter region of MMP-9 gene harbors a functional C-to-T SNP at position -1562, which leads to three genotypic variants C/C, C/T, and T/T and is thought to surge MMP-9 expression and activity. The current study was conducted to assess the association of this GP of MMP-9 gene with CP, if any.

In this study, the C/C genotype was observed in 75% in GB whereas all the participants of GA expressed C/C genotype (frequency = 100%). This indicated the association of C/C genotype with health rather than diseased condition, i.e., CP. The C/T variant was found in 25% of the participants of GB but was absent in GA which indicates its role in CP. However, this result was not statistically significant (P = 0.06). Similar reports were observed by quite a few authors who have performed studies in Asian and Mixed populations like de Souza et al. in Brazilian (mixed) population, Loo et al. in Chinese (Asian) population, and several others.[1335404142434445] On the other hand, the studies conducted in Caucasians have reported an association between MMP-9 SNP and CP; for instance, a study by Keles et al. has found the association in Turkish (Caucasian) population which is in contrast with the current observation.[46] Meta-analyses by Pan et al. and Mashhadiabbas et al. have also found a moderate association in Caucasian population but nothing significant in Asian/mixed population.[3547] On the contrary, there are other studies which have found no link between the MMP-9 GP and CP in Caucasians.[334849]

The frequency of T-allele was 12.5% in GB in contrast to GA where it was absent. However, this was found to be statistically insignificant (P = 0.18). Other Asian and mixed population studies have shown similar results like de Souza et al., Gürkan et al., and Isaza-Guzmán et al.[404249] In contrast to our findings, Holla et al. have reported a marginally higher frequency of T-allele in Czech (Caucasian) population with severe CP compared to those with mild-to-moderate forms.[48] In our study, only the moderate form of periodontitis (Stages II and III, Grades A and B) was included.[37] In complete contrast, a few studies have reported higher T-allele frequency in health rather than in CP. This indicates that the MMP-9 has some protective anti-inflammatory activities.[4649] A meta-analysis by Weng et al. associated T-allele with reduced susceptibility to CP in both Caucasians and Asians.[32]

To examine whether carrier of rare allele and genotype could be related with the parameters recorded (GI, PI, PPD, and CAL), variances among the carrier and noncarrier individuals in GB were compared. The differences observed between the T-allele carriers and noncarriers were not significant. Comparable outcomes were reported by Gürkan et al.[49] They concluded that gene transcription is one of the regulatory mechanisms which monitors the MMP-9 activities.[49] Other mechanisms include latent MMP activation and tissue inhibitors of MMPs.[49] This absence of association between CP and MMP-9 GP suggested the importance of the other alternative mechanisms in directing the activities of MMP-9. Researchers also observed that host-derived mechanisms and multiple local factors play a vital role in regulating the activity of MMP-9 which leads to periodontal tissue destruction.[50] Thereby, they suggested the role of host mechanisms and local factors in MMP-9-mediated destruction of periodontal tissues rather than genetic factors.

The main limitation of the current study was that we have analyzed only the genetic expression of MMP-9. If we have also analyzed the clinical activity of MMP-9 along with the genetic component, it would have shed some more light on the mechanism by which MMP-9 GP can affect the periodontium, if any.

CONCLUSION

MMP-9 promoter GP (CT variant) was observed in 25% of the subjects with CP in contrast to the healthy controls. However, the C/T genotypic variation could not be significantly correlated with the susceptibility to CP. The T-allele at position (-1562) seen only in the CP group at a frequency of 12.5% was also found to be statistically insignificant. In the CP group, the examined clinical periodontal parameters were not significantly different between the T-allele carrier and noncarrier. Further long-standing studies are requisite to approve these outcomes because of the confines of the study.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.