Literature DB >> 35956529

Endophytic Bacillus subtilis SR22 Triggers Defense Responses in Tomato against Rhizoctonia Root Rot.

Younes M Rashad1, Sara A Abdalla1, Mohamed M Sleem1.   

Abstract

Rhizoctonia root rot is one of the most destructive diseases of tomato and other crops. The biocontrol of plant diseases using endophytic bacteria has gained significant attention due to their distinct advantages compared with the free-living ones, as well as their new unexplored and unique properties. Endophytic Bacillus subtilis SR22 represents a promising and more effective biocontrol and growth-promoting agent for tomato plants than the free-living agents, being an ecofriendly and sustainable tool in modern agriculture. In this study, the direct antagonistic activity of B. subtilis SR22 was investigated against Rhizoctonia solani in vitro. The biocontrol activity of B. subtilis SR22 against Rhizoctonia root rot of tomato was also investigated. Effects on the level of the transcriptional expression of defense-related genes, biochemical responses, and the vegetative growth of tomato plants were also studied. The dual culture test showed 51% inhibition in the mycelial growth of R. solani due to B. subtilis SR22, indicating its potent antagonistic behavior. Using a GC-MS analysis, twenty bioactive compounds were detected to be produced by B. subtilis SR22, including chlorogenic acid, pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro, propyl thioglycolic acid, phthalic acid, and 2,3-butanediol. Under greenhouse conditions, the application of B. subtilis SR22 led to a reduction (up to 51%) in Rhizoctonia root rot of tomato. Furthermore, an upregulation in the expression of the responsive factor JERF3 (10.9-fold) and the defense-related genes POD (9.1-fold) and PR1 (4.5-fold) in tomato plants was recorded due to the application of B. subtilis SR22. In addition, this treatment enhanced the total phenolic content (76.8%) and activity of the antioxidant enzymes POD (56%) and PPO (29.2%) in tomato roots, indicating its resistance-inducing effect on tomato plants. Moreover, this treatment enhanced most of the evaluated growth parameters in tomato plants (up to 35%). We can conclude that B. subtilis SR22 is a promising biocontrol agent and growth promoter in tomato plants against Rhizoctonia root rot. An evaluation of the formulation and field application of this bio-agent is necessary in future studies.

Entities:  

Keywords:  JERF3; Rhizoctonia solani; qRT-PCR; resistance; solanum lycopersicum

Year:  2022        PMID: 35956529      PMCID: PMC9370516          DOI: 10.3390/plants11152051

Source DB:  PubMed          Journal:  Plants (Basel)        ISSN: 2223-7747


1. Introduction

Tomato (Solanum lycopersicum L.), a member of the Solanaceae family, is one of the most globally cultivated and consumed horticultural crops [1]. In 2020, the total world production was estimated at 186.8 million tons from a total harvested area of 5 million ha [2]. Tomato is a nutritious and useful food containing several bioactive chemicals such as carotenoids (primarily lycopene and ß-carotene); ascorbic acid (vitamin C); tocopherols (vitamin E); fibers; vitamin A; and polyphenolic compounds (phenols, flavonoids, and phenolic acids) [1]. However, it is susceptible to several fungal pathogens that affect its production worldwide, causing high economic loss [3]. Among them, Rhizoctonia solani, Fusarium spp., and Pythium spp. can attack tomato plants during their early developmental phases, resulting in seed rot, pre-emergence damping-off, or stem rot in greenhouses and open fields [4]. Rhizoctonia root rot, caused by R. solani Kühn, is among the most destructive tomato diseases, causing enormous economic loss up to 50% [5]. This pathogen can persist in the soil as mycelia or sclerotia and within infected plant materials for several years, through which the pathogen can transmit to a new, uninfected area. Moreover, R. solani is a nonspecific pathogen, which has a broad host range [6]. Disease symptoms include seed rot, pre- and post-emergence damping off, root rot, stem and crown cancer, dwarfism, and may lead to the complete death of the plant under severe conditions [7]. Different anastomosis groups (AGs) of R. solani have been reported to infect tomato plants at varying degrees, including AG-2-1, AG-2-2, AG-3-PT, AG-4-HG-I, and AG-5 [8]. A variety of strategies have been used to manage this disease including chemical, physical, crop rotation, resistant cultivars, and biological control [9,10,11]. Among these alternative techniques, biological control is the most favorable, owing to its safety, eco-friendliness, and efficiency [12]. The biological control of R. solani on various crops has been extensively studied [10,11,13]. Among the biocontrol agents, numerous species belonging to genus Bacillus have been studied against different fungal diseases on different crops [14,15,16]. Their ability to form endospores, stimulate plant defenses, compete for resources and space, and produce potent antibiotics may contribute to their efficient bio-control activity [17]. Endophytic bacteria are non-pathogenic bacteria, which inhabit plant tissues for part of their life cycle without causing any disease symptoms [18]. They have various distinct advantages when compared with free-living bacteria, including colonization of an ecological niche similar to that of vascular plant pathogens; facing less competition with other microorganisms; achieving a sufficient supply of nutrients; less exposure to rhizosphere’s abiotic and antibiotic stress factors; and easy translocation of their bioactive metabolites within the host plant [19]. Recently, endophytes have gained significant attention due to their new unexplored and unique properties, as well as bioactive secondary metabolites that sustain their mutualistic interactions with their hosts [20]. Rajendran and Samiyappan [21] reported around a 64% reduction in Rhizoctonia damping off in cotton when treated with the endophytic Bacillus spp. (EPCO102 and EPCO16). In addition, a reduction in the mycelial growth of R. solani was also achieved in vitro. Various modes of action that may contribute to the endophyte’s antagonistic activity have been discussed, including competition for space or resources and antibiosis through the formation of antibacterial volatile or non-volatile metabolites [22]. In addition, there is another indirect role that endophytes may play in the bio-control via induction of the host immunity to the invading pathogen by activating multiple signaling pathways [21]. The priming of plant immunity results in the activation of multiple hypersensitivity reactions in the host, such as lignin deposition, accumulation of polyphenolic compounds and phytoalexins, and/or overexpression of multiple defense-related genes [23]. Among the up-regulated genes, advantageous entophyte colonization has shown to activate jasmonate and ethylene responsive factor 3 (JERF3), which controls a group of defense-responsive genes via jasmonate/ethylene signaling pathways such as peroxidase gene (POD), which encodes the antioxidant peroxidase enzyme, and the antifungal pathogenesis-related protein 1 gene (PR1) [10,24]. The objectives of this study were to (1) investigate the antagonistic activity of the endophytic B. subtilis against R. solani in vitro; (2) identify its produced antifungal secondary metabolites; (3) evaluate its bio-control activity against Rhizoctonia root rot of tomato under greenhouse conditions; (4) investigate its effects on the transcriptional level of the defense-related genes JERF3, PR1, and POD in tomato; (5) investigate its effect on the plant growth and biochemical parameters. Beneficial endophytic bacteria may represent a more effective and sustainable solution for plant diseases due to their unique compatibility with the host plant over the free-living bacteria.

2. Results

2.1. Molecular Identification and Phylogeny of the Endophytic Bacteria SR22

BLAST search results showed that the nucleotide sequence (1402 bp) of the isolated endophytic bacteria SR22 has 100% similarity with B. subtilis, which was deposited in GenBank under accession number (ON624459). The constructed phylogeny tree (Figure 1) showed that B. subtilis SR22 was grouped with B. subtilis, B. amyloliquefaciens, and B. licheniformis in a distinct cluster with 87% bootstrap support, while B. anthracis, B. cereus, B. thuringiensis and B. wiedmannii were grouped in a separate cluster with 92% bootstrap support.
Figure 1

Phylogeny tree showing the relationship between the endophytic Bacillus subtilis SR22 and the closely related strains from the GenBank. Bootstrap values (%) are shown at the branches.

2.2. Antagonism Assay of B. subtilis SR22 against R. solani In Vitro

Antagonistic activity of B. subtilis SR22 was investigated against R. solani in vitro (Figure 2). The obtained results showed that R. solani had a fast growth rate covering the full plate in 3 days. In contrast, a considerable inhibition in its growth (51%) was achieved when it was cultured with B. subtilis SR22 in the dual culture plate. This result demonstrates the antifungal potential of B. subtilis SR22 against R. solani.
Figure 2

A dual culture test revealing the antifungal activity of Bacillus subtilis SR22 against Rhizoctonia solani, where (a) control plate, and (b) dual culture plate.

2.3. Gas Chromatography-Mass Spectrometry (GC-MS)

Twenty secondary metabolites produced by B. subtilis SR22 were detected by GC-MS system (Figure 3, and Table 1). The results obtained showed that three substances were found in major ratios including propane, 2-ethoxy-(41.47%); chlorogenic acid (33.87%); and pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro (13.7%). Four compounds were detected in intermediate ratios including 1-hexadecanol (1.9%); propyl thioglycolic acid (1.5%); 2,3-butanediol (1.09%); and phthalic acid, 3,5-dimethylphenyl 4-isopropyl (1.03%), while the other metabolites were detected in trace ratios.
Figure 3

GC–MS chromatogram showing secondary metabolites produced by Bacillus subtilis SR22. Arrows show peak limits.

Table 1

Secondary metabolites of Bacillus subtilis SR22 as detected by GC-MS system.

Peak #Retention Time (min)Peak Area (%)Compound Name
11.5081.50Propyl thioglycolic acid
21.59233.87Chlorogenic acid
31.7881.092,3-Butanediol
41.8701.901-Hexadecanol
53.04413.70Pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro
63.2480.57Acetamide
73.65941.47Propane, 2-ethoxy-
84.5180.22Propanamide
913.6190.272-Piperidinone
1022.7350.893-Isopropoxy-1,1,1,7,7,7-hexamethyl-3,5,5-tri
1126.9230.61Benzeneethanamine, N-[(pentafluorophenyl)
1228.9080.20(S)-(+)-1,2-Propanediol
1329.6331.03Phthalic acid, 3,5-dimethylphenyl 4-isopropyl
1430.3430.08Phthalic acid, di(3,5-dimethylphenyl) ester
1531.8900.591,7-Di(3-ethylphenyl)-2,2,4,4,6,6-hexamethyl
1634.6590.131,2-Diphenyltetramethyldisilane
1737.4390.222,5-Piperazinedione, 3,6-bis(2-methylpropyl)
1837.8550.543-(2-N-Acetyl-N-methylaminoethyl)indol
1940.7760.35Bis[di(trimethylsiloxy)phenylsiloxy]trimethyl
2041.3110.80Heptasiloxane, hexadecamethyl-

2.4. Effect on Transcriptional Expression of the Defense-Related Genes

The transcriptional expression levels of the defense-response genes JERF3, POD, and PR1 were investigated in the tomato plants infected with Rhizoctonia root rot and/or treated with B. subtilis SR22 at 7 dpi (Figure 4). The results from the quantitative real-time PCR (qRT-PCR) revealed that treating the tomato plants with B. subtilis SR22 triggered the studied defense-related genes in a pathogen-dependent manner. In this regard, it was found that infection with R. solani upregulated the responsive factor JERF3, compared to the untreated control, while treating the infected tomato plants with B. subtilis SR22 led to the highest gene expression (10.9-fold). For POD, the obtained results showed that infection with R. solani or treatment with B. subtilis SR22 significantly overexpressed POD at varying degrees when compared with the untreated control treatment. However, the inducing effect of infection with R. solani was higher than that due to treating with B. subtilis SR22. The highest POD expression was recorded for the dual treatment (infected with R. solani and treated with B. subtilis SR22), recording 9.1-fold. For PR1, infection with R. solani upregulated PR1, compared with the control treatment. However, the highest PR1 expression was observed for the infected tomato plants, which were treated with B. subtilis SR22, recording 4.5-fold. The triggering effect of B. subtilis SR22 on the expression of the studied defense-response genes in a pathogen-dependent manner may indicate its protective role against R. solani.
Figure 4

Expression profile of jasmonate and ethylene-responsive factor 3 (JERF3), peroxidase (POD), and pathogenesis-related protein 1 gene (PR1) in tomato roots infected with Rhizoctonia solani and/or treated with Bacillus subtilis SR22 at 7 dpi. C: non treated and uninfected; P: non-treated and infected; B: uninfected and treated with B. subtilis SR22; and P+B: infected with R. solani and treated with B. subtilis SR22. For each gene, columns superscripted with the same letter are not significantly different according to Tukey’s HSD test at p ≤ 0.05. For each sample, three biological and three technical replicates were used. Error bars represent standard errors.

2.5. Effect on Disease Incidence and Severity

The biocontrol effect of treating the tomato plants with B. subtilis SR22 on the severity and incidence of Rhizoctonia root rot at 45 dpi is presented in Table 2. The results obtained showed that no disease symptoms were detected in the tomato plants, which did not receive R. solani inoculum, whether treated with B. subtilis SR22 or not. In contrast, the tomato plants that only received R. solani inoculum exhibited 100% disease incidence with 65% severity. Treating the infected tomato plants with B. subtilis SR22 led to a significant reduction in the disease incidence to 60.3% with a severity of 30%, compared with the untreated infected plants.
Table 2

Effect of Bacillus subtilis SR22 application on disease severity and incidence of tomato plants infected with Rhizoctonia root rot at 45 dpi *.

TreatmentDisease Incidence (%)Disease Severity (%)Severity Reduction (%)
C0.0 c0.0 c0.0 b
P100.0 a65.0 ± 3.2 a0.0 b
B0.0 c0.0 c0.0 b
P+B60.3 ± 2.5 b30.0 ± 2.4 b53.8 ± 2.0 a

* In each column, values followed by the same letter are not significantly different according to Tukey’s HSD test (p ≤ 0.05); each value represents the mean of three replicates ± SD. C: non-treated with B. subtilis SR22 and uninfected; P: non-treated with B. subtilis SR22 and infected; B: treated with B. subtilis SR22 and uninfected; and P+B: treated with B. subtilis SR22 and infected.

2.6. Effect on Growth Parameters

The effect of treatment with B. subtilis SR22 on the growth of tomato plants infected with Rhizoctonia root rot at 45 dpi is presented in Table 3. The results showed that the infection of tomato plants with Rhizoctonia root rot considerably reduced the lengths of tomato shoot and root, as well as their dry weights. In contrast, treating the tomato plants with B. subtilis SR22 significantly enhanced all of the evaluated growth parameters, except the number of leaves, when compared with the untreated, non-infected control plants. At the same time, treating the infected plants with B. subtilis SR22 led to an improvement in the shoot and root lengths and dry weights, when compared with the untreated infected plants. These results indicate the growth-promoting effect of B. subtilis SR22 on tomato plants, whether infected with R. solani or not.
Table 3

Mean growth parameters of tomato plants infected with Rhizoctonia root rot when treated with Bacillus subtilis SR22 at 45 dpi *.

TreatmentShoot Length (cm)Root Length (cm)Shoot Dry Weight (g)Root Dry Weight (g)No. of Leaves
C21.5 ± 2.1 b13.5 ± 0.9 b1.43 ± 0.07 b 0.33 ± 0.04 b7.7 ± 0.6 a
P15.7 ± 3.0 c10.1 ± 0.7 c0.88 ± 0.09 d0.24 ± 0.03 c7.3 ± 0.5 a
B29.1 ± 1.5 a16.8 ± 1.0 a1.97 ± 0.10 a0.39 ± 0.03 a8.0 ± 0.7 a
P+B20.8 ± 1.8 b12.7 ± 0.9 b1.18 ± 0.06 c0.30 ± 0.05 b7.6 ± 0.3 a

* In each column, values followed by the same letter are not significantly different according to Tukey’s HSD test (p ≤ 0.05); each value represents the mean of three replicates ± SD. C: non-treated with B. subtilis SR22 and uninfected; P: non-treated with B. subtilis SR22 and infected; B: treated with B. subtilis SR22 and uninfected; and P+B: treated with B. subtilis SR22 and infected.

2.7. Effect on Phenolic Content and Activity of Antioxidant Enzymes

The mean phenolic content and activity of peroxidase (POD) and polyphenol oxidase (PPO) enzymes in the roots of the tomato plants infected with Rhizoctonia root rot and treated with B. subtilis SR22 at 45 dpi are presented in Table 4. Data from the biochemical analyses revealed that infection of the tomato plants with R. solani led to a significant increment in their total phenolic content and the activity of POD and PPO, compared with the non-infected control plants. The application of B. subtilis SR22 on the tomato plants also induced their phenolic content and increased the activities of both POD and PPO. However, the inducing effect due to infection with R. solani was higher than that due to B. subtilis SR22, when compared with the untreated, non-infected control treatment. The highest values of these parameters were recorded for the tomato plants infected with R. solani and treated with B. subtilis SR22, compared with the untreated, non-infected tomato plants.
Table 4

Mean phenolic content and activity of peroxidase (POD) and polyphenol oxidase (PPO) enzymes in roots of tomato plants infected with Rhizoctonia root rot and treated with Bacillus subtilis SR22 at 45 dpi *.

TreatmentPhenolic Content(mg.g−1 Fresh wt)POD(∆A470 min−1 g−1 Fresh wt)PPO(∆A420 min−1 g−1 Fresh wt)
C125.3 ± 2.2 d1.419 ± 0.07 d1.374 ± 0.06 d
P290.7 ± 2.7 b2.993 ± 0.06 b1.984 ± 0.04 b
B221.5 ± 3.1 c2.215 ± 0.04 c1.775 ± 0.09 c
P+B387.0 ± 5.4 a3.157 ± 0.08 a2.204 ± 0.08 a

* In each column, values followed by the same letter are not significantly different according to Tukey’s HSD test (p ≤ 0.05); each value represents the mean of three replicates ± SD. C: non-treated with B. subtilis SR22 and uninfected; P: non-treated with B. subtilis SR22 and infected; B: treated with B. subtilis SR22 and uninfected; and P+B: treated with B. subtilis SR22 and infected.

2.8. Pearson Correlation Coefficient between the Studied Variables

The correlation coefficient values between the variables studied in the tomato plants are illustrated in Table 5. The results showed that the shoot length of the tomato plants strongly correlated with the root length and shoot dry weight, recording r = 0.91 and 0.90, respectively, at p ≤ 0.001, and moderately correlated with the root dry weight (r = 0.72 at p ≤ 0.01). In addition, the root length of tomato exhibited moderate correlation with the shoot dry weight (r = 0.82 at p ≤ 0.01) and low correlation with the root dry weight (r = 0.62 at p ≤ 0.05). Meanwhile, the shoot dry weight moderately correlated with the root dry weight (r = 0.73 at p ≤ 0.01). Furthermore, the total phenolic content strongly correlated with both enzymes peroxidase and polyphenol oxidase (r =0.96 and 0.98, respectively at p ≤ 0.001), while both enzymes strongly correlated with each other (r = 0.97 at p ≤ 0.001). In contrast, no correlations were recorded between the number of leaves, phenolic compounds, peroxidase and polyphenol oxidase enzymes with the other growth variables.
Table 5

Pearson correlation coefficient (r) between the tested variables.

Shoot LengthRoot LengthShoot Dry WeightRoot Dry WeightNumber of LeavesPhenolic ContentPeroxidasePolyphenol Oxidase
Shoot length1
Root length0.91 ***1
Shoot dry weight0.90 ***0.82 **1
Root dry weight0.72 **0.62 *0.73 **1
Number of leaves0.35 ns0.44 ns0.52 ns0.38 ns1
Phenolic content−0.28 ns−0.31 ns−0.25 ns−0.38 ns−0.16 ns1
Peroxidase−0.38 ns−0.41 ns−0.37 ns−0.50 ns−0.24 ns0.96 ***1
Polyphenol oxidase−0.22 ns−0.27 ns−0.18 ns−0.36 ns−0.17 ns0.98 ***0.97 ***1

* = significant at p ≤ 0.05; ** = significant at p ≤ 0.01; *** = significant at p ≤ 0.001; while, ns = not significant.

2.9. Principal Component Analysis of Studied Variables

The results from the principal component analysis showed that PC1 was represented by the growth parameters (shoot length, root length, dry weight of shoot, dry weight of root, and number of leaves), while PC2 was represented by phenolic content, peroxidase and poly phenol oxidase enzymes (Figure 5). The four tested treatments were well separated from each other on the diagram, indicating that no similarity was observed between them. The three studied variables (phenolic content, peroxidase and poly phenol oxidase enzymes) were more pronounced for the treatment (P+B) than treatment (P), while the studied growth variables (shoot length, root length, dry weight of shoot, dry weight of root, and number of leaves) were more pronounced for treatment (B) than the control treatment (C).
Figure 5

Ordination biplot of principal component analysis of the studied variables. C: non-treated with B. subtilis SR22 and uninfected; P: non-treated with B. subtilis SR22 and infected; B: treated with B. subtilis SR22 and uninfected; and P+B: treated with B. subtilis SR22 and infected.

3. Discussion

Rhizoctonia root rot is one of the most destructive diseases of tomato and other crops, causing enormous plant damage and around 50% reduction in the yield. The biocontrol of plant diseases using endophytic bacteria has gained significant attention due to their distinct advantages compared with the free-living ones, as well as their new unexplored and unique properties [19]. The results obtained in this study indicated an effective antagonistic potential of B. subtilis SR22 against R. solani in vitro. This result is in accordance with the inhibition in the mycelial growth of R. solani due to the endophytes Bacillus sp. EPCO102 and Bacillus sp. EPCO16, reported by Rajendran and Samiyappan [21]. In this regard, different antagonistic mechanisms can be discussed, including competition for space and/or nutrients, in addition to antibiosis via the production of a diverse set of volatile and non-volatile antifungal secondary metabolites, and/or antifungal enzymes [22]. Moreover, around 200 antibiotics with variable structures and potentialities have been reported to be produced by Bacillus spp. [25]. The obtained inhibition in the mycelial growth of R. solani can be attributed to the competition or production of antifungal metabolites by B. subtilis SR22. However, the inhibition zone due to competition for nutrients cannot be visually distinguished from that due to antibiosis. Therefore, we performed a GC-MS analysis for the produced metabolites in the filtered culture of B. subtilis SR22 to identify the antifungal constituents. The results from the GC-MS analysis revealed the production of various compounds with an antifungal background, to which the antagonistic behavior of B. subtilis SR22 can be attributed, such as chlorogenic acid, pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro, propyl thioglycolic acid, and phthalic acid. Chlorogenic acid, the main produced metabolite by B. subtilis SR22 (33%), has been reported as a potent antifungal compound against different phytopathogenic fungi, inducing lysis of their cells via interfering with their cell permeability [26]. Pyrroles derivatives have been also reported to exhibit antifungal activity via the downregulation of some functional proteins-encoding genes, inhibiting the synthesis of these vital proteins [27]. All of these antifungal metabolites synergistically contributed to the antagonistic behavior of B. subtilis SR22. One of the most interesting results obtained in this study is the effective biocontrol activity of B. subtilis SR22 when applied on tomato plants against infection with Rhizoctonia root rot. This result is in agreement with that obtained by Wu et al. [28] for the application of B. subtilis SL-44 against pepper seedling wilt, caused by R. solani. In addition to the direct antifungal activity of B. subtilis SR22 against R. solani, our study showed an overexpressing effect of its use on the responsive factor JERF3 and some defense-related genes in tomato roots (POD and PR1). JERF3 regulates many defense genes via jasmonic acid and ethylene signaling pathways against various stresses that affect the plant [24]. In addition, POD and PR1 were also upregulated due to B. subtilis SR22. The POD gene that encodes for the antioxidant enzyme peroxidase acts as a scavenger of reactive oxygen species (ROS) and is produced due to the infection stress that destroys the plant cell structure, in addition to its role in the detoxification of hydrogen peroxide (H2O2) [29]. This triggering effect was supported by the elevated activity of POD and PPO enzymes in tomato roots, which was recorded in this study due to B. subtilis SR22 application. The recorded overexpression of PR1, which encodes for an antifungal pathogenesis-related protein 1, is a further evidence that has long been used as a marker for induced plant immunity [30]. Furthermore, the recorded increment in the phenolic compounds in tomato roots, which have fungitoxic effects on different pathogenic fungi, represents another triggered plant defense mechanism against R. solani. In addition to their direct inhibitory effect on the mycelial growth of the fungal pathogen, the deposition of some phenolic compounds such as lignin in the plant cell wall acts as a physical barrier restricting the pathogen transfer from cell to cell [31]. All of these defense mechanisms synergistically contributed to the biocontrol activity of B. subtilis SR22 and indicated their roles in triggering tomato resistance against Rhizoctonia root rot. In this regard, the results from the GC-MS analysis revealed production of the bioactive compound 2,3-butanediol by B. subtilis SR22. This compound has been widely reported as a resistance inducer for many plants through the ethylene signaling pathway via ROS homeostasis and upregulating the defense-related PR genes [32]. One of the interesting results obtained from this study is the growth promoting effect of applying B. subtilis SR22 on tomato plants, even if they are infected. This result is in agreement with that reported by Gohil et al. [33] for Bacillus sp. PG-8 on the growth of groundnut plants. The GC-MS analysis in this study revealed production of the bioactive compound 2,3-butanediol, which has been reported as a growth promoter for various plants [32]. This may explain the growth promoting effect of B. subtilis SR22 reported on tomato plants. Various growth promoting mechanisms have been discussed for Bacillus spp. including the production of growth regulators, siderophores, phosphate solubilization, nitrogen fixation, and the mitigation of abiotic and biotic stresses [34]. Improving the performance of the photosynthetic apparatus as well as the efficiency and content of their pigments has also been reported via enhancing the activity of the photosynthetic enzymes [35].

4. Materials and Methods

4.1. Tomato Cultivar and Used Microorganisms

Tomato seeds (cv. Castle Rock), obtained from Korma seed Co., Cairo, Egypt, were used in the greenhouse experiment. A virulent isolate of R. solani (AG-4 HG-I), originally isolated from rotted tomato roots, was obtained from the Plant Pathology Department, Faculty of Agriculture, Mansoura University, Egypt. The fungal pathogen was maintained on slants of potato dextrose agar (PDA, Difco, Detroit, MI, USA) at 4 °C until use. The endophytic bacteria were isolated from the stem of a faba bean plant that was cultivated in Kafr El-sheekh governorate, Egypt (30.98436° N, 31.29191° E). For inoculum preparation, the pathogen was cultured in a glass flask containing sterilized sorghum: soil medium (1:2, v/v) for 2 weeks at 28 ± 2 °C. To isolate the entophytic bacteria, plant tissues were cut into sections (1 mm2); the surface was sterilized using 90% ethanol for 3 min, followed by NaOCl solution (5%) for 3 min, rinsed in sterile water, and then aseptically plated on PDA plates and incubated at 28 °C for 2 days. The endophyte was picked up and transferred into PDA plates for purification. The purified colony was stained using Gram stain to examine the bacterial shape and Gram stain reaction, and designated SR22. For molecular identification, DNA was extracted using QiAamp DNA Mini Kit (Qiagen, Hilden, Germany). To amplify the 16S rDNA region, the primers 16S-27F: 5′-AGAGTTTGATCMTGGCTCAG-3′ and 16S-1492R:5′-CGGTTACCTTGTTACGACTT-3′ were used, following the method adopted by White et al. [36]. The nucleotide sequence was aligned and compared with the GenBank database via the NCBI search tool, BLAST. The phylogenetic tree of the obtained sequence and the closest BLAST sequences from the GenBank database were constructed based on the maximum likelihood method, using MEGA X software version 10.2.4. The inoculum of the endophyte was prepared by culturing on potato dextrose broth for 5 days at 30 °C. A spore suspension was adjusted at 105 cfu mL−1 and supplemented with 3% gum arabic.

4.2. Antagonism Assay of B. subtilis SR22 against R. solani In Vitro

The antagonistic potential of B. subtilis SR22 was investigated against R. solani in vitro using the dual culture technique. In a PDA plate, B. subtilis SR22 was streaked 3 cm from the plate edge, and a 6 mm-diameter disc, taken from a 3-days-old culture of R. solani, was inoculated 2 cm from the opposite edge. A PDA plate only inoculated with a disc of R. solani was used as a control. For each treatment, 4 replicates were used. The plates were incubated at 28 °C and the test was ended when the control plate had a full growth. The growth inhibition (%) of R. solani was determined compared to the control plate.

4.3. GC-MS

The secondary metabolites of B. subtilis SR22 were identified using a GC-MS QP2010 system (Shimadzu, Kyodo City, Japan). The analysis was performed as follows: the detector mass spectrometer voltage was 75 eV at a max temperature of 260 °C. The capillary column (TRB-5MS, 30 m × 0.25 mm × 0.25 µm) was used. The GC program started at 60 °C for 3 min, and the oven temperature was increased at 5 °C min−1 until 260 °C where it was held for 10 min. The identity of the secondary metabolites was determined using the database of the National Institute of Standards and Technology (NIST 11) Spectral Library (Gaithersburg, MD, USA).

4.4. Greenhouse Experiment

Tomato seeds that were soaked in the spore suspension of B. subtilis SR22 for 5 h were sown in pots (20 cm diameter) and filled with sterilized soil (clay: sand, 1:2, v/v) at 5 seeds per pot. In addition, another dose (5 mL/seedling) of the spore suspension was applied as a soil drench 21 days post sowing. Tomato seeds soaked in sterilized water with 3% gum arabic were sown in another pot and served as the control treatment. Soil infestation was achieved by mixing the inoculum of R. solani with the upper layer of the soil at 2% (v/v), 14 days post planting. Five pots were used for each treatment. NPK fertilization was applied per kg of soil as follows: ammonium nitrate (350 mg), super phosphate (250 mg), and potassium sulfate (150 mg). All the pots were arranged in a complete randomized design, regularly watered (one time a week), and kept under greenhouse conditions at 31/25 °C day/night, 70% humidity. The applied treatments were as follows: C: non-treated with B. subtilis SR22 and uninfected; P: non-treated with B. subtilis SR22 and infected; B: treated with B. subtilis SR22 and uninfected; and P+B: treated with B. subtilis SR22 and infected.

4.4.1. qRT-PCR

Seven days post-infection (dpi), the samples of the tomato roots from each treatment were collected for molecular investigation. The mRNA extraction of the samples was carried out using RNeasy Mini Kit (Qiagen, Hilden, Germany). The obtained mRNA was quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA), and then stored at −20 °C. For cDNA synthesis, a reaction mixture with a total volume of 20 μL was used, containing mRNA (30 ng, 3 μL); dNTPs (10 mM, 2.5 μL); reaction buffer (2.5 μL); primer (5 pmol μL−1, 5 μL); reverse transcriptase enzyme (New England Biolabs, Germany) (0.2 μL); and RNase free water (6.8 μL). The reaction was carried out using a SureCycler 8800 thermocycler (Agilent, Santa Clara, CA, USA) at 42 °C for 1 h, and at 70 °C for 10 min, and then the product was stored at −80 °C. A qRT-PCR was performed using a Rotor Gene 6000 system (Qiagene Inc., Germantown, MD, USA). A reaction mixture with a total volume of 20 μL was used, containing cDNA (3 μL); SYBR Green Master Mix (Bioline, Germany) (12.5 μL); primer F + R (1.5 μL + 1.5 μL); and sterile RNase free water (1.5 μL). The sequences of the tested primers are presented in Table 6. β-actine was used as a reference gene. The real-time PCR program was carried out as follows: one cycle at 95 °C for 3 min, and 45 cycles at 95 °C for 15 s, 56 °C for 30 s, and 72 °C for 30 s. For each sample, three biological and three technical replicates were used. The comparative CT method (2−ΔΔCT) was used to analyze the relative expression level [37].
Table 6

Primer sequences used in the molecular investigation.

Gene DescriptionAbbrev.Accession No.Sequence (5′-3′)
Jasmonate and ethylene-responsive factor 3JERF3-FJERF3-RAY383630GCCATTTGCCTTCTCTGCTTCGCAGCAGCATCCTTGTCTGA
PeroxidasePOD-FPOD-RX94943CCTTGTTGGTGGGCACACAAGGCCACCAGTGGAGTTGAAA
Pathogenesis-related protein 1PR1-FPR1-RM69247ACTTGGCATCCCGAGCACAACTCGGACACCCACAATTGCA
β-actinβ-actin-Fβ-actin -R GTGGGCCGCTCTAGGCACCAA
CTCTTTGATGTCACGCACGATTTC

4.4.2. Disease Assessment

Five tomato plants at forty-five dpi from each treatment were carefully uprooted and evaluated for disease incidence (DI) and severity (DS). For the DS assessment, the damage level in the tomato roots and hypocotyl was rated on a 5-degrees scale, as described by Carling et al. [38], where 0: no damage; 1: low discoloration; 2: discoloration and small necrosis; 3: discoloration and large necrosis; and 4: full death. This was calculated as follows: where a = number of rotted roots at the same degree, b = degree of disease, A = total number of assessed roots, and B = the highest degree of disease.

4.4.3. Plant Growth Evaluation

Five tomato plants at forty-five dpi from each treatment were uprooted and evaluated for shoot and root lengths, shoot and root dry weights, and number of leaves. The dry weights were recorded after the samples were dried in a drying oven at 80 °C for 48 h.

4.4.4. Estimation of Total Phenolic Content and Enzymes Activities

Forty-five dpi, total phenolic content, and enzymes activities were estimated in tomato roots of different treatments. For preparation of the crude extract, 3 g of fresh roots was ground in 5 mL phosphate buffer (100 mM, pH 7). The homogenate was centrifuged at 10,000 rpm for 15 min, the supernatant was then collected to serve as a crude extract in the next analyses. For each treatment, five replicates were applied. The total phenolic content was estimated using the Folin–Ciocalteu method, as described by Malik and Singh [39]. The activity of the POD enzyme was estimated according to Maxwell and Bateman [40], and the activity of the PPO enzyme was estimated according to Galeazzi et al. [41].

4.5. Statistical Analyses

The obtained results were analyzed using the CoStat software (version 6.4, CoHort Software, Monterey, CA, USA) [42]. The data were first examined for normality and then subjected to an analysis of variance. The means were compared using Tukey’s HSD test at p ≤ 0.05 based on a one-way ANOVA [43].

5. Conclusions

This study reported a potent antagonistic activity of the endophyte B. subtilis SR22 against R. solani in vitro. Twenty secondary metabolites produced by B. subtilis SR22 were detected by a GC-MS analysis. These metabolites included various bioactive ones such as chlorogenic acid, pyrrolo [1,2-a]pyrazine-1,4-dione, hexahydro, propyl thioglycolic acid, phthalic acid, and 2,3-butanediol. The results from the greenhouse experiment revealed a considerable biocontrol activity for B. subtilis SR22 against Rhizoctonia root rot of tomato, recording a 53.8% reduction in the disease severity and incidence. Molecular investigation using a qRT-PCR showed a triggering effect for applying B. subtilis SR22 on the transcriptional expression level of the responsive factor JERF3 and the defense-related genes POD and PR1 in infected tomato plants. In addition, the total phenolic content and activity of the antioxidant enzymes POD and PPO in tomato roots were also induced due to B. subtilis SR22 treatment, indicating its resistance-inducing effect on tomato plants. Moreover, a growth promotion of tomato plants mediated by B. subtilis SR22 was also reported. In this regard, this treatment enhanced most of the evaluated growth parameters in tomato plants. The obtained results indicated that all aims of the study were achieved. Based on these results, we can conclude the promising role for B. subtilis SR22 as an immunity inducer and growth promoter in tomato plants against Rhizoctonia root rot, which may qualify it as an effective biocontrol agent. This biocontrol agent may benefit tomato-growers and may be efficient against this disease on others crops, at least from the same family. However, the field evaluation for this bio-agent is highly recommended singly and/or in association with other bio-agents for developing a highly effective and eco-safe biofungicide.
  26 in total

1.  Induction of defense responses in common bean plants by arbuscular mycorrhizal fungi.

Authors:  G M Abdel-Fattah; S A El-Haddad; E E Hafez; Y M Rashad
Journal:  Microbiol Res       Date:  2010-07-13       Impact factor: 5.415

Review 2.  Secondary metabolites of soil Bacillus spp.

Authors:  Estibaliz Sansinenea; Aurelio Ortiz
Journal:  Biotechnol Lett       Date:  2011-04-29       Impact factor: 2.461

3.  Chlorogenic acid is a fungicide active against phytopathogenic fungi.

Authors:  Guadalupe Martínez; Mariana Regente; Santiago Jacobi; Marianela Del Rio; Marcela Pinedo; Laura de la Canal
Journal:  Pestic Biochem Physiol       Date:  2017-06-01       Impact factor: 3.963

4.  Biocontrol of Rhizoctonia solani damping-off and promotion of tomato plant growth by endophytic actinomycetes isolated from native plants of Algerian Sahara.

Authors:  Yacine Goudjal; Omrane Toumatia; Amine Yekkour; Nasserdine Sabaou; Florence Mathieu; Abdelghani Zitouni
Journal:  Microbiol Res       Date:  2013-08-03       Impact factor: 5.415

Review 5.  Inner Plant Values: Diversity, Colonization and Benefits from Endophytic Bacteria.

Authors:  Hongwei Liu; Lilia C Carvalhais; Mark Crawford; Eugenie Singh; Paul G Dennis; Corné M J Pieterse; Peer M Schenk
Journal:  Front Microbiol       Date:  2017-12-19       Impact factor: 5.640

Review 6.  Bacterial Endophyte Colonization and Distribution within Plants.

Authors: 
Journal:  Microorganisms       Date:  2017-11-25

7.  Antifungal and plant growth promotion activity of volatile organic compounds produced by Bacillus amyloliquefaciens.

Authors:  Yuncheng Wu; Jinyan Zhou; Chengguo Li; Yan Ma
Journal:  Microbiologyopen       Date:  2019-03-24       Impact factor: 3.139

8.  Biocontrol of Rhizoctonia solani via Induction of the Defense Mechanism and Antimicrobial Compounds Produced by Bacillus subtilis SL-44 on Pepper (Capsicum annuum L.).

Authors:  Zhansheng Wu; Yuanyuan Huang; Yan Li; Jiawei Dong; Xiaochen Liu; Chun Li
Journal:  Front Microbiol       Date:  2019-11-28       Impact factor: 5.640

Review 9.  Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes.

Authors:  Yiyang Yu; Ying Gui; Zijie Li; Chunhao Jiang; Jianhua Guo; Dongdong Niu
Journal:  Plants (Basel)       Date:  2022-01-30

10.  Reducing the Use of Pesticides with Site-Specific Application: The Chemical Control of Rhizoctonia solani as a Case of Study for the Management of Soil-Borne Diseases.

Authors:  Ronan Le Cointe; Thomas E Simon; Patrick Delarue; Maxime Hervé; Melen Leclerc; Sylvain Poggi
Journal:  PLoS One       Date:  2016-09-26       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.