Mallesh Pandrala1, Arne Antoon N Bruyneel2, Anna P Hnatiuk2, Mark Mercola2, Sanjay V Malhotra1. 1. Department of Cell, Developmental and Cancer Biology, Center for Experimental Therapeutics, Knight Cancer Institute, Oregon Health and Science University, Portland, Oregon 97201, United States. 2. Cardiovascular Institute and Department of Medicine, Stanford University, Stanford, California 94305, United States.
Abstract
Development of tyrosine kinase inhibitors (TKIs) targeting the BCR-ABL oncogene constitutes an effective approach for the treatment of chronic myeloid leukemia (CML) and/or acute lymphoblastic leukemia. However, currently available inhibitors are limited by drug resistance and toxicity. Ponatinib, a third-generation inhibitor, has demonstrated excellent efficacy against both wild type and mutant BCR-ABL kinase, including the "gatekeeper" T315I mutation that is resistant to all other currently available TKIs. However, it is one of the most cardiotoxic of the FDA-approved TKIs. Herein, we report the structure-guided design of a novel series of potent BCR-ABL inhibitors, particularly for the T315I mutation. Our drug design paradigm was coupled to iPSC-cardiomyocyte models. Systematic structure-activity relationship studies identified two compounds, 33a and 36a, that significantly inhibit the kinase activity of both native BCR-ABL and the T315I mutant. We have identified the most cardiac-safe TKIs reported to date, and they may be used to effectively treat CML patients with the T315I mutation.
Development of tyrosine kinase inhibitors (TKIs) targeting the BCR-ABL oncogene constitutes an effective approach for the treatment of chronic myeloid leukemia (CML) and/or acute lymphoblastic leukemia. However, currently available inhibitors are limited by drug resistance and toxicity. Ponatinib, a third-generation inhibitor, has demonstrated excellent efficacy against both wild type and mutant BCR-ABL kinase, including the "gatekeeper" T315I mutation that is resistant to all other currently available TKIs. However, it is one of the most cardiotoxic of the FDA-approved TKIs. Herein, we report the structure-guided design of a novel series of potent BCR-ABL inhibitors, particularly for the T315I mutation. Our drug design paradigm was coupled to iPSC-cardiomyocyte models. Systematic structure-activity relationship studies identified two compounds, 33a and 36a, that significantly inhibit the kinase activity of both native BCR-ABL and the T315I mutant. We have identified the most cardiac-safe TKIs reported to date, and they may be used to effectively treat CML patients with the T315I mutation.
Chronic myeloid leukemia (CML) is a myeloproliferative
neoplasm
that accounts for approximately 15% of newly diagnosed leukemia cases
in adults, and it is estimated that 61 090 new leukemia cases
will be diagnosed in the United States in 2021.[1] The fusion protein product of the Philadelphia chromosome
(Ph), BCR-ABL,[2−6] is associated with CML and a subset acute lymphoblastic leukemia
(Ph+ ALL); therefore, the development of TKIs targeting the BCR-ABL
oncogene constitutes an effective approach for the treatment of CML
and/or ALL. Imatinib [Gleevec, ST1571 (Figure )], a first-line drug for patients diagnosed
with CML, inhibits the activity of the BCR-ABL kinase protein. The
clinical success of imatinib paved the way to consider kinases as
druggable targets.[7−10] However, despite its durable initial response in most of the CML
patients, imatinib fails in ≤40% of patients due to the intolerance
of the dose and drug resistance. Mutations within the kinase domain
of BCR-ABL constitute the most frequent mechanism of drug resistance,[11−14] as they cause ineffective binding of the inhibitor to the target.[15] To date, more than 100 different point mutations
have been identified in CML patients. Resistance to imatinib prompted
the development of second-generation inhibitors, including nilotinib
(Tasigna, AMN107), the multitarget kinase inhibitor dasatinib (Sprycel,
BMS-354825), and bosutinib (Bosulif, SKI-606) (Figure ), that were approved for second-line use.[13,16,17] Although these second-generation
inhibitors demonstrated superior potency over imatinib, they fail
to inhibit many imatinib-resistant mutations,[18−20] including the
T315I “gatekeeper” mutation [replacement of threonine
(Thr) with isoleucine (Ile) at position 315 in the ABL1 kinase domain]
that occurs in >20% of CML patients.[15,21,22] When Thr315 is mutated to Ile, its bulkier side chain
protrudes into the enzyme active site and prevents imatinib and the
second-generation inhibitors from entering and binding to the ATP-binding
pocket. Consequently, the first- and second-generation inhibitors
are ineffective against the tumors carrying T315I mutant BCR-ABL.[17,23,24] Notably, several of these active
site BCR-ABL inhibitors cause serious adverse side effects in patients.
These include increased risks of vascular events for nilotinib,[25] pulmonary hypertension and myelosuppression
for dasatinib, and increased ALT and AST levels for bosutinib.[13,26] There have been several attempts to develop inhibitors effective
against the T315I mutant kinase; however, clinical development of
these compounds has been halted due to toxicity concerns.[21,27] In 2012, the FDA approved the third-generation multikinase inhibitor
ponatinib (Figure ) with a broad label as a second-line treatment option for the patients
with CML and Ph+ ALL.[28,29] It was shown to be most potent
inhibitor among the TKIs that target BCR-ABL and has demonstrated
excellent activity against T315I mutant clones.[30−32] However, soon
after its approval, it was found to cause serious vascular adverse
events, and therefore, its use has been restricted for the treatment
of tumors carrying the T315I mutant kinase. Ponatinib remains the
only approved treatment option for the patients with the T315I mutation.[33] Unfortunately, it is among the most cardiotoxic
of all of the FDA-approved TKIs.[34] Its
cardiotoxicity is thought to be due to concurrent inhibition of kinases
that are important for cardiovascular function,[35] which are likely due to off-target effects caused by its
binding to structurally similar ATP pockets.[35−37] Therefore,
the development of a new TKI that works against the T315I mutation
with improved safety to meet clinical needs is warranted. Several
approaches have been reported to address the challenges associated
with ponatinib. In most of these studies, the new inhibitor showed
efficacies similar to that of ponatinib on native protein kinase but
lacked a desired effect on the T315I mutant protein kinase.[38,39]
Figure 1
Chemical
structures of the FDA-approved BCR-ABL inhibitors.
Chemical
structures of the FDA-approved BCR-ABL inhibitors.We envisioned that if a TKI were to be effective
against both native
and T315I mutant BCR-ABL, and highly cardiac-safe compared to ponatinib,
it would gain a broader scope of utilization and provide much needed
relief to the CML and Ph+ ALL patients with T315I mutations. Considering
the cardiac-safe nature of imatinib and nilotinib as compared to ponatinib,[26,34] we hypothesized that it should be possible to discover a cardiac-safe
BCR-ABL inhibitor by modifying the structure of existing BCR-ABL inhibitors.
We reasoned that H bond interactions between the TKIs and the Met318
residue in BCR-ABL are essential for the inhibitor to show efficacies
against BCR-ABL. Therefore, re-engineering the core structure of each
TKI responsible for H bond interaction with Met318 and studying the
structure–activity relationship (SAR) for efficacies and cardiac
safety would yield potential drugs that are more broadly applicable
in the clinic.We combined our drug design paradigm with iPSC-CM
and vascular
endothelial cell models to predict the cardiotoxicities of the new
analogues. As expected, the newly designed inhibitors exhibited similar
efficacies as benchmark FDA drugs against the K-562 cell line, a BCR-ABL
positive CML tumor cell line. In addition, they also show excellent
efficacies against K-562 cells engineered to express BCR-ABLT315I. Using the iPSC-CM cardiomyocyte contractility assays, we initially
screened all new analogues and identified cardiotoxic cores. As a
result, we finally identified cardiac-safe cores and determined the
SAR around the core for efficacies against both native and T315I mutant
cell lines, while maintaining cardiac safety. Subsequently, structural
modifications led to the discovery of inhibitors 33a and 36a (Figure ), which have significantly improved cardiac safety over ponatinib,
inhibited the kinase activity of BCR-ABLT315I, and blocked
the proliferation of K-562 CML cells carrying the mutated kinase.
Figure 2
Design
of the novel BCR-ABL inhibitors using a diversification
strategy.
Design
of the novel BCR-ABL inhibitors using a diversification
strategy.
Results and Discussion
Molecular Design and Computational Studies
Figure shows the FDA-approved
BCR-ABL inhibitors. An important aspect of their activity is the interaction
with the kinase through specific hydrogen bonding. These inhibitors
form H bond interactions with the backbone of Met318 in the hinge
region of native BCR-ABL. In addition, inhibitors such as imatinib,
dasatinib, and nilotinib make a key hydrogen bond to the side chain
of the gatekeeper residue Thr315.[17,24,40] The formation of a H bond is critical for the activity
of these inhibitors. Therefore, if the gatekeeper residue is mutated
to Ile (T315I), this H bond is lost. Steric clashes of the bulkier
Ile residue are posited to block entry of the inhibitor into the hydrophobic
pocket, resulting in the loss of the H bond interaction with Met318
and efficacy against the T315I mutation. Similar steric hindrance
of Ile was also observed for bosutinib. Consequently, the only H bond
that bosutinib makes with Met318 in native BCR-ABL is inhibited when
Thr at position 315 of BCR-ABL is mutated to Ile, and therefore, it
is inactive.[41] In contrast, ponatinib does
not make H bond interactions with Thr315 in native BCR-ABL but makes
H bond interactions with Met318 with both native and T315I mutant
BCR-ABL kinase (Figure c,d), inhibiting both native BCR-ABL and BCR-ABLT315I kinases,[30] explaining its unique efficacy against tumors
carrying the T315I mutation.[33]
Figure 3
Potential binding
modes of ponatinib and lead inhibitors 33a and 36a with BCR-ABLWT (PDB entry 3OXZ) and BCR-ABLT315I (PDB entry 3IK3) proteins. (a and b) Binding interactions of inhibitors 33a and 36a, respectively. (c and d) Ponatinib
binding interactions. The key residues, which will potentially make
critical interactions with inhibitors, are shown in stick form and
labeled. The distances between two atoms are indicated as yellow dashed
lines and labeled in black.
Potential binding
modes of ponatinib and lead inhibitors 33a and 36a with BCR-ABLWT (PDB entry 3OXZ) and BCR-ABLT315I (PDB entry 3IK3) proteins. (a and b) Binding interactions of inhibitors 33a and 36a, respectively. (c and d) Ponatinib
binding interactions. The key residues, which will potentially make
critical interactions with inhibitors, are shown in stick form and
labeled. The distances between two atoms are indicated as yellow dashed
lines and labeled in black.On the basis of these observations, we reasoned
that a H bond between
an inhibitor and Met318 is crucial for activity against both native
BCR-ABL and BCR-ABLT315I kinases. Therefore, we hypothesized
that designing a hybrid molecule based on core structures of the existing
BCR-ABL inhibitors that make H bond interactions with Met318 and studying
their binding interactions with native BCR-ABL and BCR-ABLT315I protein would be an ideal first step. Using core structures of approved
BCR-ABL inhibitors, several hybrid molecules were designed and computational
studies were performed to investigate the potential binding modes
of new compounds. These studies revealed that a majority of our designed
molecules formed key H bond interactions with the backbone of Met318
in the hinge region of the native BCR-ABL. Moreover, some of the hybrids
showed H bond interactions with Met318 in BCR-ABLT315I.
Importantly, the hybrids that were designed using a core structure
from ponatinib (structure similar to that of 9) occupied
the ATP pocket of the BCR-ABLT315I and were predicted to
form a H bond interaction with the backbone of Met318 (Figure and Figure S1). Furthermore, as shown in Figure b, lead compounds 33a and 36a occupied the same binding region in BCR-ABLT315I as did ponatinib and formed the same distance between the N atom
of the Met318 residue and the N atom of the imidazo[1,2-b]pyridazine moiety of inhibitors (Figure d). Moreover, the distances between the atoms
of other key residues such as Glu286 and Asp381 and the atoms of our
lead compounds [which could potentially interact with these residues
by H bonding (Figure a,b)] were also similar to that observed for ponatinib with BCR-ABLT315I. The superimposition of both BCR-ABL and BCR-ABLT315I kinases (Figure ) with the poses of lead compounds predicted that the ethyne
linker in these inhibitors would skirt the mutated gatekeeper residue
Ile315, similar to the case for ponatinib.[42] Therefore, these compounds could possibly show efficacies similar
to those of ponatinib in inhibiting BCR-ABLT315I.
Figure 4
Potential binding
interactions of (a) ponatinib and (b) 33a and 36a after alignment of protein structures of BCR-ABLWT (pale
green, PDB entry 3OXZ) and BCR-ABLT315I (gray, PDB
entry 3IK3).
Potential binding
interactions of (a) ponatinib and (b) 33a and 36a after alignment of protein structures of BCR-ABLWT (pale
green, PDB entry 3OXZ) and BCR-ABLT315I (gray, PDB
entry 3IK3).
Chemistry
Compound 3a was obtained from
a commercial source (Ark Pharma). The synthesis of hit finder compounds
2-amino-N-(2-chloro-6-methylphenyl)thiazole-5-carboxamide-based
inhibitors 3b–d is shown in Scheme . N-(2-Chloro-6-methylphenyl)-2-[(2-methylpyrimidin-4-yl)amino]thiazole-5-carboxamide 3b was prepared according to the previously reported procedure
for a similar analogue,[43] by the SNAr displacement of 4-chloro-2-methylpyrimidine 2b with 2-amino-N-(2-chloro-6-methylphenyl)thiazole-5-carboxamide 1. Alternatively, 3c and 3d were
obtained by amide coupling in the presence of EDC·HCl and HOBt.
Scheme 1
Synthesis of Hit Finder Compounds
Reagents and conditions:
(a)
NaH (60% in mineral oil), DMF, 0 °C to rt, overnight; (b) EDC·HCl,
HOBt, diisopropylethylamine, THF, rt, 18 h.
Synthesis of Hit Finder Compounds
Reagents and conditions:
(a)
NaH (60% in mineral oil), DMF, 0 °C to rt, overnight; (b) EDC·HCl,
HOBt, diisopropylethylamine, THF, rt, 18 h.Inhibitors 11a–c were synthesized on the basis
of the tandem Sonogashira strategy using a previously reported procedure
for similar analogues.[44] As illustrated
in Scheme , two general
methods (A and B) were explored using either 3-bromoimidazo[1,2-b]pyridazine 4 or methyl 3-iodo-4-methylbenzoate 6 as coupling agents in the first Sonogashira reaction. This
was a straightforward reaction used for both reagents 4 and 6, and the corresponding products were isolated
in good yields. However, the final Sonogashira reaction employed in
method B resulted in very low yields of the desired product, with
debromination of 4 being the major impurity. Therefore,
method A was used to synthesize 8. Hydrolysis of 8 using a 1 M LiOH solution afforded 9, which
upon reaction with appropriate amines 10a–c in
standard amide coupling conditions, using EDC and HOBt, afforded the
final compounds 11a–c, respectively. HIT compound 15 was synthesized using a convenient route outlined in Scheme . An amide coupling
of the readily available 3-iodo-4-methylbenzoic acid 12 with 3-bromo-5-(trifluoromethyl)aniline 13 in the presence
of SOCl2 and DIPEA yielded intermediate 14. Subsequent Sonogashira coupling of 14 with 5 provided inhibitor 15.
Scheme 2
Synthesis of HIT
Finder SAR
Reagents and conditions:
(a)
trimethylsilylacetylene, [PdCl2(Ph3P)2], CuI, K2CO3, acetonitrile, 100 °C, 24
h; (b) CuI, [Pd(Ph3P)4], diisopropylethylamine,
DMF, sealed tube, 100 °C, 5 h; (c) 1 M LiOH solution in water,
1:1 THF/MeOH, rt, 24 h; (d) EDC·HCl, HOBt diisopropylethylamine,
THF, rt, 18 h.
Scheme 3
Synthesis of the HIT Compound
Reagents and conditions:
(a)
SOCl2, diisopropylethylamine, DMAP, THF, reflux, 5 h, THF;
(b) CuI, [Pd(Ph3P)4], diisopropylethylamine,
DMF, sealed tube, 100 °C, 5 h.
Synthesis of HIT
Finder SAR
Reagents and conditions:
(a)
trimethylsilylacetylene, [PdCl2(Ph3P)2], CuI, K2CO3, acetonitrile, 100 °C, 24
h; (b) CuI, [Pd(Ph3P)4], diisopropylethylamine,
DMF, sealed tube, 100 °C, 5 h; (c) 1 M LiOH solution in water,
1:1 THF/MeOH, rt, 24 h; (d) EDC·HCl, HOBt diisopropylethylamine,
THF, rt, 18 h.
Synthesis of the HIT Compound
Reagents and conditions:
(a)
SOCl2, diisopropylethylamine, DMAP, THF, reflux, 5 h, THF;
(b) CuI, [Pd(Ph3P)4], diisopropylethylamine,
DMF, sealed tube, 100 °C, 5 h.Inhibitors 19, 20, 21a, 21b, and 24 were synthesized according to the
synthetic route outlined in Scheme . Starting material 3-ethynyl-4-methylbenzoic acid 16 was obtained from 3-iodo-4-methylbenzoate 6 via Sonogashira reaction followed by hydrolysis. Amide coupling
of 17 with 16 resulted in 19, which underwent Sonogashira coupling with 4-iodo-1-methyl-1H-imidazole to yield 20. Inhibitors 21a and 21b were prepared like 19 using 18a and 18b instead of 16 as the
carboxylic acid precursors. Inhibitor 24 was prepared
from 17 via an amide coupling followed by a Sonogashira
reaction, with the appropriate starting materials.
Scheme 4
Synthesis of Inhibitors 19–21 and 24
Reagents and conditions:
(a)
(i) trimethylsilylacetylene, [PdCl2(Ph3P)2Cl], CuI, triethylamine, THF, rt, 24 h; (ii) KOH, MeOH; (b)
EDC·HCl, HOBt diisopropylethylamine, DMF, rt, 18 h; (c) 4-iodo-1-methyl-1H-imidazole, CuI, [PdCl2(Ph3P)2], diisopropylethylamine, DMF, sealed tube, 100 °C, 24
h; (d) CuI, [PdCl2(Ph3P)2], diisopropylethylamine,
DMF, sealed tube, 100 °C, 24 h.
Synthesis of Inhibitors 19–21 and 24
Reagents and conditions:
(a)
(i) trimethylsilylacetylene, [PdCl2(Ph3P)2Cl], CuI, triethylamine, THF, rt, 24 h; (ii) KOH, MeOH; (b)
EDC·HCl, HOBt diisopropylethylamine, DMF, rt, 18 h; (c) 4-iodo-1-methyl-1H-imidazole, CuI, [PdCl2(Ph3P)2], diisopropylethylamine, DMF, sealed tube, 100 °C, 24
h; (d) CuI, [PdCl2(Ph3P)2], diisopropylethylamine,
DMF, sealed tube, 100 °C, 24 h.Synthesis
of inhibitors 26, 29, and 32 is depicted in Scheme . Inhibitor 26 was obtained by reacting
3-(4-methyl-1H-imidazol-1-yl)-5-(trifluoromethyl)aniline 25 with 16 using standard EDC-HOBt amide coupling
conditions. Inhibitor 29 was prepared in a manner similar
to that of 19, using the required starting materials
for both Sonogashira reactions.[45] The structure
of inhibitor 32 resembled that of 11b; however,
the sole difference is that the amide group in 32 was
inverted between the two aryl groups. It was prepared in two steps.
In the initial step, amide condensation was performed between 3-iodo-4-methylaniline 30 and 2d to afford intermediate 31, which was then reacted with 5 via Sonogashira reaction
conditions to provide inhibitor 32.
Scheme 5
Synthesis of Inhibitors 26, 29, and 32
Reagents and conditions:
(a)
EDC·HCl, HOBt diisopropylethylamine, DMF, rt, 18 h; (b) (i) trimethylsilylacetylene,
[PdCl2(Ph3P)2], CuI, triethylamine,
THF, rt, 24 h; (ii) KOH, MeOH; (c) CuI, [Pd(Ph3P)4], diisopropylethylamine, DMF, sealed tube, 100 °C, 5 h.
Synthesis of Inhibitors 26, 29, and 32
Reagents and conditions:
(a)
EDC·HCl, HOBt diisopropylethylamine, DMF, rt, 18 h; (b) (i) trimethylsilylacetylene,
[PdCl2(Ph3P)2], CuI, triethylamine,
THF, rt, 24 h; (ii) KOH, MeOH; (c) CuI, [Pd(Ph3P)4], diisopropylethylamine, DMF, sealed tube, 100 °C, 5 h.Scheme illustrates
the synthesis of inhibitors 33a–h compiled in Table . Briefly, a copper-catalyzed
N-arylation[46−48] of imidazole or substituted imidazoles or methyl
pyrrole or methyl piperazine with 15 yielded corresponding
compounds 33a–h. Notably, the coupling reaction
worked well for all of the substrates reported here; however, a slight
decrease in yield was observed for inhibitors 33e and 33f, with pyrrole and methyl piperazine moieties, respectively.
Notably, compound 33e was synthesized by microwave irradiation.
Scheme 6
Synthesis of Inhibitors 33a–h
Reagents and conditions:
(a)
CuI, 8-Quinolinol, K2CO3, DMSO.
Table 5
SAR around 15e
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.
IC50 was determined by
following the biochemical kinase assay protocol. The data represent
the mean and standard deviation of at least two independent experiments
performed in duplicate.
Overall smallest toxic dose.
Data taken from ref (52).
Cell viability in the
presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. HMVEC-Cs were treated with inhibitors, and GI50 values
were measured to assess the vasculotoxicity as the AUC (area under
the curve) as shown in Figure a. ND, no inhibition detected at concentrations of ≤10
μM.
Synthesis of Inhibitors 33a–h
Reagents and conditions:
(a)
CuI, 8-Quinolinol, K2CO3, DMSO.The synthetic protocols for inhibitors 36a–c and 40a–c are outlined in Schemes and 8, respectively.
They were prepared using the amide coupling and Sonogashira procedures
outlined in Scheme .
Scheme 7
Synthesis of Inhibitors 36a–c
Reagents and conditions:
(a)
(i) SOCl2, reflux, 5 h; (ii) diisopropylethylamine, DMAP,
THF, 18 h; (b) CuI, [Pd(Ph3P)4], diisopropylethylamine,
DMF, sealed tube, 100 °C, 5 h.
Because the
H bond interactions between the inhibitor and Met318 in BCR-ABL were
considered to play a crucial role in the activity of the desired compounds,
we initially selected core fragments of the FDA-approved TKIs, which
are important in making H bond interactions with Met318, and designed
hybrid molecules to identify cardiac-safe “HIT” molecules.
The new compounds were evaluated for their kinase and cellular activities in vitro, against both BCR-ABL and BCR-ABLT315I kinases and corresponding K-562 cell lines. Their cardiomyocyte
toxicities were evaluated by probing the contractility and voltage
transients in human iPSC-CMs to help guide template selection. The
results from the in vitro human iPSC-CM assays have
been shown previously to correlate well with clinical incidences of
toxicity for small molecule kinase inhibitor oncology therapeutics.[49−51] Briefly, the transients were quantified, and curve fitted, to extract
several measures for voltage (action potential duration of 75%) and
contractility (peak contraction amplitude). The minimal concentration
at which the dose response curve of any metric or the variability
of the given metric deviated beyond a threshold (25%) from the control
was deemed the overall minimum toxic dose. Imatinib, dasatinib, and
ponatinib were used as controls to validate the screening conditions.As shown in Table , under the experimental conditions, the hybrids prepared from the
dasatinib core (fragment) showed significant efficacies against native
K-562 cells. In particular, 3d potently inhibited the
growth of native K-562 cells with a GI50 value of 30 nM.
Consistent with the cellular inhibition potency, it inhibited the
activity of native BCR-ABL kinase (Table ). However, similar to dasatinib, these hybrids
were also ineffective against the T315I mutation and did not inhibit
the activity of the BCR-ABLT315I kinase or the growth of
the corresponding K-562 cell line.
Table 1
Cellular Activity of the Hit Finder
Compoundsc
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.
Overall smallest toxic dose.
Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.
Table 2
Kinase Inhibition for the Selected
Hit Finder Compounds
kinase
inhibition (IC50, nM ± SD)a
Compound
BCR-ABLWT
BCR-ABLT315I
3c
5.0 ± 0.3
>10000
3d
0.5 ± 0.3
>10000
11b
4.0 ± 0.3
547 ± 3.9
11c
1000
>10000
15
150 ± 16
360 ± 31
20
58.5 ± 1.0
120 ± 6.6
21b
9.1 ± 2.8
670 ± 72
24
9.4 ± 2.0
16.1 ± 2.2
32
1.6 ± 0.3
390 ± 1.7
imatinib
190b
>10000b
dasatinib
0.3b
1140b
ponatinib
2.2 ± 0.1
5.1 ± 0.1
IC50 was determined by
following the biochemical kinase assay protocol. The data represent
the mean and standard deviation of at least two independent experiments
performed in duplicate.
Data taken from ref (52).
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.Overall smallest toxic dose.Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.IC50 was determined by
following the biochemical kinase assay protocol. The data represent
the mean and standard deviation of at least two independent experiments
performed in duplicate.Data taken from ref (52).It is plausible that when the Thr at position 315
of BCR-ABL is
mutated to the bulkier Ile residue, it could possibly block the entry
of new compounds into the hydrophobic pocket. Therefore, the H bond
interaction between new hybrids and the Met318 residue will be lost.
Also, this could result in the loss of other key H bond interactions
with Thr315 as observed in the case of dasatinib.[24] Therefore, they are inefficient against BCR-ABLT315I. Moreover, our computational studies of 3d with BCR-ABLT315I revealed that none of the docking poses allowed H bond
interactions with Met318. In the best pose, the position of 3d closest to Met318 (Figure S2a) was still too far away to form an H bond with Met318, whereas it
was found to be within range to form H bond interactions with native
BCR-ABL (Figure S2b).The new compounds 3a–d appeared to be cardiac-safe
(Table ), as there
was no decrease in the contractile amplitude or alterations in the
iPSC-CM voltage waveforms at concentrations of ≤10 μM.
Arrhythmia was assessed by analyzing cardiomyocyte voltage traces
for evidence of action potential prolongation, after depolarizations,
tachycardia and bradycardia, ectopy, etc. (see Experimental
Section). Also, we did not observe a decrease in contractility
up to this dose.This initial findings with the dasatinib core
encouraged us to
explore SAR using core moieties of other inhibitors predicted to bind
Met318 in the hinge region of BCR-ABL. Therefore, considering the
similar approach of H bond interactions with Met318 in BCR-ABLT315I, we explored the SAR against a ponatinib fragment, 3-(imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methylbenzoic acid (9) and designed new compounds (11a–c and 15). As shown in Table , significant improvement was observed in the growth inhibition
of both native K-562 cells and K-562 cells expressing BCR-ABLT315I for these hybrids. 15 in particular showed
remarkable growth inhibition against native and kinase-mutated K-562
cells, with GI50 values of 18 and 370 nM, respectively.
Consistent with its cellular activity, 15 also strongly
inhibited the native BCR-ABL and BCR-ABLT315I kinases in
a biochemical kinase assay (Table ), with IC50 values of 150 and 360 nM, respectively.
These data suggest that 15 could access the hydrophobic
pocket of BCR-ABLT315I. Docking studies predicted that 15 should interact with key residues, such as Met318, Glu286,
and Asp381 of BCR-ABLT315I via H bond interactions (Figure S3), in a manner similar to that shown
for ponatinib.[30] On the contrary, 11a and 11c were found to be inactive and showed
no efficacy against K-562 cells at concentrations of ≤10 μM.
We found that 11c has dose-dependent cardiomyocyte toxicity,
while other compounds derived from the ponatinib core moiety showed
improved cardiac safety compared to that of ponatinib. We speculated
that the cardiotoxicity of 11c could be due to its interaction
with some other targets that would potentially cause cardiomyocyte
toxicity. Therefore, the fragment (R group) used to prepare 11c was avoided in the subsequent studies.
Table 3
Cellular Activity of the Hit Finder
Compoundsc
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.
Overall smallest toxic dose.
Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.Overall smallest toxic dose.Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.Despite being less potent than ponatinib, hybrids
containing the
fragment of ponatinib that interacts with Met318 exhibited significantly
improved cardiac safety compared to that of ponatinib. We speculated,
therefore, that other portions of ponatinib might be responsible for
its cardiomyocyte toxicity. We explored this idea further in the next
step by studying the SAR around the remaining core of ponatinib. Several
structurally diverse hybrids were prepared using 4-[(4-methylpiperazin-1-yl)methyl]-3-(trifluoromethyl)aniline 17 as a core. Consistent with our hypothesis, the majority
of hybrids (Table , 19, 20, 21a, 21b, and 29) exhibited cardiomyocyte toxicity. Interestingly,
some of the hybrids were inactive against K-562 cell lines yet exhibited
cardiomyocyte toxicity significantly higher than that of the hybrids
that were active in this series. For example, compounds 21a and 29 were ineffective against K-562 cells up to 10
μM but were found to be highly cardiomyocyte toxic at doses
of 0.64 and 1.26 μM, respectively. Moreover, 21b, which is a hybrid molecule of imatinib and ponatinib, had significantly
increased cardiomyocyte toxicity at 5.21 μM (Table ). These findings suggest that
the cardiomyocyte toxicity arises from fragment 17 because
imatinib did not exhibit cardiomyocyte toxicity up to 25 μM,
whereas appreciable cardiomyocyte toxicity was observed for 21b at a much lower concentration.
Table 4
Cellular Activity of the Hit Finder
Compoundsc
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.
Overall smallest toxic dose.
Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.Overall smallest toxic dose.Cell viability in the presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. ND, no inhibition detected at concentrations of ≤10
μM.Despite their cardiomyocyte toxicities, the hybrids
that were generated
from 17, such as 20, 21b, and 24, all were efficacious against K-562 cells, with GI50 values of 300, 3, and 3 nM, respectively. However, except
for 24, none of these hybrids showed improved efficacies
over 15 against BCR-ABLT315I kinase and the
corresponding K-562 cell lines. Because compound 15 exhibited
more favorable cardiomyocyte safety than 24, we decided
to explore its SAR further.
SAR around 15
The SAR around the lead
compound 15 was explored by investigating the influence
of different R1 and R2 groups. Our computational
investigation suggested that modifications at the R1 and
R2 positions could preserve important elements of molecular
recognition. The new analogues should access ATP-binding sites of
both BCR-ABL and BCR-ABLT315I, and therefore, they would
make key H bond interactions with Met318, Glu286, and Asp381 in both
proteins (Figure S1). Hence, we expected
either similar or enhanced potencies for the designed hybrids compared
to that of 15. As shown in Table , most of the
hybrids demonstrated improved efficacies in enzymatic and cellular
assays relative to that of 15. We found that replacing
the bromo group with imidazole or substituted imidazoles at the R2 position dramatically enhanced the activities for the inhibitors.
For example, 33a–d and 36a have remarkably
increased potencies compared to that of 15 (Table and Figure a,b). Notably, 33a and 36a showed dramatically increased potencies (a
6–7-fold improvement compared to that of 15) in
both enzymatic and cellular assays against BCR-ABLT315I. For these compounds, the bulkiness of the imidazole ring seemed
to affect the potency of these hybrids. For example, compared to 33a, hybrids 36a, 33b–d, 33g, and 33h, which contain alkyl groups or bulky
aromatic groups at position C-4 of the imidazole ring, were found
to be less potent. Increasing the alkyl chain length at this position
gradually decreased the activity of the hybrids. This phenomenon was
generally observed for both BCR-ABL and BCR-ABLT315I protein
inhibition. For example, 33a with no substitution on
the imidazole showed superior activity among all of the hybrids, with
IC50 values of 20.1 and 43.7 nM for BCR-ABL and BCR-ABLT315I, respectively, whereas 36a, with a methyl
group at position C-4 of the imidazole ring, was slightly less potent
than 33a (IC50 values of 26.3 and 51.4 nM
for BCR-ABL and BCR-ABLT315I, respectively). Moreover,
while the length of the alkyl chain of 33b and 33c was gradually increased upon incorporation of ethyl and
isopropyl groups, respectively, their potencies also decreased. Finally, 33c with an isopropyl group was found to be the least potent
among all of the n-alkyl-substituted analogues (IC50 values of 119 and 255 nM for BCR-ABL and BCR-ABLT315I, respectively). The sole exception to an increased alkyl chain length
correlating with decreased activity was 33d. Unexpectedly,
its cyclopropyl substitution corresponded to slightly improved activity
(IC50 values of 88.4 nM for BCR-ABL and 164 nM for BCR-ABLT315I) compared to that seen with isopropyl analogue 33c.
Figure 5
Antiproliferative activities of inhibitors. (a) Relative viability
of K-562 cells and K-562-T315I cells. (b) Percent inhibition of ABL1
and ABL1T315I protein with drug treatment with ponatinib and hybrid
compounds 15, 33a–d, and 36a.
GI50 values are shown
as the median and median absolute deviation (MAD) of at least two
independent experiments performed in triplicate.IC50 was determined by
following the biochemical kinase assay protocol. The data represent
the mean and standard deviation of at least two independent experiments
performed in duplicate.Overall smallest toxic dose.Data taken from ref (52).Cell viability in the
presence of
varying concentrations of compounds was measured by the AlamarBlue
assay. HMVEC-Cs were treated with inhibitors, and GI50 values
were measured to assess the vasculotoxicity as the AUC (area under
the curve) as shown in Figure a. ND, no inhibition detected at concentrations of ≤10
μM.
Figure 6
Cardiac safety of inhibitors. (a) Vasculogenesis
assay. HMVEC-Cs
were treated for 6 h with a dose response 3-fold change with a maximum
dose of 10 μM imatinib, ponatinib, 24, 33a–d, and 36a. DMSO was used as a control, and mean ±
SEM values were used to plot the graph. (b) Images of the vasculogenesis
assay for the control, imatinib, ponatinib, 24, 33a–d, and 36a at a dose of 1.1 μM
(scale bar, 200 μM). Analogues preserved the ability to form
a capillary-like network similar to control and imatinib, whereas
loop formation was not observed for HMVEC-Cs treated with ponatinib.
(c) Vasculotoxicity vs GI50 for imatinib, ponatinib, 33a–d, and 36a. AUC is area under the
curves shown in panel a. (d) Cardiomyocyte toxicity vs GI50 for imatinib, ponatinib, 33a–d, and 36a. Cardiotoxicity is qualified as the smallest dose that caused cardiotoxicity.
(e) Vasculotoxicity vs cardiomyocyte toxicity of all compounds tested.
Note that 33a showed a safety profile similar to that
of imatinib, whereas 36a showed an intermediate safety
profile.
Antiproliferative activities of inhibitors. (a) Relative viability
of K-562 cells and K-562-T315I cells. (b) Percent inhibition of ABL1
and ABL1T315I protein with drug treatment with ponatinib and hybrid
compounds 15, 33a–d, and 36a.As described in ref (53), the kinase profiles of 33a and 36a remain
largely unchanged. Additional studies are needed to understand whether
the altered potencies contribute to the improved cardiotoxicity profiles
of 33a and 36a or to ascertain if they affect
noncardiac toxicity. Overall, the BCR-ABLT315I kinase activity
for these hybrids was reduced by 2–3-fold compared to the native
BCR-ABL kinase activity, similar to the difference observed for ponatinib.[42] A slight outward displacement of the Flag-methyl
group containing the phenyl ring of the hybrids from the hydrophobic
pocket of BCR-ABLT315I would account for the reduction
in potency against BCR-ABLT315I. This is similar to the
outward displacement observed for ponatinib in complex with BCR-ABLT315I that leads to reduced potencies against this mutated
kinase and the corresponding cell lines.[42]Next, we explored the effect of steric hindrance by using
1H-benzo[d]imidazole (33g)
and 4-phenyl-1H-imidazole (33h) moieties.
We found that hybrids 33g and 33h have markedly
reduced kinase and cellular activities. Compared to 33a, the potencies of these compounds are decreased 7–16- and
4–9-fold in the BCR-ABLT315I enzymatic and cellular
assays, respectively.To further optimize the lead compound,
we focused on improving
solubility. We hypothesized that incorporation of the 1-methylpiperazine
moiety would improve cell permeability and help reduce lipophilicity.
However, we found that 33f did not show improved efficacies
compared to 33a. Moreover, relative to 33a, compound 33f had 2-fold decreased activity against
BCR-ABLT315I kinase. The cellular inhibition efficacy for 33f was consistent with that in the biochemical assay. Another
hybrid, 33e, with 3-methyl-1H-pyrrole,
was also less effective than 33a and showed significantly
reduced BCR-ABLT315I kinase and cellular potencies of 14-
and 6-fold, respectively. This suggests that the second nitrogen in
the five-member ring is essential for improving the efficacies of
the hybrids.Next, a Flag-methyl[54] group (R1) was briefly included to evaluate its impact
on inhibitory activity.
Hybrids 33a, 33d, and 36a were
selected for the study, and the results are summarized in Table . When the methyl
group in 33a was replaced with H, the resulting compound, 40a, displayed efficacies similar to those of 33a against the native BCR-ABL kinase. However, its activities against
BCR-ABLT315I and the corresponding cell lines were dramatically
decreased. Hybrids 40c and 36b, which were
derived from 33d and 36a, respectively,
maintained similar activities as seen with the corresponding analogues
containing the methyl group against both native BCR-ABL and BCR-ABLT315I kinases. On the contrary, their cellular potencies decreased
by 2–10-fold. We observed that large hydrophobic groups at
the R1 position were detrimental to the activities on both
kinase and cellular levels. For instance, relative to 33d and 36a, methoxy analogues 40b and 36c demonstrated 8–16- and 35–100-fold losses
of potency against BCR-ABLT315I kinase and the corresponding
K-562 cell lines, respectively. In line with previous findings,[44,54,55] our results clearly demonstrated
the importance of the Flag-methyl group in the selective inhibition
of BCR-ABL. Furthermore, similar to ponatinib binding with BCR-ABL,[42] the presence of the Flag-methyl group in hybrids
favored desirable binding orientations within BCR-ABL. Accordingly,
substituting the Flag-methyl group with either H or a large hydrophobic
group resulted in a loss of selectivity,[56] and the corresponding hybrids were found to be less potent than
analogues containing the methyl group.
Hybrids Decreased Adverse Cardiomyocyte and Vascular Toxicities
The TKIs currently used for the treatment of CML primarily target
BCR-ABL kinase activity. However, most of them have shown distinctive
off-target activities,[30,57] which result in adverse effects.[35] These cardiovascular complications have restricted
the use of the most potent TKIs.[34,58,59] Among these, ponatinib is currently the only FDA-approved
drug that effectively inhibits the BCR-ABLT315I mutation
and has been restricted due to cardiovascular adverse events to treating
only patients carrying mutated tumors refractory to first- and second-line
therapeutics.[34,58] Ponatinib cardiomyocyte toxicity
events were observed at a low dose of 1.49 μM in vitro (Table ). Similarly,
ponatinib inhibited the integrity of vascular structures formed by
HMVEC-Cs in vitro (Figure ) at <1 μM.
In addition, it inhibited the growth of healthy HEK cells at 1.1 μM.
These results demonstrated its toxicity in realistic assays and allowed
us to develop improved hybrid compounds with excellent efficacies
against both BCR-ABLT315I kinase and corresponding K-562
cells lines that were also safer in the vascular and cardiomyocyte
assays (Figure ).
In addition, compounds 33a and 33b did not
inhibit vascular integrity on HMVEC-Cs even at 10 μM, which
suggests that these hybrids are cardiac-safe. In particular, highly
potent hybrids 33a and 36a have shown superior
cardiac safety up to 25 and ∼15 μM, respectively. Bulky
substitutions at position C-4 of the imidazole ring, however, rendered
hybrid molecules cardiotoxic. For example, whereas hybrids 33a, 36a, and 33b, with H, methyl, and ethyl
groups, respectively, are cardiac-safe up to 25, ∼15, and 10
μM, respectively (Table and Figure c–e), hybrid 33c with an isopropyl group demonstrated
cardiomyocyte toxicity at 6.16 μM, suggesting that even a small
modification on the imidazole ring could cause a significant change
in cardiac safety. The cardiomyocyte toxicities caused by the bulkiness
on the imidazole ring were clearly observed for hybrid 33h, which had a phenyl group on the imidazole moiety and was the most
toxic hybrid among those examined during lead optimization. Notably,
replacing the Flag-methyl group with H or a methoxy group also resulted
in cardiotoxicity. These findings clearly suggest that a small change
in the inhibitor structure could alter the balance of on-target versus
off-target interactions[56] to cause adverse
effects. On the basis of the distinct SARs, we conclude that cardiotoxicity
for ponatinib and the derivatives likely results from strong interactions
with off-targets rather than BCR-ABL.Cardiac safety of inhibitors. (a) Vasculogenesis
assay. HMVEC-Cs
were treated for 6 h with a dose response 3-fold change with a maximum
dose of 10 μM imatinib, ponatinib, 24, 33a–d, and 36a. DMSO was used as a control, and mean ±
SEM values were used to plot the graph. (b) Images of the vasculogenesis
assay for the control, imatinib, ponatinib, 24, 33a–d, and 36a at a dose of 1.1 μM
(scale bar, 200 μM). Analogues preserved the ability to form
a capillary-like network similar to control and imatinib, whereas
loop formation was not observed for HMVEC-Cs treated with ponatinib.
(c) Vasculotoxicity vs GI50 for imatinib, ponatinib, 33a–d, and 36a. AUC is area under the
curves shown in panel a. (d) Cardiomyocyte toxicity vs GI50 for imatinib, ponatinib, 33a–d, and 36a. Cardiotoxicity is qualified as the smallest dose that caused cardiotoxicity.
(e) Vasculotoxicity vs cardiomyocyte toxicity of all compounds tested.
Note that 33a showed a safety profile similar to that
of imatinib, whereas 36a showed an intermediate safety
profile.Considering the overall performance, including in vitro kinase and cellular potencies as well as cardiac
safety, inhibitors 33a and 36a were selected
to evaluate their pharmacokinetic
profiles and antitumor activities in vivo. Our results
suggest that these compounds have shown efficacies comparable to those
of ponatinib in mouse models of CML driven by the T315I mutation.
The complete details of these findings are reported in ref (53).
Conclusions
In summary, this paper describes a distinct
SAR for the desirable
anti-BCR-ABLT315I antitumor potency versus adverse cardiotoxicity
for ponatinib. On the basis of this information, we successfully designed
and synthesized a series of hybrid molecules that are more selective
BCR-ABL inhibitors. The hybrids maintained significant inhibitory
activities against K-562 human CML cells, including the most intractable
gatekeeper T315I mutant associated with disease progression in CML.
The most potent compounds, 33a and 36a,
strongly inhibited the kinase activities of both native BCR-ABL and
BCR-ABLT315I with mean IC50 values of 20.1 and
26.3 nM and 34.7 and 51.4 nM, respectively. Furthermore, they showed
comparable efficacies and only slightly diminished potencies relative
to those of ponatinib on K-562 cells expressing BCR-ABLT315I. Considering the ∼10-fold diminished potencies for in vitro inhibition of T315I mutant BCR-ABL, the net improved
safety was nonetheless substantial. Compound 33a did
not show cardiomyocyte or vascular toxicity at any dose (Table ). We speculate that
differential inhibition of kinases might contribute to the greater
safety of 33a and 36a relative to ponatinib.
As described in ref (53) and shown in the Supporting Information (page S54), several kinases are inhibited
by ponatinib that are not significantly inhibited by 33a and 36a, at least in vitro. The in vivo biological consequences of different kinase targeting
remain to be explored. Notably, hybrids 33a and 36a were found to be the most cardiac-safe TKIs reported to
date. Moreover, 33a and 36a have shown excellent
pharmacokinetics and achieved durable tumor regression in the K-562
xenograft model in mice upon oral administration. Therefore, they
could serve as promising lead compounds for further development of
a new class of BCR-ABL inhibitors overcoming the T315I mutation and
cardiotoxicity.
Experimental Section
Chemical Synthesis
General Methods
All of the reagents and solvents were
obtained at the highest commercial quality from sources such as Sigma-Aldrich,
Fisher Scientific, TCI International, Acros organics, Alfa Aesar,
Matrix Scientific, Chem-Implex, and Enamine and were used without
further purification. Unless otherwise mentioned, all of the reactions
were carried out under a nitrogen atmosphere with dry solvents. The
reactions were monitored by TLC using precoated silica gel plates
(Merck, silica gel 60 F254). Flash chromatography was carried
out using a CombiFlash Rf+ Lumen chromatography system (Teledyne ISCO,
Lincoln, NE). 1H (400 MHz) and 13C (101 MHz)
NMR spectra were recorded either on an Agilent 400-MR NMR instrument
or on a Bruker Avance 400 MHz spectrometer, using appropriate deuterated
solvents, as needed. Chemical shifts (δ) were reported in parts
per million upfield from tetramethylsilane (TMS) as an internal standard.
Coupling constants (J) were reported in hertz, and
s, br.s, d, t, and m denote singlet, broad singlet, doublet, triplet,
and multiplet, respectively. LC-MS analysis was performed on an Agilent
6490 iFunnel Triple Quadrupole Mass Spectrometer from Agilent Technologies
Inc. (Santa Clara, CA). An Agilent EclipsePlusC18 reverse phase column
(1.8 μm, 2.1 mm × 50 mm) was used with solvent A (0.1%
formic acid in water) and solvent B (0.1% formic acid in acetonitrile)
for LC-MS analysis. The solvent A:solvent B ratio was 1:9 at the beginning
and gradually changed to 9:1 at the end. The flow rate was set to
0.4 mL/min. The detector wavelength was set to 254 nm. The mass spectrometer
was operated under positive ionization mode. Purity testing was done
by means of analytical HPLC on a Waters prep150 system with a Phenomenex
Luna 3 μm PFP (2) column (150 mm × 3 mm) eluted at a rate
of 0.6 mL/min with solvent A (0.1% formic acid in water) and solvent
B (0.1% formic acid in acetonitrile). The solvent A:solvent B ratio
was 0.5:9.5 at the beginning and gradually changed to 9.5:0.5 after
5 min. The detector wavelength was set to 254–400 nm. All tested
compounds were >95% pure.
Compound 3b was prepared on
the basis of a literature procedure.[43] Sodium
hydride (60% in mineral oil, 0.186 g, 4.67 mmol) was added to a stirred
solution of 2-amino-N-(2-chloro-6-methylphenyl)thiazole-5-carboxamide 1 (0.5 g, 1.87 mmol) and 4-chloro-2-methylpyrimidine 2b (0.28 g, 2.24 mmol) in DMF (20 mL). The solution was heated
at 100 °C overnight and cooled to room temperature (rt), and
the reaction quenched by adding glacial acetic acid and water. The
crude product was extracted into DCM (2 × 50 mL). The organic
layers were combined and washed with water, followed by a saturated
NaCl solution (25 mL). The organic phase was dried over Na2SO4, filtered, and then evaporated to dryness using a
rotatory evaporator. The crude product was purified on a silica gel
column with a 0% to 10% gradient of methanol in DCM to furnish the
desired product as a pale yellow solid (0.07 g, 10% yield): HPLC purity
98.7% (tR = 1.75 min); 1H NMR
(400 MHz, DMSO-d6) δ 8.37 (d, J = 5.5 Hz, 1H), 8.12 (s, 1H), 7.58–7.48 (m, 1H),
7.47–7.37 (m, 2H), 6.90 (dd, J = 5.5, 0.7
Hz, 1H), 2.49 (s, 3H), 2.14 (s, 3H); 13C NMR (101 MHz,
DMSO-d6) δ 171.6, 167.1, 164.7,
159.6, 157.6, 156.4, 138.8, 132.0, 131.7, 131.3, 130.7, 128.6, 114.3,
98.6, 25.9, 17.8; LC-MS (ESI-QQQ) m/z 360.1 ([C16H14ClN5OS + H]+ calcd 360.06); purity 99% (tR = 3.287
min).
General Procedure for the Synthesis of 3c and 3d. Procedure for N-(2-Chloro-6-methylphenyl)-2-(4-methyl-3-{[4-(pyridin-3-yl)pyrimidin-2-yl]amino}benzamido)thiazole-5-carboxamide
(3c)
Under a nitrogen atmosphere, 2-amino-N-(2-chloro-6-methylphenyl)thiazole-5-carboxamide 1 (0.5 g, 1.87 mmol) and 4-methyl-3-{[4-(pyridin-3-yl)pyrimidin-2-yl]amino}benoic
acid 2c (0.57 g, 1.87 mmol) were added to dry THF (100
mL) at room temperature and the mixture was stirred for 10 min, which
resulted in a clear solution. EDC·HCl (0.54 g, 2.80 mmol), HOBt
(0.38 g, 2.80 mmol), and DIPEA (0.65 mL, 3.74 mmol) were added, and
then the mixture was heated at 40 °C for 48 h. The progress of
the reaction was monitored by TLC. Water (25 mL) was added, followed
by EtOAc (25 mL). The organic phase was separated, and the aqueous
phase was extracted with EtOAc (2 × 50 mL). The combined organic
phase was washed with water (25 mL) followed by a brine solution (25
mL). The organic phase was dried over Na2SO4, filtered, and evaporated to dryness to afford the crude product
that was purified on a silica gel column with a 0% to 10% gradient
of methanol in DCM as an eluent to afford the desired compound as
an off-white solid (0.08 g, 8% yield): HPLC purity 95.3% (tR = 2.71 min); 1H NMR (400 MHz, DMSO-d6) δ 12.90 (bs, 1H), 9.84 (s, 1H), 9.28
(d, J = 2.3 Hz, 1H), 9.08 (s, 1H), 8.69 (dd, J = 4.8, 1.6 Hz, 1H), 8.55 (d, J = 5.1
Hz, 1H), 8.49 (dt, J = 8.1, 2.0 Hz, 1H), 8.47–8.41
(m, 1H), 8.29 (s, 1H), 7.89 (dd, J = 7.9, 1.8 Hz,
1H), 7.54 (dd, J = 8.0, 4.8 Hz, 1H), 7.47 (d, J = 5.2 Hz, 1H), 7.43–7.33 (m, 2H), 7.32–7.20
(m, 2H), 2.34 (s, 3H), 2.25 (s, 3H); 13C NMR (101 MHz,
DMSO-d6) δ 167.5, 166.4, 162.1,
161.9 161.6, 160.6, 160.0, 151.9, 148.6, 141.7, 139.3, 138.4, 136.7,
134.9, 134.2, 132.9, 132.6, 130.6, 129.5, 128.5, 127.4, 125.4, 125.0,
124.6, 124.4, 108.3, 18.8, 18.7; LC-MS (ESI-QQQ) m/z 556.20 ([C28H22ClN7O2S + H]+ calcd 556.12); purity 96.3%
(tR = 4.853 min).
The title compound was synthesized from
2-amino-N-(2-chloro-6-methylphenyl)thiazole-5-carboxamide 1 (0.62 g, 2.34 mmol) and 4-[(4-methylpiperazin-1-yl)methyl]benzoic
acid 2d (0.5 g, 2.13 mmol), as described for the synthesis
of 3c. The crude product was purified on a silica gel
column using a 0% to 10% gradient of methanol in DCM as an eluent
to yield the desired compound as an off-white solid (0.2 g, 19% yield):
HPLC purity 96.8% (tR = 1.87 min); 1H NMR (400 MHz, DMSO-d6) δ
10.09 (s, 1H), 8.39 (s, 1H), 8.13–8.03 (m, 2H), 7.47 (d, J = 8.2 Hz, 2H), 7.41 (dd, J = 7.5, 2.0
Hz, 1H), 7.35–7.20 (m, 3H), 3.55 (s, 2H), 2.41 (bs, 8H), 2.25
(s, 3H), 2.21 (s, 3H); 13C NMR (101 MHz, DMSO-d6) δ 165.8, 162.4, 160.0, 144.1, 141.0, 139.2, 133.8,
132.8, 130.8, 129.5, 129.3, 128.8, 127.5, 127.3, 123.8, 61.9, 54.9,
52.7, 45.8, 18.7; LC-MS (ESI-QQQ) m/z 484.10 ([C24H26ClN5O2S + H]+ calcd 484.15); purity 97.9% (tR = 3.520 min).
3-Ethynylimidazo[1,2-b]pyridazine (5)
Compound 5 was prepared according to the
previously reported method,[44] with several
modifications. To a solution of 3-bromoimidazo[1,2-b]pyridazine 4 (10.0 g, 50.5 mmol) in acetonitrile were
added CuI (0.5 g, 2.63 mmol), Pd(PPh3)2Cl2 (1.8 g, 2.63 mmol), and TEA (21.0 mL, 150.6 mmol). The solution
was purged with a nitrogen flow for 10 min, and then ethynyltrimethylsilane
(21.0 mL, 151.8 mmol) was added. The mixture was heated to reflux
overnight. After being cooled to rt, the reaction mixture was filtered
to remove the undissolved solid. The solid was washed with copious
amounts of acetonitrile. The filtrate was evaporated to dryness and
then placed in methanol (300 mL). To this mixture was added K2CO3 (14.3 g, 103.5 mmol) at room temperature, and
then the mixture was stirred for 4 h. The progress of the reaction
was monitored by TLC. The reaction mixture was filtered to remove
excess K2CO3. The solid was washed with a minimal
amount of methanol. The filtrate was concentrated to dryness, dissolved
in excess EtOAc, and then washed with water followed by a brine solution.
The organic phase was dried over Na2SO4, filtered,
and evaporated to dryness to afford the crude product, which was purified
on a silica gel column using a 0% to 50% gradient of EtOAc in hexane
to afford the desired product as a pale-brown solid (5.0 g, 69%): 1H NMR (400 MHz, CDCl3) δ 8.47 (dd, J = 4.4, 1.7 Hz, 1H), 8.03–7.96 (m, 2H), 7.12 (dd, J = 9.1, 4.5 Hz, 1H), 3.80 (s, 1H); 13C NMR (101
MHz, CDCl3) δ 143.9, 139.0, 132.0, 128.4, 126.0,
117.9, 87.3, 70.6; LC-MS (ESI-QQQ) m/z 144.10 ([C8H5N3 + H]+ calcd 144.05); purity 99% (tR = 2.680
min).
Compound 8 was prepared according
to the literature procedure,[60] with few
modifications. Methyl 3-iodo-4-methylbenzoate 6 (1.85
g, 6.71 mmol) was added to a stirred solution of 3-ethynylimidazo[1,2-b]pyridazine 5 (0.8 g, 5.59 mmol) in DMF (10
mL). The mixture underwent three cycles of vacuum/filling with nitrogen,
and then CuI (0.21 g, 1.11 mmol), Pd(PPh3)4 (0.64
g, 0.55 mmol), and diisopropylethylamine (1.94 mL, 11.17 mmol) were
added. The reaction mixture was stirred at 80 °C for 2 h before
it was cooled to rt. Water (25 mL) was added, and the product extracted
into EtOAc (3 × 25 mL). The organic layers were combined and
washed with water (20 mL) followed by a brine solution (20 mL). The
organic phase was dried over Na2SO4, filtered,
and then evaporated to dryness to afford a gummy solid, which was
then triturated with minimal acetonitrile to yield a solid. The solid
was collected by filtration, washed with a minimal amount of acetonitrile,
and dried under vacuum for 2 h to furnish the desired compound as
an off-white solid (0.82 g, 50% yield): 1H NMR (400 MHz,
CDCl3) δ 8.53 (dd, J = 4.4, 1.0
Hz, 1H), 8.25 (d, J = 1.9 Hz, 1H), 8.17–8.02
(m, 2H), 7.92 (dd, J = 8.0, 1.9 Hz, 1H), 7.33 (dt, J = 8.0, 0.7 Hz, 1H), 7.20 (dd, J = 9.1,
4.4 Hz, 1H), 3.91 (s, 3H), 2.62 (s, 3H); 13C NMR (101 MHz,
CDCl3) δ 166.4, 145.6, 144.4, 136.7, 133.2, 130.7,
129.9, 129.8, 128.0, 125.6, 122.5, 118.6, 113.7, 97.1, 79.9, 52.2,
21.1; LC-MS (ESI-QQQ) m/z 292.00
([C17H13N3O2 + H]+ calcd 292.10); purity 99% (tR = 5.027 min).
Compound 9 was prepared
on the basis of a literature procedure,[60] with few modifications. Methyl 3-(imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methylbenzoate 8 (0.81 g,
2.78 mmol) was placed in a 1:1 MeOH/THF mixture (120 mL). To this
mixture was added a freshly prepared 1.0 M LiOH solution in water
(15.0 mL), and the mixture was stirred at rt for 24 h. The pH was
adjusted to 2 before the volume was reduced to 15% on a rotatory evaporator.
The off-white solid that had appeared was collected by filtration,
washed with copious amounts of ether, and dried under vacuum for 4
h to give the title compound (0.7 g, 91% yield): 1H NMR
(400 MHz, DMSO-d6) δ 13.09 (bs,
1H), 8.70 (dd, J = 4.4, 1.6 Hz, 1H), 8.28–8.15
(m, 2H), 8.03 (d, J = 1.8 Hz, 1H), 7.87 (dd, J = 7.9, 1.9 Hz, 1H), 7.48 (d, J = 8.0
Hz, 1H), 7.37 (dd, J = 9.2, 4.4 Hz, 1H), 2.57 (s,
3H); 13C NMR (101 MHz, DMSO-d6) δ 166.9, 145.5, 144.8, 140.1, 138.7, 132.4, 130.7, 130.1,
129.3, 126.5, 122.5, 119.5, 112.1, 96.6, 81.5, 20.9; LC-MS (ESI-QQQ) m/z 277.9 ([C16H11N3O2 + H]+ calcd 278.09); purity
99% (tR = 4.16 min).Compounds 11a–c were prepared from compound 9 and
the corresponding reactants 10a–c, respectively,
using a similar method that was described for the synthesis of 3d.
Under a nitrogen atmosphere, 3-iodo-4-methylbenzoic
acid 12 (5.0 g, 19.08 mmol) was taken in SOCl2 (6.5 mL, 89.6 mmol) and then two drops of DMF was added at rt. The
reaction mixture was stirred at reflux for 5 h before it was cooled
to rt, and the excess SOCl2 was carefully removed. The
crude material was co-evaporated with benzene and dried under vacuum
to afford the desired acid chloride. The acid chloride was dissolved
in anhydrous THF (20 mL) and then added dropwise to a stirred mixture
of 3-bromo-5-(trifluoromethyl)aniline 13 (4.57 g, 19.08
mmol), diisopropylethylamine (3.97 mL, 22.8 mmol), and DMAP (0.23
g, 1.88 mmol) in THF at 0 °C. Upon completion of the addition,
the reaction mixture was warmed to rt and stirred overnight. The reaction
was quenched with water, and the product was extracted into EtOAc
(3 × 50 mL). The combined organic extracts were washed with a
brine solution (25 mL), dried over Na2SO4, filtered,
and evaporated to dryness to afford a crude material that was purified
on a silica gel column using a 0% to 50% gradient of EtOAc in hexane
as the eluent to obtain the desired product as an off-white solid
(7.6 g, 82% yield): 1H NMR (400 MHz, DMSO-d6) δ 10.61 (s, 1H), 8.49–8.29 (m, 2H), 8.19
(s, 1H), 7.91 (dd, J = 7.9, 1.9 Hz, 1H), 7.67 (s,
1H), 7.50 (d, J = 7.9 Hz, 1H), 2.44 (s, 3H); 13C NMR (101 MHz, DMSO-d6) δ
164.6, 145.9, 141.7, 137.9, 133.5, 131.6 (q, J =
32.4 Hz), 130.4, 128.3, 126.5, 123.6 (q, J = 274.7
Hz), 123.0 (q, J = 4.1 Hz), 122.7, 115.9 (q, J = 4.0 Hz), 101.6, 28.1; LC-MS (ESI-QQQ) m/z 483.90 ([C15H10BrF3INO + H]+ calcd 483.89); purity 99% (tR = 6.410 min).
This was prepared using N-[3-bromo-5-(trifluoromethyl)phenyl]-3-iodo-4-methylbenzamide 14 (2.0 g, 4.13 mmol) and 3-ethynylimidazo[1,2-b]pyridazine 5 (0.62 g, 4.33 mmol) as shown in Scheme using a similar
method that was described for the synthesis of 8. The
desired product was obtained as an off-white solid (1.42 g, 69% yield):
HPLC purity 95.6% (tR = 5.95 min); 1H NMR (400 MHz, DMSO-d6) δ
10.69 (s, 1H), 8.72 (dd, J = 4.5, 1.5 Hz, 1H), 8.39
(s, 1H), 8.26 (dd, J = 9.3, 1.6 Hz, 1H), 8.24–8.19
(m, 2H), 7.94 (dd, J = 8.0, 2.0 Hz, 1H), 7.68 (d, J = 0.7 Hz, 1H), 7.65–7.58 (m, 1H), 7.58–7.54
(m, 1H), 7.39 (dd, J = 9.2, 4.4 Hz, 1H), 2.61 (s,
3H); 13C NMR (101 MHz, DMSO-d6) δ 165.3, 145.5, 144.3, 141.8, 138.7, 132.2, 131.9, 131.5
(q, J = 32.5 Hz), 130.6, 129.3, 129.1, 129.0, 126.5,
126.4, 123.6 (q, J = 274.7 Hz), 123.0 (q, J = 4.0 Hz), 122.6, 122.3, 119.5, 115.8 (q, J = 4.0 Hz), 96.8, 81.7, 20.9; LC-MS (ESI-QQQ) m/z 499.1 ([C23H14BrF3N4O + H]+ calcd 499.03); purity 95.8% (tR = 6.040 min).
3-Ethynyl-4-methylbenzoic Acid (16)
Methyl
3-iodo-4-methylbenzoate 6 (3.0 g, 10.86 mmol) was placed
in anhydrous THF (30 mL). The solution underwent three cycles of vacuum/filling
with nitrogen, and then CuI (0.17 g, 0.89 mmol), [Pd(PPh3)2Cl2] (0.4 g, 0.56 mmol), and ethynyltrimethylsilane
(5.0 mL, 36.14 mmol) were added. The mixture was stirred overnight
at rt. EtOAc (50 mL) was added followed by a 0.5 M aqueous NH4OH solution (100.0 mL). Aqueous and organic phases were separated.
The organic phase was washed with 0.5 N HCl (50 mL) followed by a
brine solution (25 mL), dried over Na2SO4, filtered,
evaporated to dryness to afford a brown oil that was dissolved in
a freshly prepared methanolic KOH solution (13 g of KOH flakes dissolved
in 50 mL of MeOH), and stirred at rt for 2 h. EtOAc (100 mL) was added,
and the undissolved solid was removed by filtration. The solid was
washed with copious amounts of methanol. The filtrate was evaporated
to dryness and placed in water (50 mL). The pH was adjusted to 5 using
0.5 N HCl, during which time an off-white solid was observed. The
solid obtained was collected by filtration and washed with cold water
followed by hexane. The solid was dried under vacuum for 4 h to obtain
the desired compound as an off-white solid (1.5 g, 86%): 1H NMR (400 MHz, DMSO-d6) δ 13.10
(bs, 1H), 7.92 (d, J = 1.8 Hz, 1H), 7.84 (dd, J = 8.0, 1.8 Hz, 1H), 7.42 (d, J = 8.0
Hz, 1H), 4.47 (d, J = 0.9 Hz, 1H), 2.44 (s, 3H); 13C NMR (101 MHz, DMSO-d6) δ
167.0, 145.4, 133.2, 130.4, 130.0, 129.5, 122.3, 85.8, 81.8, 20.8.
The title compound was prepared following
the general Sonogashira coupling, as described for the synthesis of 8, except for using 31 (0.34 g, 0.768 mmol) and 5 (0.1 g, 0.70 mmol) as the starting materials as shown in Scheme . The title compound
was obtained as an off-white solid (0.062 g, 19% yield): HPLC purity
97.9% (tR = 2.10 min); 1H NMR
(400 MHz, DMSO-d6) δ 10.27 (s, 1H),
8.71 (dd, J = 4.4, 1.6 Hz, 1H), 8.25 (dd, J = 9.2, 1.6 Hz, 1H), 8.22 (s, 1H), 8.08 (d, J = 2.2 Hz, 1H), 7.93 (d, J = 8.3 Hz, 2H), 7.72 (dd, J = 8.3, 2.3 Hz, 1H), 7.45 (d, J = 8.3
Hz, 2H), 7.38 (dd, J = 9.2, 4.5 Hz, 1H), 7.36–7.31
(m, 1H), 3.54 (s, 2H), 2.50 (s, 3H), 2.39 (s, 8H), 2.19 (s, 3H); 13C NMR (101 MHz, DMSO-d6) δ
165.4, 145.0, 142.3, 139.5, 138.0, 137.2, 134.4, 133.4, 130.0, 128.7,
127.6, 126.0, 122.5, 121.5, 121.1, 118.9, 111.9, 97.1, 80.1, 61.5,
54.6, 52.4, 45.5, 19.7; LC-MS (ESI-QQQ) m/z 465.40 ([C28H28N6O +
H]+ calcd 465.23); purity 99% (tR = 3.673 min).
General Procedure for the Synthesis of 33a–h. Procedure for N-[3-(1H-Imidazol-1-yl)-5-(trifluoromethyl)phenyl]-3-(imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methylbenzamide (33a)
Compound 33a was prepared according to the
previously reported methods for similar compounds,[46,47] with several modifications. N-[3-Bromo-5-(trifluoromethyl)phenyl]-3-(imidazo[1,2-b]pyridazin-3-ylethynyl)-4-methylbenzamide 15 (3.0 g, 6.00 mmol) and 1H-imidazole (0.45 g, 6.61
mmol) were placed in dry DMSO (50 mL) in a pressure tube. The solution
was purged with a nitrogen flow for 10 min; CuI (0.17 g, 0.90 mmol),
K2CO3 (2.5 g, 18.0 mmol), and 8-hydroxyquinoline
(0.13 g, 0.90 mmol) were added, and purging was continued for an additional
10 min. The pressure tube was then sealed tightly and stirred at 100
°C for 18 h. Upon being cooled to rt, the reaction mixture was
poured into ice-cold water (∼50 mL) and allowed to stir for
30 min, during which time a pale yellow solid was observed. The solid
was collected by filtration and then dissolved in 10% MeOH in DCM
(100 mL). The undissolved solid was removed by filtration. The filtrate
was evaporated to dryness to afford the crude product, which was purified
on a silica gel column using a 0% to 10% gradient of methanol in DCM
as an eluent to afford the desired product as a pale yellow solid
(1.67 g, 57% yield): HPLC purity 98.4% (tR = 3.16 min); 1H NMR (400 MHz, DMSO-d) δ 10.78 (s, 1H), 8.73 (dt, J = 4.5, 1.4 Hz, 1H), 8.34 (s, 2H), 8.30–8.19 (m,
4H), 7.98 (dd, J = 8.1, 1.9 Hz, 1H), 7.81 (d, J = 9.6 Hz, 2H), 7.59 (d, J = 8.1 Hz, 1H),
7.40 (ddd, J = 9.2, 4.5, 1.1 Hz, 1H), 7.18 (s, 1H),
2.63 (s, 3H); 13C NMR (101 MHz, DMSO-d6) δ 165.3, 145.5, 144.3, 141.7, 140.2, 138.8, 138.5,
132.3, 131.3 (q, J = 32.2 Hz), 130.9, 130.7, 130.6,
129.0, 126.6, 124.1 (q, J = 273.7 Hz), 122.4, 119.6,
116.0, 115.2 (q, J = 4.0 Hz), 112.8, 112.7, 112.2,
100.3, 96.8, 81.7, 20.9; LC-MS (ESI-QQQ) m/z 487.20 ([C26H17F3N6O + H]+ calcd 487.14); purity 99% (tR = 4.510 min).
Compound 33b was synthesized from 15 (0.1 g, 0.20 mmol) and 4-ethyl-1H-imidazole (0.03
g, 0.30 mmol) according to the general procedure for the synthesis
of 33a–h. After the reaction had reached completion,
the reaction mixture was cooled to rt and a 10% NH4OH solution
was added. The product was extracted into EtOAc (3 × 25 mL).
The combined organic layers were washed with water followed by a 10%
NH4OH solution, dried over Na2SO4, filtered, and evaporated to dryness. The crude product was purified
on a silica gel column using a 0% to 10% gradient of methanol in DCM
as an eluent to yield the title compound as a pale yellow solid (3.0
mg, 3% yield): HPLC purity 97.5% (tR =
4.22 min); 1H NMR (400 MHz, DMSO-d6) δ 10.74 (s, 1H), 8.82–8.67 (m, 1H), 8.38–8.12
(m, 6H), 7.98 (dd, J = 8.0, 2.0 Hz, 1H), 7.77 (s,
1H), 7.58 (d, J = 8.1 Hz, 1H), 7.52 (s, 1H), 7.40
(dd, J = 9.2, 4.4 Hz, 1H), 2.62 (s, 3H), 2.56 (q, J = 7.4 Hz, 2H), 1.22 (t, J = 7.4 Hz, 3H); 13C NMR (101 MHz, DMSO-d6) δ
165.3, 145.6, 144.3, 141.7, 138.8, 138.5, 132.3, 131.3 (q, J = 32.3 Hz), 131.1, 131.0, 130.7, 130.6, 129.0, 126.6,
124.1, 122.4, 119.6, 115.4, 114.7 (q, J = 4.0 Hz),
114.7, 113.6, 112.2, 112.2, 96.8, 81.7, 21.7, 20.9, 13.8; LC-MS (ESI-QQQ) m/z 515.30 ([C28H21F3N6O + H]+ calcd 515.17); purity
87.5% (tR = 4.663 min).
Molecular docking simulations were
performed using AutoDock Vina 1.1.2. Pymol 2.3.1 was employed to analyze
the docking results.[61] The crystal structures
of wild type BCR-ABL and BCR-ABLT315I were taken from PDB
entries 3OXZ and 3IK3,
respectively. The protein structure was prepared by adding polar hydrogens,
deleting water molecules, and adding charges. The grid box was prepared
on the basis of the ligand sites that were defined in the crystal
structure. The coordinate center of the search space for 3OXZ was set to 12.110,
−5.407, 15.591 (x, y, z). The x, y, and z dimensions were set to 22, 24, and 34, respectively. The
coordination center of the search space for 3IK3 was set to 6.487,
1.061, 17.621 (x, y, z), and the x, y, and z dimensions were set to 22, 30, and 26, respectively. For both structures,
a grid-point spacing of 0.375 Å was applied. The exhaustiveness
was set to 48, and the maximum number of binding modes was set to
100. Other docking parameters were kept to the default values. Docking
calculations were performed with full flexibility of the ligand inside
the search space.
Biological Characterization of Compounds
K-562 and K-562-T315I
Leukemia cell line K-562 was
purchased from ATCC and maintained as recommended by ATCC (Manassas,
VA). Briefly, K-562 cells were cultured in suspension in RPMI1640
(ThermoFisher Scientific) supplemented with 10% fetal bovine serum
and Pen/Strep/l-glutamine. The K-562-T315I cell line was
derived from the K-562 line by CRISPR. Briefly, 1 million K-562 cells
were seeded in six-well plates and transfected with Lipofectamine
2000 and 1 μg of CRISPR/Cas9 vector [pSpCas9(BB)-2A-GFP] (Addgene
48138) incorporating the guide sequence (CTCAGTGATGATATAGAACG),
and Lipofectamine RNAiMax (Invitrogen 13778500, Thermo Fisher Scientific)
and 4 μg of ssDNA donors (1 μg of each donor, HDR template
1, CGTGTTGAAGTCCTCGTTGTCTTGTTGGCAGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCATTGAGTTCATGACCTACGGGAACCTCCTGGACT;
HDR template 2, TTCAGTTGGGAGCGGAGCCACGTGTTGAAGTCCTCGTTGTCTTGTTGGCAGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCATTGAGTTCATGAC;
HDR template 3, CGTGTTGAAGTCCTCGTTGTCTTGTTGGCAGGGGTCTGCACCCGGGAGCCACCGTTCTATATCATCATTGAGTTCATGACCTACGGGAACCTCCTGGACT;
and HDR template 4, TTCAGTTGGGAGCGGAGCCACGTGTTGAAGTCCTCGTTGTCTTGTTGGCAGGGGTCTGCACCCGGGAGCCACCGTTCTATATCATCATTGAGTTCATGAC)
for each well of a six-well plate. The cells were left to recover
and proliferate before being selected using 1 μM imatinib in
RPMI supplemented with 10% FBS. When an enriched T315I polyclonal
line was achieved, imatinib selection was stopped.
HEK 293 Cells
Human embryonic kidney cells (HEK293)
were cultured in high-glucose DMEM medium (Gibco 11965092) supplemented
with 10% FBS (Gibco 26140079) and Pen/Strep/l-glutamine (Gibco
10378016).
Human iPSC-CMs
iPSC lines were as described (SCVI-15S1
from the Stanford Cardiovascular Institute Biobank). The derivation
of the line was approved by the Stanford University Institutional
Review Board and Stem Cell Research Oversite board. hiPSC lines were
cultured in E8 cell culture medium (Life Technologies) in plates coated
with growth factor-reduced Matrigel (Corning) until at least passage
20 before differentiation. hiPSC cells were differentiated into cardiomyocytes
(CMs) utilizing a chemically defined cardiomyocyte differentiation
protocol[62] and fatty acid rich maturation
protocol.[63]
HMVEC-Cs Cells
Human microvascular cardiac endothelial
cells (HMVEC-Cs) were purchased from LONZA (CC-7030 batch 0000550176).
The HMVEC cells were cultured in EBMTM-2 Basal Medium (Lonza, CC-3156)
and EGMTM-2 MV supplemented with microvascular endothelial Cell Growth
Medium SingleQuots (Lonza, CC-4147). HMVEC-Cs were expanded and used
at passage 7 for the vasculogenesis assay.
Cell Viability and Growth Inhibition Assay
Growth inhibitory
activities were evaluated on K-562 CML cancer cell lines. The effects
of the compounds on cell viability were evaluated using the AlamarBlue
assay using the NCI60 methodology.[64] Cells
were harvested and plated in 384-well plates (Greiner μClear)
at a concentration of 1250 cells/well in 40 μL and incubated
for 24 h at 37 °C. The next day, test compounds were added to
the cells as a 2× 40 μL solution and incubated for 48 h
at 37 °C. Then, the cells were treated with Resazurin (final
concentration of 10%) and incubated for 2 h before the fluorescence
was measured on a plate reader (excitation at 544 nm, emission at
590 nm) to quantify the antiproliferative effects of the compounds.
The 50% growth inhibition (GI50) values are reported as
medians ± median absolute differences (MADs).
Kinase Activity Assays
The kinase activity for ABL1
and ABL1T315I was performed using the SelectScreen Biochemical Kinase
Profiling service of ThermoFisher Scientific (Madison, WI). For each
kinase, an IC50 was calculated on the basis of a 10-point
concentration curve of the test article and converted into Ki values.
Vasculogenesis Assay
HMVEC-Cs were plated on a Geltrex
surface in 96-well plates at a density of 25 000 cells/well
(Greiner μClear) supplemented with EBMTM-2 Basal Medium. The
cells were incubated with the compounds for 6 h at 37 °C at three
doses per compound: 10, 3.33, and 1.11 μM for all of the compounds.
DMSO was used as a vehicle for the compounds and also tested. After
the treatment, the HMVEC cells were stained with calcein AM fluorescent
dye (Corning 354216) at a 1/200 dilution in 1× HBSS medium (ThermoFisher,
14185052) for 25 min and imaged without washing the dye on the IC200
Kinetic Imaging Platform (Vala Sciences) with a 4× objective.
The vasculogenesis assay was generally performed for compounds that
had cell inhibition GI50 values of <100 nM for K-562-T315I
cells. Vessel formation was quantified using ImageJ version 1.53e
analyzer, quantifying the number of complete formed loops in a capillary-like
web and AUC for the overall dose response curve.
Cardiomyocyte Toxicity Assays
Human iPSC-CMs were plated
on Matrigel-coated 384-well plates at a density of 20 000 cells/well
(Greiner μClear) in 50 μL cardiomyocyte media (fatty acid
rich maturation medium[63]) supplemented
with 10% knockout replacement serum. The subsequent day, an additional
50 μL of medium was added and cells were grown for a minimum
of 5 days prior to analysis. Action potential kinetics and contractility
were measured sequentially on the same cells. First, action potential
kinetics were recorded using the protocol as established by McKeithan
et al.[50] Briefly, the cells were washed
five times with FluoroBrite, loaded with VF2.1.Cl dye for 50 min at
37 °C, and washed again five times with FluoroBrite. Voltage
time series were acquired at a frequency of 33 Hz for a duration of
10 s on the IC200 Kinetic Imaging Platform (Vala Sciences). Then,
the cells were loaded with 1/50000 tetramethylrhodamine and a methyl
ester perchlorate (TMRM) wheat germ agglutinin–Alexa Fluor
555 conjugate (10 nM, T668 ThermoFisher) for 50 min at 37 °C
and then washed four times with FluoroBrite.[49] Contractile time series were acquired at a frequency of 50 Hz for
a duration of 6.5 s. The resulting recordings were subsequently analyzed
using Vala Sciences and custom software, and action potential kinetics,
action potential durations and rates,[50] or contractile activity parameters (peak divergence, area under
the curve) were used as measures of cardiotoxicity.[49] To determine human iPSC-CM toxicity, the transients were
quantified, and curves fitted, to extract several measures for voltage
(action potential duration of 75%) and contractility (peak contraction
amplitude). The minimal concentration at which the dose response curve
of any metric or the variability of the given metric deviated beyond
a threshold (25% or 4.5×, respectively) from control was deemed
the overall minimum toxic dose.
Authors: Xiaojun Lian; Cheston Hsiao; Gisela Wilson; Kexian Zhu; Laurie B Hazeltine; Samira M Azarin; Kunil K Raval; Jianhua Zhang; Timothy J Kamp; Sean P Palecek Journal: Proc Natl Acad Sci U S A Date: 2012-05-29 Impact factor: 11.205
Authors: Brian J Druker; François Guilhot; Stephen G O'Brien; Insa Gathmann; Hagop Kantarjian; Norbert Gattermann; Michael W N Deininger; Richard T Silver; John M Goldman; Richard M Stone; Francisco Cervantes; Andreas Hochhaus; Bayard L Powell; Janice L Gabrilove; Philippe Rousselot; Josy Reiffers; Jan J Cornelissen; Timothy Hughes; Hermine Agis; Thomas Fischer; Gregor Verhoef; John Shepherd; Giuseppe Saglio; Alois Gratwohl; Johan L Nielsen; Jerald P Radich; Bengt Simonsson; Kerry Taylor; Michele Baccarani; Charlene So; Laurie Letvak; Richard A Larson Journal: N Engl J Med Date: 2006-12-07 Impact factor: 91.245
Authors: Arun Sharma; Paul W Burridge; Wesley L McKeithan; Ricardo Serrano; Praveen Shukla; Nazish Sayed; Jared M Churko; Tomoya Kitani; Haodi Wu; Alexandra Holmström; Elena Matsa; Yuan Zhang; Anusha Kumar; Alice C Fan; Juan C Del Álamo; Sean M Wu; Javid J Moslehi; Mark Mercola; Joseph C Wu Journal: Sci Transl Med Date: 2017-02-15 Impact factor: 17.956
Authors: Thomas O'Hare; Denise K Walters; Eric P Stoffregen; Taiping Jia; Paul W Manley; Jürgen Mestan; Sandra W Cowan-Jacob; Francis Y Lee; Michael C Heinrich; Michael W N Deininger; Brian J Druker Journal: Cancer Res Date: 2005-06-01 Impact factor: 12.701
Figure 1
Figure 2
Figure 3
Scheme 1
Scheme 2
Scheme 3
Scheme 4
Scheme 5
Scheme 6
Scheme 7
Scheme 8
Figure 5
Figure 6