Literature DB >> 35944027

New insights into the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene-Discovery of a functional allele pair differing by a single amino acid.

Robert Mroczek1, Agnieszka Laszkiewicz1, Pawel Blazej2, Kinga Adamczyk-Weglarzy1, Joanna Niedbalska-Tarnowska1, Malgorzata Cebrat1.   

Abstract

The complementary sex determiner (csd) gene is responsible for controlling the sex-determination molecular switch in western honey bees (Apis mellifera): bees that are heterozygous for csd develop into females, whereas bees that are hemizygous or homozygous develop into males. The homozygous diploid males are destroyed at an early stage of their development. It has been proposed that the minimal number of amino acid differences between two csd alleles needed to fully determine femaleness is five and it has also been shown that smaller differences may result in forming an evolutionary intermediate that is not fully capable of female determination, but has increased fitness compared to the homozygous genotype. In this study, we have implemented a terminal restriction length polymorphism-based method of identifying and distinguishing paternal alleles in a given bee colony and assigning them to a particular maternal allele in order to gather information on large number of functional csd pairs and also to identify, to some extent, genotypes that are underrepresented or absent in bee colonies. The main finding of this study is the identification of a fully functional genotype consisting of csd alleles that differed from each other by a one amino acid position. The individuals carrying this genotype expressed only female-specific transcripts of feminizer and double-sex genes. By comparing the sequences differences between the csd pair identified in our study with those described earlier, we conclude that functional heterozygosity of the csd gene is dependent not only on the number of the amino acid differences but also on the sequence context and position of the change. The discovery of a functional allele pair differing by a single amino acid also implies that the generation of a new csd specificity may also occur during a single mutation step with no need for evolutionary intermediates accumulating further mutations.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35944027      PMCID: PMC9362917          DOI: 10.1371/journal.pone.0271922

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Western honey bees (Apis mellifera) are haplodiploid: the males develop from unfertilised oocytes, whereas the females develop from fertilised oocytes. The complementary sex determiner (csd) gene is responsible for controlling the sex-determination molecular switch [1]: bees that are heterozygous for csd develop into females, whereas the female developmental pathway is not activated in bees that are hemizygous or homozygous, which leads to default male development. The homozygous diploid males are eaten by worker bees shortly after they hatch from the egg [2]. The risk of homozygous bee formation is reduced by polyandry (in natural conditions, the queen mates with several drones), behavioural traits limiting the possibility of sib-mating, and most importantly, a high number of csd alleles present in the population [3]. The lethality of homozygous bees is the reason why new alleles appearing in the population are highly favoured: the probability that a rare allele forms a homozygous pair is low, and therefore, the csd gene evolves under balancing (negative frequency-dependent) selection [4]. It has been shown that the total number of csd alleles is difficult (or even impossible) to estimate due to the uneven distribution of the alleles and the occurrence of a large number of infrequent alleles [5]. Currently, publicly available databases contain several hundred different csd sequences [6, 7]. Such a high diversity of csd alleles is possible due to the specific structure of the csd gene. The gene consists of 9 exons, out of which exons 6–8 encode the potential-specifying domain (csd-PSD), which has been identified as a target for balancing selection [1, 8]. The csd-PSD itself contains a hypervariable region (HVR) flanked by arginine/serine- and proline-rich regions, which are likely responsible for protein-protein interactions (Fig 1). The HVR, which encodes the tyrosine- and asparagine-rich portion of the csd-PSD, is A/T-rich and contains several trinucleotide repeats (TAT and TAA), often arranged as sets of motifs. It has been proposed that the microsatellite-like structure of the HVR is responsible for its high mutation rate, most likely due to polymerase slippage during DNA replication and/or unequal crossing-over. Differences in the length and composition of the HVR are the major contributing factor to the diversity of the csd alleles. This diversity is further increased due to the occurrence of nucleotide substitutions outside the HVR. In contrast to csd-PSD, the gene fragment encoding the N-terminal part of the csd protein accumulates far fewer mutations and has been proven to be a target of purifying selection [4].
Fig 1

Organisation of the Apis mellifera csd gene locus.

Rectangles represent exons and white exons or their fragments represent non-coding parts of the gene. Arrows represent the position of primers used in this study. The green and blue fragments of exons 7 and 8 represent the localization of the amplicon and its restriction fragments analysed by the T-RFLP method used in this work. The amino acid sequence of an example of a potential-specifying domain of the csd protein (csd-PSD) is given together with the localization of its arginine/serine-rich domain (RS-domain, brown), hypervariable region (HVR, yellow) and proline-rich domain (P-domain, orange).

Organisation of the Apis mellifera csd gene locus.

Rectangles represent exons and white exons or their fragments represent non-coding parts of the gene. Arrows represent the position of primers used in this study. The green and blue fragments of exons 7 and 8 represent the localization of the amplicon and its restriction fragments analysed by the T-RFLP method used in this work. The amino acid sequence of an example of a potential-specifying domain of the csd protein (csd-PSD) is given together with the localization of its arginine/serine-rich domain (RS-domain, brown), hypervariable region (HVR, yellow) and proline-rich domain (P-domain, orange). The occurrence of different csd alleles in the embryo leads to female-specific splicing of the feminizer (fem) transcript, which results in the presence of a functional fem protein, which in turn leads to female-specific splicing of the doublesex (dsx) transcript encoding a version of the protein truncated at the C-terminus, which initiates the cascade of female development. The lack of different csd alleles or a complete absence of csd gene products results in male-specific fem splicing, which encodes a non-functional protein. Lack of the fem protein leads to the appearance of a variant of the doublesex transcript and protein that determine male development [1, 9, 10]. Although it has not yet been proven, it is likely that csd acts as a protein dimer that can be formed or is functional only as a heterodimer; however, the exact molecular mechanism of csd action remains to be established [11]. Another major issue is determining the minimal difference in the csd sequence(s) that is sufficient for establishing functional heterozygosity. After analysing differences in csd alleles occurring in females, Lechner et al. proposed the following criteria: dHVR ≥ 6, dPSD ≥ 1 and 3dPSD + 2de8 ≥ 9, where: dHVR is the difference in the length of the HVR; dPSD is the number of amino acid mismatches in the PSD region; and de8 is the number of amino acid mismatches in the part of the protein that is encoded by exon 8 [12]. These criteria were challenged by a subsequent report proposing that at least 5 amino acid differences and length variations in the csd-PSD are able to regularly induce femaleness [13]. The same report described a case of the co-occurrence of a pair of csd alleles encoding proteins that differed by only 3 amino acids in the HVR region. This pair of alleles predominantly induced lethality, but in infrequent cases, also femaleness. The incomplete penetrance of femaleness has been suggested as a mechanism through which new csd specificities can gradually evolve. However, because only one case of a genotype consisting of non-identical csd alleles unable to fully establish femaleness has been identified so far [13], establishing any conclusive criteria for functional heterozygosity is difficult or even impossible. In this study, we implemented an approach enabling the analysis of a large number of diploid csd genotypes to gather information on functional csd pairs and also to identify, to some extent, genotypes that are underrepresented or absent in bee colonies in order to verify/refine the criteria of functional heterozygosity of csd alleles. The main finding of this study is the identification of a fully functional genotype consisting of csd alleles that differed from each other by a one amino acid position.

Results

Rationale and workflow of the genotyping method

Defining the criteria for the functional heterozygosity of csd alleles requires, on the one hand, gathering information on existing functional csd genotypes, i.e. those present in viable females, and on the other hand, learning about allele combinations that are ‘forbidden’, i.e. do not form functional pairs. The latter should not be present in a given population, since they lead to the formation of non-viable diploid males or, as in the case described by Beye et. al., should be strongly underrepresented in the female population, as those able to determine femaleness but with incomplete penetrance [13]. Prior to sequencing, the csd alleles derived from the females would have to be cloned, which makes this approach impossible to carry out on a larger scale. On the other hand, the high-throughput approaches which have been described recently albeit excellent for identifying csd alleles present in the population, do not give information on their functional combinations i.e. which alleles are able to form pairs determining femaleness [7]. Consequently, we developed an approach that took advantage of the fact that csd alleles most frequently differ from each other in the number of trinucleotide repeats in the HVR, as well as the TTCCTG/A repeats in the proline-rich encoding region of the gene. In virtually all csd allele sequences analysed to date, these two parts are separated by a conserved sequence containing the VspI restriction enzyme recognition site (ATTAAT) (Fig 1). These features of the csd sequence allowed us to develop a T-RFLP (terminal restriction length polymorphism)-based method of identifying and distinguishing paternal alleles in a given bee colony and assigning them to a particular maternal allele. The aim was to a) identify csd allele combinations present in females, b) identify (whenever possible due to the appropriate number of analysed individuals within the patriline and the fulfilment of the criteria for statistical tests) significant biases in the frequency of genotypes consisting of a given paternal allele and the two maternal alleles present in a given colony. We assumed that the distribution of the maternal alleles within the group of worker bee pupas carrying the same paternal allele would be 0.5/0.5 unless one of the genotypes is lethal or partially lethal; if identified, the absent/underrepresented genotypes should be the ones that are unable to fully determine femaleness. Here we would like to stress that by implementing this method we did not attempt to analyse and compare the frequencies of occurrence of paternal csd alleles at the level of the entire colony but only compare the frequency by which a given paternal allele pairs with the maternal alleles. A potential drawback of the above-proposed method is that the number of restriction patterns is smaller than the number of different csd sequences, and therefore, assigning paternal alleles to individual groups based solely on their restriction patterns may lead to an incorrect merging of two or more distinct paternal alleles into a single group. In order to identify the extent of this problem, we created and analysed a virtual dataset beforehand, consisting of csd sequences present in publicly available databases. We extracted the records that contained the entire sequence in question and identified in silico the VspI restriction patterns. The final dataset contained sequences representing 151 different csd alleles and 79 restriction patterns (S1 File). From this set, we created subsets containing 80 randomly-picked distinct records—number of records in the subsets was chosen based on the reported csd diversity present in the local populations [5]. Assuming that a queen bee mates with 10–20 drones, we created ‘virtual spermathecas’ by sampling with replacement 10, 12, 14 16, 18 and 20 random records from each subset and counted the number of different alleles and distinct restriction patterns in the obtained samples (Table 1). The sampling was repeated 10 times for each subset and spermatheca size. Thus, we obtained an approximation of the expected number of different alleles in all analysed cases. In the case of the 20 represented sampled records, we obtained 17.7 different alleles and 16 different restriction patterns. Smaller differences between the respective mean numbers were observed when a small ‘spermatheca’ size was used.
Table 1

The comparison of the number of different csd alleles and their VspI restriction patterns in virtual spermathecas of different sizes (containing 10–20 records/”alleles”).

size of the spermathecamean number of different allelesmean number of restriction patterns
20 17.716
18 16.214.7
16 14.513.4
14 12.911.9
12 11.210.6
10 9.59

The numbers are mean values obtained after drawing with replacement (n = 10) a specified by the spermatheca size number of records from 80-record subsets (n = 10) of a dataset containing 151 different csd-PSD sequences available in the public repositories.

The numbers are mean values obtained after drawing with replacement (n = 10) a specified by the spermatheca size number of records from 80-record subsets (n = 10) of a dataset containing 151 different csd-PSD sequences available in the public repositories. We concluded that the possible error generated by the proposed screening method is small enough to warrant its further application, especially that a merged group of distinct paternal alleles could easily be distinguished as the one containing significantly more elements than the other groups. Alternatively, such large groups can also represent those containing the offspring of multiple drones possessing identical csd alleles. However, the two possibilities are indistinguishable in this method. The method consisted of the following steps: 1. Identification of maternal alleles through genotyping of the drones present in a given colony: the genotyping involved PCR amplification of the portion of the csd-PSD using 6FAM- and HEX-labelled primers followed by identification of the lengths of both restriction fragments obtained after VspI digestion and direct sequencing of the amplicons. 2. Amplification of the csd alleles from several hundred worker bee at the pupa stage present in a given colony individually and subsequent T-RFLP analysis of the amplicons. Using the previously obtained information on the restriction pattern of the maternal alleles present in the colony, the restriction pattern of the paternal allele was identified. 3. Assigning the worker bees into groups based on the restriction pattern of the paternal allele, and within the particular groups, to one of the two maternal alleles. 4. Cloning and sequencing of the paternal csd alleles representing particular groups. 5. a) Aligning the sequences of csd alleles present in the identified genotypes and b) identifying potential statistically significant differences in the frequencies of the pairing of a given paternal allele with the respective maternal alleles and analysis of the sequence differences between the maternal and paternal alleles within the identified genotypes. The overview of the method is presented in Fig 2.
Fig 2

Schematic representation of the methodology of identifying csd genotypes in worker bees.

Identification and characterisation of csd genotypes

We have tested worker bee pupas from five colonies led by naturally inseminated one-year-old queens. First, we identified the VspI restriction pattern and sequenced the maternal alleles present in a given colony by drone genotyping, identifying 7 distinct alleles in total. Several hundred worker bees were then genotyped and assigned to groups based on the presence of a given paternal allele identified through the unique restriction pattern (Fig 3A). An example of the restriction pattern map of the paternal alleles of one of the colonies is shown in Fig 3B. In total, we established the maternal and paternal csd restrictions patterns of 1248 worker bees, identifying from 7 to 18 paternal alleles in a single colony. As a result of the cloning and sequencing of the paternal alleles of the representatives of each group, we identified 54 distinct paternal alleles and 118 distinct csd genotypes (Table 2 and S2 File, accession numbers MZ030644-MZ0306717).
Fig 3

Terminal restriction fragment length polymorphism method of identifying paternal csd alleles in bee colonies.

(A) An example of T-RFLP analysis of a drone (maternal allele) and a worker bee (identification of a paternal allele) csd alleles. (B) An example of the distribution of the paternal alleles based on the length of the VspI restriction fragments of analysed portion of the csd gene assessed by the T-RFLP method (colony 15–2019). Blue and orange dots represent paternal alleles paired with a given maternal alleles. (C) Frequency of the occurrence of the paternal alleles in each colony and the distribution of the maternal alleles (blue and orange bars) in each csd patriline. Paternal allele groups with statistically significant (chi-test with Bonferroni correction for multiple testing, p<0.1) differences in pairing with maternal alleles are marked with asterisk. Shaded parts of the graph indicate patrilines that were excluded from the analysis due to too small number of individuals in a given patriline.

Table 2

Summary of the identified csd alleles and genotypes in the analysed colonies.

colony identifier3–201915–201920–201915–202020–2020
number of analysed worker bees 272231268236241
frequency of maternal alleles 1 A:134, B:138B:116, F:115C:133, D:135F:146, G:90A:125, E:116
number of paternal alleles * 181415710
number of patrilines with different frequency of maternal alleles # 01021
total number of distinct maternal alleles 7
total number of distinct paternal alleles 54
total number of distinct genotypes 118

1 number of worker bees within a colony carrying a given maternal csd allele

*number of the identified distinct paternal csd restriction patterns

#statistically significant (chi-test, p-value adjusted for multiple testing < 0.1) differences in frequencies of occurrence of maternal csd alleles in a given csd patriline.

Terminal restriction fragment length polymorphism method of identifying paternal csd alleles in bee colonies.

(A) An example of T-RFLP analysis of a drone (maternal allele) and a worker bee (identification of a paternal allele) csd alleles. (B) An example of the distribution of the paternal alleles based on the length of the VspI restriction fragments of analysed portion of the csd gene assessed by the T-RFLP method (colony 15–2019). Blue and orange dots represent paternal alleles paired with a given maternal alleles. (C) Frequency of the occurrence of the paternal alleles in each colony and the distribution of the maternal alleles (blue and orange bars) in each csd patriline. Paternal allele groups with statistically significant (chi-test with Bonferroni correction for multiple testing, p<0.1) differences in pairing with maternal alleles are marked with asterisk. Shaded parts of the graph indicate patrilines that were excluded from the analysis due to too small number of individuals in a given patriline. 1 number of worker bees within a colony carrying a given maternal csd allele *number of the identified distinct paternal csd restriction patterns #statistically significant (chi-test, p-value adjusted for multiple testing < 0.1) differences in frequencies of occurrence of maternal csd alleles in a given csd patriline. Next, we have aligned the sequences of csd allele pairs forming the identified genotypes. As a result, we have created a two-dimensional heat map representing the sequence differences (Fig 4); since the nature of the HVR region does not allow for reliable sequence alignment, the differences between the csd alleles forming a given genotype were characterised by two parameters: the difference in the length of the HVRs (given by the number of amino acid residues) and the number of amino acid differences (mismatches and indels) outside of the HVRs (the fragments of the RS- and proline-rich domains) [13]. As shown in Fig 4, the differences in the length of HVRs ranged from 0 to 16, whereas the number of amino acid differences outside the HVRs ranged from 0 to 12 (with the median values equal to 6 and 5, respectively). Then we have analysed the frequencies with which the given paternal alleles formed a pair with the two maternal alleles present in a given colony (Fig 3C and S3 File). At this point it is important to note that a large number of patrilines (33) had to be excluded from the analysis due to an insufficient number of individuals (n<16) assigned to a given patriline–this was most probably due to the naturally occurring biases in the patriline composition reflecting the actual contribution of a particular drone to the number of spermatozoa stored in the spermatheca and insufficient mixing of sperm at the beginning of oviposition [14]. While most of the remaining patrilines were characterised by nearly equal frequencies of the presence of maternal alleles, we were able to identify four cases that were characterised by different frequencies of the pairing of the paternal allele with the maternal alleles (chi-test, p-value adjusted for multiple testing < 0.1). We assumed that these uneven frequencies were caused by the partial lethality of these underrepresented csd genotypes, and compared the sequence differences between the csd alleles in such genotypes to the other genotypes identified in our study using the aforementioned map of sequence differences. We found that the sequence differences between the csd alleles forming the genotypes underrepresented in our analysis (Fig 4, red dots) were indistinguishable from the differences characterising other genotypes.
Fig 4

The distribution of sequence differences between maternal and paternal csd alleles in the identified genotypes.

The diagram represents the differences between maternal and paternal csd-PSD sequences in genotypes detected in this study characterized by the difference in HVR (amino acid) length and the number of amino acid differences outside of the HVR (X- and Y-axis, respectively). Different shadings depict the number of genotypes characterized by a given set of parameters. Red dots represent the genotypes identified as underrepresented in the analysed colonies.

The distribution of sequence differences between maternal and paternal csd alleles in the identified genotypes.

The diagram represents the differences between maternal and paternal csd-PSD sequences in genotypes detected in this study characterized by the difference in HVR (amino acid) length and the number of amino acid differences outside of the HVR (X- and Y-axis, respectively). Different shadings depict the number of genotypes characterized by a given set of parameters. Red dots represent the genotypes identified as underrepresented in the analysed colonies. More importantly however, we have investigated the csd genotypes characterised by sequence differences smaller than the assumed minimal difference necessary to regularly induce femaleness (five amino acid differences and length variations in the csd-PSD [13]). We initially identified 11 such genotypes (Fig 4); however, nine of them, apart from small differences in the length of the HVR region, were characterised by several amino acid mismatches in this region. The remaining two genotypes, consisting of mB-p66 and mB-p29 csd alleles (where “m” and “p” stands for maternal and paternal alleles, respectively; B–the identifier of the maternal allele; the numbers–identifiers of the paternal alleles [see S2 File for details]), were characterised by a total of one and four amino acid differences in the analysed fragment of the csd-PSD, respectively (Fig 5). These two genotypes were subject to further analysis.
Fig 5

Alignment of amino acid sequences of csd-PSD of p66/mB, p66/mA, p29/mB and p29/mA alleles.

Analysis of the fully functional csd pairs with a minimal sequence difference

The paternal p66 allele was present in 22 worker bees in one of the colonies (3–2019), out of which 13 specimens carried the above-mentioned nearly identical mB-p66 csd genotype and 9 carried the mA/p66 genotype. The mB and p66 alleles differed from each other by a trinucleotide indel (AAT) encoding asparagine residue localised in the hypervariable portion of the protein. The difference between p66 and the other maternal allele (mA) was more profound (a 3 a-a difference in the HVR length, 5 other a-a mismatches in HVR, and 3 a-a differences in the P-domain) (Fig 5). In order to exclude the possibility that the p66 allele was an artefact that had been accidentally derived from the mB allele as a result of a polymerase error during the amplification stage of genotyping, the csd alleles of several specimens assigned to the p66 paternal allele group were cloned and sequenced and were found to have an identical p66 allele as the originally identified, paired either with the mB or mA maternal allele. The sequences of the maternal alleles were independently verified using drone genotyping. We then sequenced an extended portion of p66 and mB alleles to cover the protein-coding sequence present in exons 6–8. We found one C>T substitution localised in exon 6; however, this change did not change the sequence of the encoded protein. To exclude the possibility that we have accidently amplified csd pseudogenes instead of the functional genes we have confirmed the expression of the csd-PSD region of both mB and p66 alleles by RT-PCR using cDNA obtained from mB-p66 larvae. The T-RFLP analysis and sequencing of the cloned amplification products showed the lack of the intron between exons 7 and 8 whereas the rest of the sequence fragments were identical to the ones identified during the analysis of the genomic DNA. It is also important to mention that we have been unable to obtained such intronless amplicons during the amplification of the genomic DNA–this excludes the possibility of the presence of the processed pseudogenes in the genome. Although the frequency of the occurrence of the mB-p66 genotype vs. the mA-p66 genotype (13/9) strongly indicated that the mB-p66 genotype did not cause lethality, we nonetheless tested whether bee larvae carrying the mB-p66 genotype had the molecular hallmark of female development. This was done in order to exclude the possibility that the mB-p66 genotype leads to the formation of diploid males, which are not recognised as such by the worker bees. Consequently, we tested the mB-p66 larvae for the presence of female and/or male splice variants of the dsx transcript using RT-PCR. In all tested cases, the mB-p66 larvae expressed only the female-specific dsx transcript (Fig 6, S1 Raw images).
Fig 6

RT-PCR analysis of female- (dsxF) and male-specific (dsxM) splice variants expression of dsx gene in individuals possessing mB-p66 and mA-p66 and mB-p29 and mA-p29 genotypes.

Numbers 1–5 depict randomly chosen representants of each genotype, D1-4: drone individuals used as controls. Amplification of EF1α gene was used as a positive control.

RT-PCR analysis of female- (dsxF) and male-specific (dsxM) splice variants expression of dsx gene in individuals possessing mB-p66 and mA-p66 and mB-p29 and mA-p29 genotypes.

Numbers 1–5 depict randomly chosen representants of each genotype, D1-4: drone individuals used as controls. Amplification of EF1α gene was used as a positive control. We used the same method to analyse the second pair of alleles, mB-p29. This pair was characterised by one amino-acid indel in the HVR region accompanied by three other amino-acid mismatches in the HVR. Again, the sequence difference between p29 and the other maternal allele (mA) was much larger (1 a-a difference in the length of the HVR, 8 other a-a mismatches in the HVR and 3 a-a differences in the P-domain). The number of occurrences of the mB-p29 and mA-p29 genotypes in the analysed colony was 14 and 11, respectively, showing no indication that mB-p29 genotype may cause lethality. Similar to mA-p29, the mB-p29 individuals expressed a female splice variant of the dsx transcript (Fig 6, S1 Raw images). However sequencing of the additional portion of the RS-domain revealed additional amino acid substitution (K>N, Fig 5).

Discussion

The extreme diversity of the honeybee csd gene (several hundred of its alleles have been identified to date) means that the number of theoretically possible genotypes heterozygous for csd gene is enormous. However, the number of functional heterozygous genotypes actually present in local populations can safely be assumed to be smaller, for two reasons: firstly, the csd alleles show an uneven spatial distribution across the honey bee population, making the number of available variants in local populations limited [5]; secondly, not all alleles can be expected to have the ability to form functional pairs with each other due to insufficient sequence differences. Establishing the criteria of functional heterozygosity is difficult for many reasons, the most important of which is the lack of knowledge about the detailed mechanism of action of the csd protein and its interaction with itself (formation of homo- and/or heterodimers) and with other proteins, which makes it impossible to focus the analysis on precisely selected regions of the csd protein, e.g. by creating an in vitro model and site-directed mutagenesis. An obstacle which in turn prevents the development of a computer algorithm that would predict the ability of a given pair of alleles to form a functional pair is an almost complete lack of data on the pairs of alleles that differ in sequence, but are not functional and incapable (or not fully capable) of determining female development. Therefore, it is not surprising that along with identifying new csd genotypes, the predicted minimum sequence difference continues to decrease [12, 13, 15] along with identifying new genotypes. In this study, we have implemented a method allowing for efficient screening of bee colonies in order to identify csd alleles and their combinations present in female individuals. Instead of randomly picking worker bees in order to clone and sequence their csd alleles we have segregated the analysed bees into patrilines using T-RFLP method, thus greatly reducing the number of individuals needed to establish the sequence of csd alleles present in the colony. While we found this method very efficient in identifying diploid csd genotypes it has not been that efficient in identifying potential biases in the frequencies with which a given paternal allele pairs with the maternal alleles—approx. 50% of the patrilines had to be excluded from the analysis due to the insufficient number of individuals needed to draw statistically meaningful results. Most likely this problem is a result of naturally occurring differences in the contributions of particular drones to the number of spermatozoa present in the spermatheca and it can be resolved by increasing the number of analysed worker bees; however, the actual extent of the bias and therefore the number individuals needed for the analysis is difficult to estimate. To date, the minimum sequence difference between csd alleles needed to fully establish femaleness has been determined to amount to a 5 amino acid difference in the csd-PSD sequence. At the same time, it has been observed that the 3 amino acid difference in length in the HVR caused by a single indel mutation led in most cases to male development, but could also, although infrequently, determine femaleness [13]. In this study we pushed the boundary conditions for functional heterozygosity even further, to a virtually absolute minimum. One of the genotypes identified in our study, mB-p29, was characterised by a difference of 4 amino acids in the HVR region of the protein, but an additional single amino acid substitution was found in the RS-domain. However the second genotype, mB-p66, differed only by a single amino acid in the HVR length and no additional differences in the csd-PSD were found. The identification of the functional mB-p66 pair calls into question the validity of the current approach, i.e. establishing the criteria of functional heterozygosity based only on the number of differences in length and amino acid substitutions in the csd-PSD. It can be argued that since we have genotyped the specimens at the pupa stage of their development, one can’t exclude the possibility that the identified genotype mB-p66 still causes partial lethality due to incomplete penetrance of femaleness. This means however, given that no significant differences of the occurrence between mB-p66 and mA-p66 genotypes have been observed, the mA-p66 was also partially lethal. We find this scenario highly unlikely because the difference between alleles mA/p66 was much bigger (11 amino acid residues) than the previously established minimal criteria for functional heterozygosity (5 amino acid residues). It can still argue that the observed genotype frequencies could be explained by two independent causes: a) the mB-p66 genotype are not fully capable to determine femaleness due to too small sequence differences, b) and at the same time the mA-p66 genotype are partially lethal for reason independent from the csd genotype. Again, we think that this scenario is unlikely because the overall frequency of p66 allele occurrence in the analysed colony (3–2019) is higher than most of the other paternal alleles in this colony (5-th out of 18 in the order of frequency of the paternal alleles, Fig 3C) suggesting that both genotypes do not cause lethality. Based on the evidence that, on the one hand, the 3 amino acid difference in HVR length is unable to fully determine femaleness (alleles G2-Y2 [13]), and, on the other hand, that the HVR length difference of 1 amino acid may be fully functional, it should be concluded that the criteria of functional heterozygosity are highly dependent on the position of the change in the amino acid sequence. We also noticed that the difference between the mB-p66 allele pair is localised within the 3 amino acid difference characterizing the previously described G2-Y2 allele pair. Given that the mB-p66 vs. G2-Y2 sequence alignment shows significant differences in other csd-PSD positions, it should also be inferred that the difference causing functional heterozygosity depends not only on the position in the csd-PSD sequence, but also on the surrounding sequence context. In other words, the same or a similar mutation located at the same site may have a different effect depending on the allele in which it occurs. An additional indication for the dependence of functional heterozygosity on the context of the sequence and type of difference, but not necessarily the number of accumulated changes, is the identification of underrepresented csd genotypes, which in terms of the difference in HVR length and number of differences outside the HVR did not differ from other genotypes identified in this study. It should be noted, however, that the observed differences in the frequency of paternal and maternal allele pairing, are much smaller than those observed in a similar analysis by Beye et al. [13], where the effect of incomplete penetrance of femaleness led to the development of 1 female out of 45 embryos. Therefore, it remains to be established whether the underrepresentation of these genotypes is really caused by the csd configuration or other unfavourable genotypes linked with a given csd allele. The discovery of csd genotype with minimal difference in the sequence of csd-PSD but fully functional in determining femaleness and showing that changes in the csd sequence have a different effect on generating functional heterozygosity depending on the context of the adjacent sequence is important for further research on the csd gene and its diversity. It becomes clear that until the exact structure and mechanism of action of the csd protein and its interactions with other proteins is fully characterised, predicting what difference in the sequence of the csd alleles (at least when minor differences are concerned) will be a functional one may be significantly flawed. This may be crucial for the analysis of the diversity of csd alleles and the subsequent estimation of the number of potentially functional csd genotypes present in a given population, as well as for predicting lethal genotypes in bee breeding programs [16, 17]. It may also be worth considering to refocus the research regarding csd on the N-terminal part of the protein (encoded by exons 2–5); although it has been shown to be subject to purifying selection and accumulates far less changes than the csd-PSD, at this point one cannot outright dismiss the possibility that very small differences in csd-PSD may be supported by more substantial differences in the N-terminal part of the protein to establish functional heterozygosity. Keeping that possibility in mind it may become necessary to sequence the full length of several hundred variants of csd identified so far on the basis of csd-PSD alone. The discovery of the G2-Y2 csd pair differing only in HVR length and capable of partial female development determination led to the conclusion that the emergence of new csd specificities follows a path of increased fitness by increasing the penetrance of femaleness. It has been suggested that the fast-evolving length differences in the HVR are the initial step of the separation of csd specificities and are followed by subsequent mutations in other parts of the csd-PSD. This model assumes that no molecular intermediate forms that evolved through selectively neutral mutations are required [13]. While we find these conclusions still valid, at the same time, we show that the generation of a new, fully functional csd variant may also take place in a single mutation step involving a minimal change in the HVR length only, and therefore, we conclude that at least in some cases (depending on the position of the mutation and the sequence affected), no evolutionary intermediate forms of any kind may be needed to establish a new csd specificity. This means that the rate of emergence of new csd specificities in the population may be higher than expected. However, due to limited number of nearly identical (functional or partially functional) csd allele pairs identified so far, it is still unclear which evolutionary scenario is more likely to take place.

Methods

Simulation of the number of the restriction patterns of csd alleles present in spermathecas

All sequences used in the simulation were retrieved from GenBank (nucleotide) in May 2022 using the search parameters “Apis mellifera” in [organism] and “csd”. Only records containing genomic DNA sequences were considered for further processing. Out of 667 retrieved records, 317 records contained sequences of appropriate length (flanked by csdF2 and csdR2 primers, see Fig 1). The retrieved sequences were trimmed to contain the csdF2-csdR2 fragment and then exported to MS Excel for further processing. Next, the duplicates were excluded and the resulting sequences (214 records) were processed to remove the intron between exons 7 and 8. The resulting sequences were translated in vitro and records with corrupted open reading frames were excluded from the dataset. As a result 151 genomic sequences flanked by csdF2 and csdR2 primers and containing the intron was used in the simulation. In each sequence the position of VspI restriction site (ATTAAT) has been localized and the length of the 5’ and 3’ fragments were established. Seventy nine unique VspI restriction patterns had been identified assigned to the records and their ID numbers. The records with their allele ID, corresponding restriction pattern ID, length of the 5’ and 3’ restriction fragments are available in the S1 File. From this set, we created 10 subsets containing 80 randomly-picked distinct records (Kutools for MS Excel, “random data” tool)–the number of records in the subsets was chosen based on the reported csd diversity present in the local populations. Out of each of these subsets, “virtual spermathecas” containing 10, 12, 14, 16, 18 and 20 records were picked using RANDBETWEEN function. 10 virtual spermathecas were created for each subset and spermatheca size resulting in 100 simulations for each spermatheca size. The content of the virtual spermathecas were analysed to establish the number of distinct csd alleles (represented by the allele ID) and the number of unique corresponding restriction patterns (represented by the restriction pattern ID).

Sample collection and DNA isolation

The worker brood was collected from five colonies headed by naturally inseminated 1-year-old queens in 2019 and 2020 (April) by cutting out a section of the capped brood comb. We have assumed that the queens mated with 15 drones and that the minimal size of the patriline group needed to identify potential biases in pairing with the maternal alleles within a given patriline is 16, thus we have estimated the number of individuals needed for the analysis as 240. The individual specimens were transferred into 48-well plates and stored in 96% ethanol at -20°C prior to further processing. The DNA was isolated using in-house-made silica-coated magnetic nanoparticles [18]. Briefly, ~20 mg of tissue was incubated in 60 ul of TNES buffer (100 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.3% SDS, 200 mM NaCl) with 4 ul of proteinase K (10 mg/ml) for 2 hours at 56°C with shaking. Then 120 ul of GITC lysis buffer (6M guanidine isothiocyanate, 50 mM Tris-HCl pH 7.6–8.0, 20 mM EDTA, 2% sarkosyl) was added followed by precipitation with 240 ul of isopropanol. The DNA was then bound to magnetic particles which were settled on a magnetic rack. The DNA-bead complexes were washed once with 400 ul of isopropanol, twice with 300 ul of 80% ethanol, dried at 56°C, resuspended in 50 ul of nuclease-free water and incubated with shaking for 5 minutes at 56°C to enable DNA elution [18]. After settling the beads on the magnetic rack, 1 ul of the DNA solution was used for PCR.

Terminal restriction length polymorphism

The Terminal Restriction Length Polymorphism analysis of csd gene was performed as following: the fragment encoding the potential-specifying domain of csd gene was amplified in a two-step nested PCR reaction (30 cycles, 51°C annealing) using the following set of primers [19]: csdF1: 5’AGACrATATGAAAAATTACACAATGA, csdR1: 5’TCATwTTTCATTATTCA and csdF2: 5’-HEX-TATCGAGAAAsATCGAAAGAACGAT, csdR2: 5’-6FAM-ATTGAAATCCAAGGTCCCATTGGT using PCR Mix Plus kit containing PCR antiinhibitors (A&A Biotechnology). 1–2 ul of the second amplification product was digested in 10 ul of reaction mixture containing 2.5 U of VspI restriction enzyme (Thermo Scientific) and incubated for 1 hour at 37°C. 1 ul of the digestion product was denatured in the presence of Hi-Di formamide and 0.25 ul of 350 bp Rox standard (Life Technologies) and subjected to capillary electrophoresis on ABI Prism 310 apparatus. The size of the restriction fragments was assessed using GeneMarker software.

Cloning and sequencing

To clone the csd alleles from female specimens the sequence- and ligation-independent cloning (SLIC) method was used. The product of the first PCR reaction (see above) was reamplified using primers containing overhangs complementary to pUC-18 vector: SLIC-csdF2: 5’- AGGTCGACTCTAGAGGATCCTATCGAGAAAsATCGAAAGAACGAT and SLIC-csdR2: 5’- ATGACCATGATTACGAATTCATTGAAATCCAAGGTCCCATTGGT. 60 ng of the gel-purified amplification product was then mixed with 150 ng of pUC-18 plasmid linearized with EcoRI and BamHI (Thermo Scientific) and the single-stranded overhangs were obtained in a 10 ul reaction containing T4 DNA polymerase (Thermo Scientific), 1x T4 DNA polymerase reaction buffer, 1 ul BSA (1 mg/ml) for 3 minutes at room temperature. The reaction was terminated by adding 1 ul of 10 mM dCTP and 20 ng of recA protein. The reaction mixture was then used for transformation of chemicompetent E.coli followed by ampicillin selection and blue/white screening. Single white colonies were picked and used directly in a PCR reaction (30 cycles, 52°C annealing) using M13forward: 5’- CCCAGTCACGACGTTGTAAAACG and M13reverse: 5’- AGCGGATAACAATTTCACACAGG primers. The amplification product was digested with alkaline phosphatase (0.25 U, Thermo Scientific) and exonuclease I (0.5 U, Thermo Scientific) for 30 minutes at 37°C. The enzymes were inactivated by denaturation (5 minutes, 95°C). 1–3 ul of the DNA was used in cycle sequencing reaction (10 ul) containing: 1.9 ul 5x sequencing buffer, 0.5 ul BigDye Terminator Cycle Sequencing mix and 0.65 ul 5 uM of either csdF2 or csdR2 primer. The sequencing products were precipitated with 75% isopropanol in the presence of 0.25 ul of glycogen (10 mg/ml), resuspended in 15 ul of Hi-Di formamide, denatured and subjected to capillary electrophoresis (ABI Prism 310). Data were analyzed using ABI Sequence Analysis software (v3.3). In individual cases, in order to clone fragments extending the csd-PSD the same cloning and sequencing techniques were used as described above except for different sets of primers for both nested-PCR reactions and sequencing (csdF0<->csdR1 [first PCR] and SLIC-csdF2<->SLIC-csdR1 [second PCR], or csdF0<->csdR0 [first PCR] and SLIC-csdF0<->SLIC-csdR2 [second PCR]) [20]. csdF0: 5’- GGGAGAGAAGTTGCAGTAGAG, csdR0: 5’- TTGATGCGTAGGTCCAAATCC, SLIC-csdR1: 5’- ATGACCATGATTACGAATTCGTCATCTCATwTTTCATTATTCAAT, SLIC-csdF0: 5’- AGGTCGACTCTAGAGGATCCGGGAGAGAAGTTGCAGTAGAGATAGAAATAGAG. The csd gene fragments derived from drones were amplified and sequenced without prior cloning.

Data analysis

The worker bees within a given colony were assigned to paternal allele groups based on the nucleotide length of the restriction fragments of the paternal alleles. Within the paternal groups, they were assigned to one of two maternal alleles present in the given colony. Testing for statistically significant differences between the expected frequencies of the presence of maternal alleles (0.5/0.5) and the observed frequencies within a given patriline is a problem of the simultaneous testing of more than one hypothesis i.e. testing of several patrilines within a colony. Therefore, Pearson chi-squared tests with Bonferroni correction for multiple (i.e. the number of tests performed for a given colony) testing (R statistical package) was used to adjust p-values to avoid the problem of higher probability of false rejecting the general null hypothesis, i.e. there is no significant differences in all considered cases. In order to characterize sequence differences occurring in the allele pairs the obtained nucleotide sequences were in silico translated and aligned using Jalview pairwise alignment. The differences in the protein sequences were characterized by the length differences of the HVR and a total number of amino acid differences outside of the HVR.

RNA isolation and RT-PCR

Total RNA was isolated from ~40 mg of tissue using Quick-RNA miniprep kit (Zymo Research) according to the manufacturer’s recommendation. The RNA was then reverse-transcribed using Superscript IV reverse transcriptase (ThermoFisher Scientific) and random decamers and amplified in a PCR reaction (30 cycles, 52°C annealing). In order to amplify csd transcripts, csdF1/csdR1 and csdF2/csdR2 were used as described above. In order to detect female- or male-specific splice forms of dsx gene the following primer sets were used: dsxM-A: 5’-TGGTCACCCATTTGCCACAGAC, dsxM-B: 5’-TCGTATGTCGGAGGTCCCGTTG (male) and dsxF-A: 5’-CTATTGGAGCACAGTAGCAAACTTG, dsxF-C: 5’-GAAACAATTTTGTTCAAAATAGAATTCC (female). The amplification of ef1-α gene was used as a control of cDNA quality: ef1F: 5’-CGTTCGTACCGATCTCCGGATG, ef1R: 5’-GCTGCTGGAGCGAATGTTAC. The amplification products were resolved in 2% agarose gel.

Sequences and record IDs of csd alleles retrieved from the public databases used in virtual validation of T-RFLP method.

(XLSX) Click here for additional data file.

Sequences and accession numbers of the csd alleles identified throughout this work.

(XLSX) Click here for additional data file.

Summary of the paternal csd allele identification in the analysed colonies and frequency of pairing with maternal alleles.

(XLSX) Click here for additional data file.

Raw images used in Fig 6.

(PDF) Click here for additional data file. 22 Apr 2022
PONE-D-22-09346
Revisiting the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene
PLOS ONE Dear Dr. Cebrat, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
 
As you can see from the accompanying critiques, one reviewer liked your manuscript as it is while the second one raises some points which you should address in a revised version. Since additional experiments are not required I estimate the extent of the requested changes anywhere between 'minor' and 'major'. 
Please submit your revised manuscript by Jun 06 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Christoph Englert Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This well written manuscripts utilizes a new method to investigate the minimum sequence difference to result in functional CSD alleles that result in female honey bees. The finding that a single amino acid difference can result in femaleness is a significant breakthrough. Line 80-81: There is no definition for dPSD, just dPSD Reviewer #2: The manuscript report an interesting study on the A. mellifera csd gene - mainly focused on the identification of potential functional pairs. The study is well written - however it needs several adjustemnts to better refine the content and clarify the approach Introduction: Line 47 - references should be reported. As far as I know, two publications list the number of csd alleles Bilodeau, L., & Elsik, C. (2021). A scientific note defining allelic nomenclature standards for the highly diverse complementary sex-determiner (csd) locus in honey bees. Apidologie, 52(4), 749-754. Bovo, S., Ribani, A., Utzeri, V. J., Taurisano, V., Schiavo, G., Bolner, M., & Fontanesi, L. (2021). Application of Next Generation Semiconductor-Based Sequencing for the Identification of Apis mellifera Complementary Sex Determiner (csd) Alleles from Honey DNA. Insects, 12(10), 868. These works should be cited The aim of the study is not completely clear - a methodology to enabling the analysis of a large number of the csd genotypes of worker bees in order to identify those that are underrepresented or absent in bee colonies, under the assumption that these genotypes induce, at least to some extent, lethality - was used but the purpose is not well defined as the results were not as the authors would have assumed It seems that the study is divided in two part: one that would like to establish if there would be any underepresented genotypes and the other that analysed the minimum sequence differences between the pairs to define lethality or not. The methodology should be however better defined Results Rationale and workflow of the genotyping method A figure reporting the schematic representation of the methodology applied would help to follow the different steps and concepts line 118: a figure reporting an example of the pattern observed with the T-RFLP (terminal restriction length polymorphism)-based method is needed to clarify the methodology and the way in which this approach was able to identify paternal alleles Results were not really conclusive - this might be due to the fact that only five colonies were sampled - in addition it is not known when pupae (in which part of the year were sampled) - according to the ovideposition of the queen there would be potentially some biases in the distribution of the paternal alleles over the ovideposition period/years of the queen - this bias has not been taken into account to discuss the first part of the results - the biased genotypes Some concluding remarks are missed - what is the final message derived by t he obtained results ? what are the limits of the approach? this should be reported in the discussion and conclusion as well as in the abstract Methods All elements related to the simulation study is missed - it is described partially in results - however, it is not clear how csd sequence data were retrieved, when, and how have been filtered - Actually a much larger number of alleles than those used in the simulation. All different steps of the simulation part should be described here. It is not very clear how virtual spermateca have been constructed and the potential biases due to unequal sperm representation have been considered in the simulation How multiple testing was considered ? It is not clear if the authors defined the minimum number of sequences to be obtained from workers to infer with a sound statistical approach if there would be any biases in the paternal allele distribution - this part is quite naive ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 19 May 2022 Attached please find our response to the Reviewers’ comments regarding our paper: “Revisiting the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene” which we would like to publish in PLOS ONE. I hope you will find that we have adequately responded to the comments, made appropriate corrections and that our paper can be now accepted for publication. Below please find our point-by-point response. Kind regards – Malgorzata Cebrat Reviewer 1 1. Line 80-81: There is no definition for dPSD, just dPSD Answer: the definition of dPSD has been included in line 79. Reviewer 2 1. Line 47 - references should be reported. As far as I know, two publications list the number of csd alleles Bilodeau, L., & Elsik, C. (2021). A scientific note defining allelic nomenclature standards for the highly diverse complementary sex-determiner (csd) locus in honey bees. Apidologie, 52(4), 749-754. Bovo, S., Ribani, A., Utzeri, V. J., Taurisano, V., Schiavo, G., Bolner, M., & Fontanesi, L. (2021). Application of Next Generation Semiconductor-Based Sequencing for the Identification of Apis mellifera Complementary Sex Determiner (csd) Alleles from Honey DNA. Insects, 12(10), 868. These works should be cited Answer: The above-mentioned papers were cited as references 6 and 7, respectively (lines 45 and 108) 2. The aim of the study is not completely clear - a methodology to enabling the analysis of a large number of the csd genotypes of worker bees in order to identify those that are underrepresented or absent in bee colonies, under the assumption that these genotypes induce, at least to some extent, lethality - was used but the purpose is not well defined as the results were not as the authors would have assumed It seems that the study is divided in two part: one that would like to establish if there would be any underepresented genotypes and the other that analysed the minimum sequence differences between the pairs to define lethality or not. Answer: Indeed, we agree that the aim was not completely clear and the results were presented in a confusing way. The aim of this study was to acquire information about a large number of csd genotypes of diploid individuals and to identify, whenever possible, genotypes that are underrepresented or absent in bee colonies in order to verify/refine the criteria of functional heterozygosity of csd alleles. We have now clarified this in the Introduction (lines 89-94) and Results section (lines 115-118). Also, the Results section had been rearranged to remove the misleading impression of the aforementioned division and to emphasize the importance of identifying csd genotypes in analyzed colonies (subsection Identification and characterisation of csd genotypes). 3. A figure reporting the schematic representation of the methodology applied would help to follow the different steps and concepts Answer: The figure showing the schematic representation of the methodology is included in the revised version of the manuscript as Figure 2. 4. line 118: a figure reporting an example of the pattern observed with the T-RFLP (terminal restriction length polymorphism)-based method is needed to clarify the methodology and the way in which this approach was able to identify paternal alleles Answer: The requested figure is included in the revised version of the manuscript as Figure 3A. 5. Results were not really conclusive - this might be due to the fact that only five colonies were sampled - in addition it is not known when pupae (in which part of the year were sampled) - according to the ovideposition of the queen there would be potentially some biases in the distribution of the paternal alleles over the ovideposition period/years of the queen - this bias has not been taken into account to discuss the first part of the results - the biased genotypes Answer: The pupae were collected in early spring (April) and they were offspring of 1-year-old naturally inseminated queens. This information is provided in the Methods section (lines 413-414). We agree that there are biases in the distribution of the paternal alleles over the ovideposition period/years of the queen (as it has been hypothesized – e.g. due to improper mixing of spermatozoa in the spermatheca, Brodschneider et al, 2012), however, we would like to draw the Reviewer's attention to the fact that we have not attempted to compare the frequency of occurrence of paternal alleles in the analysed colony but the potential biases in the frequency of pairing of a given paternal allele with the two maternal alleles present in the colony. Figuratively speaking, we did not pay attention to differences in the number of worker bees identified in the patrilines (differences in the heights of the bars in Fig 3C) but we have analyzed each patriline separately in order to establish whether there was a difference in pairing with the maternal alleles (comparing blue vs orange parts of each bar). This fact has been emphasized in lines 121-124 of the revised version of the manuscript. 6. Some concluding remarks are missed - what is the final message derived by t he obtained results ? what are the limits of the approach? this should be reported in the discussion and conclusion as well as in the abstract Answer: The final message of the manuscript is the identification of a fully functional csd pair differing by one amino acid residue and the resulting conclusion that criteria for functional heterozygosity of the csd gene are highly dependent on the sequence context and position of the change and the generation of a new csd specificity may occur during a single mutation step with no need for evolutionary intermediates accumulating further mutations. This message has been now included in the Abstract (lines 26-30) and the final part of the Discussion (lines 379-385). The limitations of the method implemented in our research – low efficiency in identifying potential biases in the frequencies with which a given paternal allele pairs with the maternal alleles (approx. 50% of the patrilines had to be excluded from the analysis due to the insufficient number of individuals needed to draw statistically meaningful results) has been now presented in the Results and Discussion sections (lines 207-211 and 301-313, respectively). 7. All elements related to the simulation study is missed - it is described partially in results - however, it is not clear how csd sequence data were retrieved, when, and how have been filtered - Actually a much larger number of alleles than those used in the simulation. All different steps of the simulation part should be described here. It is not very clear how virtual spermateca have been constructed and the potential biases due to unequal sperm representation have been considered in the simulation Answer: Details of the simulation have been now included in subsection “Simulation of the number of the restriction patterns of csd alleles present in spermathecas” of the “Methods” section (lines 388-410). a) Yes, it is true that the databases contain much more records on Apis mellifera csd allele sequences – our most recent search (May 2022) retrieved 667 records. Regrettably, because most of the research is focusing on the hypervariable region alone, only 317 records contained the full sequence needed for our analysis (depicted in Figure 1 of the manuscript). After elimination of duplicates (317->214) and the records containing obvious errors in sequencing (out of frame indels in exon sequences) we have now been able to identify 151 distinct csd alleles on the level of nucleotide sequence. Those 151 alleles represented 79 distinct restriction patterns. We have now redone our simulation using the updated set of sequences. b) Because the aim of this simulation was to estimate the difference between the absolute number of the distinct alleles present and the number of distinct restriction patterns they represent, in our opinion it is not necessary to consider biases in sperm representation in the spermatheca. In other words – assuming that the queen mated with a given number of drones we wanted to check how many distinct alleles and restriction patterns are present in her spermatheca but not how they will be distributed in the worker bees. 8. How multiple testing was considered? Answer: Testing for statistically significant differences between the expected frequencies of the presence of maternal alleles (0.5/0.5) and the observed frequencies within a given patriline is a problem of the simultaneous testing of more than one hypothesis i.e. testing of several patrilines within a colony . Therefore, Pearson chi-squared tests with Bonferroni correction for multiple (i.e. the number of tests performed for a given colony) testing (R statistical package) was used to adjust p-values to avoid the problem of higher probability of false rejecting the general null hypothesis, i.e. there is no significant differences in all considered cases. This information has now been included in the manuscript (lines 473-479) 9. It is not clear if the authors defined the minimum number of sequences to be obtained from workers to infer with a sound statistical approach if there would be any biases in the paternal allele distribution - this part is quite naïve Answer: We have assumed that the queens mated with approx. 15 drones and that the minimal size of the patriline group needed to identify potential biases in pairing with the maternal alleles within a given patriline as 16, thus we have estimated the number of individuals needed for the analysis as 240. This information has been now included in the Methods section (lines 414-417). We have not been able to predict the extent of the bias in sperm distribution and we admit in the revised version of the manuscript that this assumed number was too small, since many patrilines groups had to be excluded from the analysis due to the insufficient number of individuals. In the revised version of the manuscript we have also emphasized the usefulness of our approach in identifying genotypes in the analysed colonies. Submitted filename: response.docx Click here for additional data file. 30 Jun 2022
PONE-D-22-09346R1
Revisiting the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene
PLOS ONE Dear Dr. Cebrat, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The reviewer still has a number of suggestions that should improve your manuscript. Please address those issues before we can consider your manuscript for publication. 
Please submit your revised manuscript by Aug 14 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Christoph Englert Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: The manuscript has been improved and now is much more interesting. Anyway, a few additional improvements are still needed. 1) The title: based on the results obtained - jus one sequence that differ by one amino acid is a preliminary suggestion and and a confirmation of what is stated 2) The abstract is largely written including introductions to the context -no M&M info and just a few lines of results are reported - it should be better balanced - please take also into account that too bold conclusions should be better balanced. 3) In Table 2: They are not clear the the numbers corresponding to the "frequency of maternal alleles" 4) Not clear the nomenclature reported at line 232 ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
6 Jul 2022 Attached please find our response to the Reviewer comments regarding our paper: “New insights into the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene – discovery of a functional allele pair differing by a single amino acid” (former title “Revisiting the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene”) which we would like to publish in PLOS ONE. I hope you will find that we have adequately responded to the comments, made appropriate corrections and that our paper can be now accepted for publication. Below please find our point-by-point response. Kind regards – Malgorzata Cebrat 1. “The title: based on the results obtained - jus one sequence that differ by one amino acid is a preliminary suggestion and and a confirmation of what is stated” Answer: The title has been changed to precisely describe our discovery and their possible impact on the matter of functional heterozygosity of csd gene. 2) “The abstract is largely written including introductions to the context -no M&M info and just a few lines of results are reported - it should be better balanced - please take also into account that too bold conclusions should be better balanced.” Answer: The abstract has been rewritten to accommodate Reviewer’s suggestions – the introduction part has been shortened to a minimum needed to understand the context of our work, the M&M information has been incorporated into the description of the results and the conclusions are, in our opinion, better balanced. Please also note that the final sentence of the Discussion part has been added to better balance our conclusions. 3) “In Table 2: They are not clear the the numbers corresponding to the "frequency of maternal alleles" Answer: An additional line has been added to the Table 2 legend in order to clarify the issue. We have also added the information which maternal alleles (A to G) were present in a given colony and how many worker bees carried it. 4) “Not clear the nomenclature reported at line 232” Answer: The description of the genotypes have been changed (lines 237-239) Submitted filename: response.docx Click here for additional data file. 11 Jul 2022 New insights into the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene – discovery of a functional allele pair differing by a single amino acid PONE-D-22-09346R2 Dear Dr. Cebrat, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Christoph Englert Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 29 Jul 2022 PONE-D-22-09346R2 New insights into the criteria of functional heterozygosity of the Apis mellifera complementary sex determining gene – discovery of a functional allele pair differing by a single amino acid Dear Dr. Cebrat: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Christoph Englert Academic Editor PLOS ONE
  15 in total

1.  The gene csd is the primary signal for sexual development in the honeybee and encodes an SR-type protein.

Authors:  Martin Beye; Martin Hasselmann; M Kim Fondrk; Robert E Page; Stig W Omholt
Journal:  Cell       Date:  2003-08-22       Impact factor: 41.582

2.  Evolution of the complementary sex-determination gene of honey bees: balancing selection and trans-species polymorphisms.

Authors:  Soochin Cho; Zachary Y Huang; Daniel R Green; Deborah R Smith; Jianzhi Zhang
Journal:  Genome Res       Date:  2006-10-25       Impact factor: 9.043

3.  Gradual molecular evolution of a sex determination switch through incomplete penetrance of femaleness.

Authors:  Martin Beye; Christine Seelmann; Tanja Gempe; Martin Hasselmann; Xavier Vekemans; M Kim Fondrk; Robert E Page
Journal:  Curr Biol       Date:  2013-12-05       Impact factor: 10.834

4.  Signatures of selection among sex-determining alleles of the honey bee.

Authors:  Martin Hasselmann; Martin Beye
Journal:  Proc Natl Acad Sci U S A       Date:  2004-03-29       Impact factor: 11.205

5.  Evidence for convergent nucleotide evolution and high allelic turnover rates at the complementary sex determiner gene of Western and Asian honeybees.

Authors:  Martin Hasselmann; Xavier Vekemans; Jochen Pflugfelder; Nikolaus Koeniger; Gudrun Koeniger; Salim Tingek; Martin Beye
Journal:  Mol Biol Evol       Date:  2008-01-12       Impact factor: 16.240

6.  Single locus complementary sex determination in Hymenoptera: an "unintelligent" design?

Authors:  Ellen van Wilgenburg; Gerard Driessen; Leo W Beukeboom
Journal:  Front Zool       Date:  2006-01-05       Impact factor: 3.172

7.  Does Patriline Composition Change over a Honey Bee Queen's Lifetime?

Authors:  Robert Brodschneider; Gérard Arnold; Norbert Hrassnigg; Karl Crailsheim
Journal:  Insects       Date:  2012-09-13       Impact factor: 2.769

8.  Sex determination in honeybees: two separate mechanisms induce and maintain the female pathway.

Authors:  Tanja Gempe; Martin Hasselmann; Morten Schiøtt; Gerd Hause; Marianne Otte; Martin Beye
Journal:  PLoS Biol       Date:  2009-10-20       Impact factor: 8.029

9.  The Am-tra2 gene is an essential regulator of female splice regulation at two levels of the sex determination hierarchy of the honeybee.

Authors:  Inga Nissen; Miriam Müller; Martin Beye
Journal:  Genetics       Date:  2012-08-31       Impact factor: 4.562

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.