| Literature DB >> 35938174 |
Giulia Gaggi1,2, Andrea Di Credico1,2, Simone Guarnieri3,4, Maria Addolorata Mariggiò3,4, Angela Di Baldassarre1,2, Barbara Ghinassi1,2.
Abstract
Human amniotic fluids stem cells (hAFSCs) can be easily isolated from the amniotic fluid during routinely scheduled amniocentesis. Unlike hiPSCs or hESC, they are neither tumorigenic nor immunogenic and their use does not rise ethical or safety issues: for these reasons they may represent a good candidate for the regenerative medicine. hAFSCs are generally considered multipotent and committed towards the mesodermal lineages; however, they express many pluripotent markers and share some epigenetic features with hiPSCs. Hence, we hypothesized that hAFSCs may overcome their mesodermal commitment differentiating into to ectodermal lineages. Here we demonstrated that by the sequential exposure to specific factors, hAFSCs can give rise to spinal motor neurons (MNs), as evidenced by the gradual gene and protein upregulation of early and late MN markers (PAX6, ISL1, HB9, NF-L, vAChT). When co-cultured with myotubes, hAFSCs-derived MNs were able to create functional neuromuscular junctions that induced robust skeletal muscle contractions. These data demonstrated the hAFSCs are not restricted to mesodermal commitment and can generate functional MNs thus outlining an ethically acceptable strategy for the study and treatment of the neurodegenerative diseases.Entities:
Keywords: amniotic fluid stem cells (AFSC); mesenchimal cells; motoneuron (MN); perinatal stem cells; regenerative medicine
Year: 2022 PMID: 35938174 PMCID: PMC9354810 DOI: 10.3389/fcell.2022.936990
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
FIGURE 1Timeline and culture conditions for the MN differentiation of hAFSCs. The picture reported in detail the small molecules used to induce the MN differentiation. Cells were grown on Matrigel until day 11 and then were detached and replated on polyornitine/laminin plates. During the differentiation process the IMDM medium was gradually replaced with N2 medium until day 11, when it was changed into Neurobasal medium supplemented with B27. *IMDM medium: IMDM 20%FBS supplemented 1% penicillin/streptomycin, 2 mM L-glutamine. **N2 medium: IMDM supplemented with N2, 1% penicillin/streptomycin and 2 mM L-glutamine.
qPCR primer sequences.
| Gene | Sequence (5′–3′) |
|---|---|
| Endo- | GGGTTTTTGGGATTAAGTTCTTCA |
| Endo- | GCCCCCACCCTTTGTGTT |
| PAX6-FW | CCAACTCCATCAGTTCCAACG |
| PAX6-RV | GGCTGCTAGTCTTTCTCGGG |
| HB9-FW | GCACCAGTTCAAGCTCAAC |
| HB9-RV | GCTGCGTTTCCATTTCATCC |
| ISL1-FW | GCCTGCTTTTCAGCAACTGG |
| ISL1-RV | GCCTCAATAGGACTGGCTACC |
| 18S-FW | CATGGCCGTTCTTAGTTGGT |
| 18S-RV | CGCTGAGCCAGTCAGTGTAG |
Phenotypic characterization of hAFSCs.
| Markers | Positive cells (%) |
|---|---|
| Pluripotency Markers | |
| OCT4 | 18.5 ± 5.2 |
| SSEA4 | 65.3 ± 6.1 |
| SOX2 | 53.0 ± 2.3 |
| NANOG | 76.2 ± 3.1 |
| TRA1-60 | 12.1 ± 2.8 |
| C-KIT | 1.0 ± 1.3 |
| Mesenchymal markers | |
| CD90 | 73.1 ± 4.1 |
| CD105 | 68.4 ± 3.8 |
| Hematopoietic markers | |
| CD34 | Negative |
| CD45 | Negative |
FIGURE 2Morphological and gene expression analysis of hAFSC during the differentiation into MNs (A) Schematic representation of key points of MN differentiation. (B) Morphological analysis of different differentiation steps. Magnification 20x, scale bar 50 µm. Pictures are representative of 3 independent experiments. (C) Gene expression of OCT4, PAX6, ISL1 and HB9 was quantified in hAFSCs by qPCR at different time points during the differentiation process, as indicated. The fold changes were expressed in relation to day 11. 18S was used as reference gene. The graphs show the Mean ± SD of 3 independent experiments *p < 0.05.
FIGURE 3Immunofluorescent analysis of late MN markers. Immunostaining and the relative fluorescence intensity for (A) NF-L (green), (B) vAChT (red) and (C) HB9 (green) in undifferentiated cells (day 0) and hAFSC-derived MNs (day 22). The nuclei were counterstained with DAPI. Arrows indicate the cytoskeleton localization of NF-L in (A), the vesicular staining pattern of vAChT in (B) and the HB9 perinuclear localization in (C). Original magnification: 40x, scale bar 20 μm. Red rectangle represents an enlarged area: magnification 60x. Immunofluorescence images are representative of 3 independent experiments.
FIGURE 4Functional features of hAFSC-derived MNs. (A) Calcium imaging in hAFSC-derived MNs after 22 days of differentiation. Cells were stimulated with 50 mM of KCl. F/F0 represents the ratio of fluorescence intensity for each cell at the indicated time. (B) NMJ detection in the co-culture of hAFSC-derived MNs and myotubes. MNs were labelled with a blue vital staining, whereas the AChRs on myotubes were stained with the α-BTX (green). Red rectangle represents enlarged area (60x). White arrow indicates neuronal terminals ending on the α-BTX (AChRs). Magnification 40x, scale bar 20 µm. The picture is representative of 3 different experiments. (C) Video analysis of the muscle cell contractions in single culture of myotubes, in a contacting co-culture (hAFSC-derived MNs plus myotube) and in a non-contacting co-culture between hAFSC-derived MNs and myotubes. The movements of different points were tracked and quantified by Celleste Image Analysis Software. Graphs are representative of the distance covered by moving points inside three differently ROI.