Redefining species limits in the Fusarium fujikuroi species complex.

The Fusarium fujikuroi species complex (FFSC) includes more than 60 phylogenetic species (phylospecies) with both phytopathological and clinical importance. Because of their economical relevance, a stable taxonomy and nomenclature is crucial for species in the FFSC. To attain this goal, we examined type specimens and representative cultures of several species by employing morphology and phylogenetic analyses based on partial gene fragments of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase II second largest subunit (rpb2). Based on these results three new species were delimited in the FFSC. Two of these phylospecies clustered within the African clade, and one in the American clade. Epitypes were also designated for six previously described FFSC species including F. proliferatum and F. verticillioides, and a neotype designated for F. subglutinans. Furthermore, both F. acutatum and F. ophioides, which were previously invalidly published, are validated. Citation: Yilmaz N, Sandoval-Denis M, Lombard L, et al. 2021. Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46: 129-162. https://doi.org/10.3767/persoonia.2021.46.05.

INTRODUCTION

The genus Fusarium is considered one of the most important plant pathogenic genera globally and includes more than 330 species. Fusarium graminearum s.lat. and F. oxysporum s.lat. are regarded as two of the most important fungal pathogens in plant pathology based on a survey done within the international phytopathological community (Dean et al. 2012). Fusarium species cause diseases that universally influence both the agricultural and forestry sectors. In addition, some species produce regulated mycotoxins which are responsible for further devastating losses to agricultural crops worldwide and threaten global food security (Wu 2007). Recently, Fusarium species have also become more prevalent in the clinical setting causing various diseases and infections in humans and animals for which limited clinical treatments are available (Jain et al. 2011).

The Fusarium fujikuroi species complex (FFSC) is one of the larger and best studied species complexes within the genus displaying various ecologies (Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019). The FFSC was first established by Wollenweber et al. (1925) as section Liseola for species that produce sporodochial conidia (macroconidia), microconidia in chains and/or false heads, and do not produce chlamydospores. However, in subsequent years several species were described, namely F. dlamini (Marasas et al. 1985), F. nygamai (Burgess & Trimboli 1986) and F. napiforme (Marasas et al. 1987) that conformed to the characteristics of section Liseola, but notably also produced chlamydospores. To accommodate these species, Kwasna et al. (1991) introduced the section Dlaminia. Subsequent molecular studies nonetheless showed that section Liseola was paraphyletic, with species in section Dlaminia resolving within Liseola (O’Donnell et al. 1998, 2000). This clearly exemplified the complications of using phenotypic characters to predict relatedness and evolutionary histories, where morphology often displayed discord with DNA sequence data. In light of these limitations, the term ‘species complex’ was introduced which essentially served as a way to name phylogenetic clades (O’Donnell & Cigelnik 1997, O’Donnell et al. 1998).

Throughout the years, Fusarium species in the FFSC have been extensively studied due to their ability to cause infections in plants, producing mycotoxins (e.g., beauvericin, fumonisins, moniliformin), and causing opportunistic human infections (Nirenberg & O’Donnell 1998, Munkvold 2017, Al-Hatmi et al. 2019). A biogeographic hypothesis was developed by O’Donnell et al. (1998) for FFSC, which clustered isolates into three relatively well-supported phylogenetic clades named the African, American and Asian clades. Subsequent studies split the African clade into two distinct and highly supported lineages (African Clade A & B; Herron et al. 2015, Sandoval-Denis et al. 2018b). The core African clade (African Clade A) included maize and coffee pathogens such as F. verticillioides and F. xylarioides, whereas the African Clade B included F. fredkrugeri and F. dlaminii (Geiser et al. 2005, O’Donnell et al. 2018, Sandoval-Denis et al. 2018b). The American clade included species like F. circinatum, the causal agent of pitch canker in pine trees, and F. temperatum, a maize pathogen producing several mycotoxins (Aoki et al. 2014, Fumero et al. 2015). The Asian clade included species such as F. mangiferae, a tree pathogen, and F. proliferatum known for its ability to cause significant levels of disease on a wide range of plant hosts (Britz et al. 2002, Leslie & Summerell 2006).

Presently there are more than 60 distinct phylogenetic species recognised in the FFSC. However, several phylogenetically distinct species within this complex have still not been officially named. A well-defined species with a Latin binomial will help end-users to more robustly identify Fusarium strains, better diagnose diseases, help to intimately understand their biology, and ultimately develop better management and quarantine strategies. The purpose of this study was to introduce Latin binomials for unnamed FFSC phylospecies based on a number of strains accessioned within the Westerdijk Fungal Biodiversity Institute (CBS), and the USDA Agricultural Research Service (NRRL) culture collections and correct seven species typifications which have been neglected in the past.

MATERIALS AND METHODS

Isolates

Isolates included in this study were obtained from diverse culture collections, namely the U.S. Agricultural Research Service culture collection (NRRL), the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS), the working collections of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa, Neriman Yilmaz (NY), University of Pretoria, South Africa, the Medical Research Center (MRC) Tygerberg, Cape Town, South Africa, and Mycothèque de l’Université catholique de Louvain (MUCL), Louvain-la-Neuve, Belgium (Table 1).

Table 1

Fusarium strains used in this study.

Speciesa	Culture collectionb	GenBank accession numberc					Substrate	Country	Other collection numbers	References
		tef1	tub2	cmdA	rpb2	rpb1
F. acutatum	CBS 401.97	MW402124	MW402322	MW402458	MW402813	MW402652	Cajanus cajan	India	BBA 63520; NRRL 25731	This study
	CBS 402.97T	MW402125	MW402323	MW402459	MW402768	MW402653	Environmental	India	BBA 69580; FRC O-1117; NRRL 13309	This study
	CBS 739.97	AF160276	MW402348	AF158329	MN193883	MW402696	Environmental	India	BBA 69553; DAOM 225121; FRC O-1116; IMI 375327; NRRL 13308	Scauflaire et al. (2011), O’Donnell et al. (2000), Laraba et al. (2020)
	CBS 113964	MW401971	MW402172	–	–	–	Triticum aestivum, grains in silo	Egypt		This study
	CBS 131573	MW402037	MW402236	MW402406	MW402796	MW402565	Wheat	Iran		This study
	CBS 137545	MN533987	MN534062	MN534147	MN534228	MW402587	Human nail	Qatar		This study
	CBS 137634	MW402061	MW402260	MW402415	–	MW402588	Human nail	Pakistan		This study
	CBS 138572	MW402062	MW402261	–	–	–	Human nail	India		This study
F. agapanthi	CBS 100193	MW401959	MW402160	MW402363	MW402727	MW402491	Agapanthus praecox	New Zealand		This study
	NRRL 54463T	KU900630	KU900635	KU900611	KU900625	KU900620	Agapanthus sp.	Australia		Edwards et al. (2016)
	NRRL 54464	MN193856	KU900637	KU900613	KU900627	MW402718	Agapanthus sp.	Australia		Edwards et al. (2016), Laraba et al. (2020), this study
F. ananatum	CBS 118516T	LT996091	MN534089	MW402376	LT996137	MW402507	Ananas comosus	South Africa	MRC 8165; FCC 2986; CMW 18685	Sandoval-Denis et al. (2018a), this study
	CBS 118517	MN533988	MN534090	MN534157	MN534229	MW402508	Ananas comosus	South Africa	MRC 8166; FCC 2988; CMW 18686	This study
	CBS 118518	MW401979	MW402179	MW402377	MW402730	–	Ananas comosus	South Africa	MRC 8167; FCC 2990; CMW 18687	This study
	CBS 118519	MW401980	MW402180	MW402378	MW402731	–	Ananas comosus	South Africa	MRC 8168; FCC 2991; CMW 18688	This study
	CBS 184.29	MW402105	MW402303	MW402445	MW402809	MW402629	Ananas sativus	England	DAOM 225144; IMI 375350; NRRL 22945	This study
	CMW 28597	MW402155	MW402356	MW402483	MW402822	–	Ananas comosus	South Africa	FCC 4251	This study
	CMW 28598	MW402156	MW402357	MW402484	–	MW402708	Ananas comosus	South Africa	FCC 4252	This study
	CMW 28599	MW402157	MW402358	MW402485	MW402775	–	Ananas comosus	South Africa	FCC 4253	This study
F. andiyazi	CBS 119856	MN533989	MN534081	MN534174	MN534286	MW402523	Sorghum grain	Ethiopia	MRC 8046	This study
	CBS 119857T	MN193854	LT996113	MN534175	LT996138	MW402524	Sorghum bicolor soil debris	South Africa	FRC M-8413; MRC 6122	Laraba et al. (2020), Sandoval-Denis et al. (2018a), this study
F. annulatum	CBS 115.97	MW401973	MW402173	MW402373	MW402785	MW402503	Dianthus caryophyllus	Italy	CECT 20569	This study
	CBS 133.95	MW402040	MW402239	MW402407	MW402743	MW402568	Dianthus caryophyllus	Netherlands	PD 90/76	This study
	CBS 134.95	MW402042	MW402241	–	MW402744	MW402570	Dianthus caryophyllus	Netherlands	PD 90/214	This study
	CBS 135.95	MW402043	MW402242	MW402408	MW402745	MW402571	Dianthus caryophyllus	Netherlands	PD 90/1262 a	This study
	CBS 153.27	MW402100	MW402299	–	–	MW402621	Saccharum officinarum with pokkah boeng	Unknown		This study
	CBS 181.30	MW402102	MW402301	MW402443	–	MW402625	Zea mays	USA	MUCL 1130	This study
	CBS 189.38	MW402110	MW402308	–	–	MW402633	Unknown	India	IMI 035108; MUCL 1129	This study
	CBS 217.76	AF160280	U34416	AF158333	HM068352	–	Cattleya pseudobulb, hybrid	Germany	BBA 11341; BBA 63624; DAOM 225133; IMI 202873; IMI 375339; NRRL 22944	O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011)
	CBS 226.49	MW402116	MW402314	MW402452	–	MW402642	Gossypium seed	Unknown		This study
	CBS 258.54T	MT010994	MT011041	MT010908	MT010983	MT010944	Oryza sativa	New Caledonia	BBA 63629; IMI 202878; MUCL 8059; NRRL 13619	Yang et al. 2020
	CBS 267.93	MN534028	MN534127	MN534221	MN534267	–	Unknown	Indonesia	NRRL 22948	This study
	CBS 299.96	MW402123	MW402321	MW402457	MW402835	MW402651	Sunflower oil with garlic cloves	France	IAM 14683	This study
	CBS 531.96	MW402137	MW402337	MW402469	–	MW402684	soil	Ivory Coast	IAM 14680; NRRL 26424	This study
	CBS 533.95	MW402138	MW402338	MW402470	MW402817	–	Vanilla	Unknown		This study
	CBS 620.80	MW402144	MW402344	–	MW402838	MW402688	Sitobion avenae	England	NRRL 25054	This study
	CBS 738.97	MW402147	MW402347	–	–	–	Soil in Zea mays field	South Africa	BBA 69859; FRC M-1636; NRRL 13614	This study
	CBS 791.91	MW402152	MW402353	MW402480	MW402839	MW402705	Gladiolus	Netherlands		This study
	CBS 792.91	MW402153	MW402354	MW402481	MW402774	MW402706	Gladiolus	Netherlands		This study
	CBS 116324	MW401975	MW402175	MW402374	MW402824	MW402504	Man, eye, clinical sample	Spain		This study
	CBS 119836	MW401988	MW402188	MW402383	MW402732	–	Unknown	Unknown	MRC 8550; KSU 4853	This study
	CBS 119837	MW401989	MW402189	MW402384	–	MW402517	Corn stalk	California	FRC M-1153; MRC 2301	This study
	CBS 120996	MW402000	MW402200	MW402391	–	MW402532	Corn stalk	California	MRC 8549	This study
	CBS 121447	MW402001	MW402201	–	MW402828	MW402533	Declined grape vine	Syria		This study
	CBS 122158	MW402004	MW402204	–	MW402829	MW402536	Pinus radiata/Hylurgops palliatus	Spain		This study
	CBS 125014	MW402013	MW402213	MW402393	–	MW402544	Human	USA	IHEM 3828	This study
	CBS 125179	MW402014	MW402214	MW402394	–	–	Figs	Iran	Ep17	This study
	CBS 125180	MW402015	MW402215	–	–	MW402547	Figs	Iran	Ep4	This study
	CBS 125182	MW402016	MW402216	MW402395	–	–	Figs	Iran		This study
	CBS 125183	MW402017	MW402217	MW402396	–	MW402549	Unknown	Iran		This study
	CBS 125713	MW402018	MW402218	MW402397	MW402737	MW402550	Unknown	Unknown		This study
	CBS 125714	MW402019	MW402219	–	MW402830	MW402551	Unknown	Unknown		This study
	CBS 125716	MW402020	MW402220	MW402398	–	MW402552	Unknown	Unknown		This study
	CBS 127316	MW402021	MW402221	MW402399	MW402738	–	Unknown	Unknown		This study
	CBS 130179	MW402023	MW402223	MW402400	MW402739	MW402553	Human blood	USA	NRRL 43617; UTHSC 03-60	This study
	CBS 131191	MW402026	MW402225	–	MW402831	MW402555	Unknown	Unknown		This study
	CBS 131192	MW402027	MW402226	MW402401	–	–	Unknown	Unknown		This study
	CBS 131256	MW402028	MW402227	MW402402	MW402741	MW402556	Unknown	Unknown		This study
	CBS 131259	MW402029	MW402228	MW402403	MW402742	MW402557	Unknown	Unknown		This study
	CBS 131574	MW402038	MW402237	–	–	MW402566	Wheat	Iran	dH 22560; Z36	This study
	CBS 131581	MW402039	MW402238	–	MW402832	MW402567	Unknown	Unknown		This study
	CBS 135783	MW402052	MW402251	MW402410	–	MW402579	Wheat	Iran	Z31; dH 23109	This study
	CBS 135791	MW402054	MW402253	MW402411	MW402746	MW402581	Unknown	Unknown		This study
	CBS 137537	MW402060	MW402259	MW402414	MW402749	MW402586	Human tissue	Pakistan		This study
	CBS 139334	MW402065	MW402264	MW402417	MW402750	MW402592	Human wound	Pakistan		This study
	CBS 139739	MW402074	MW402273	MW402420	MW402754	MW402602	Xylosandrus amputatas galleries in Cinnamonum camphora branch	USA	C 3445; BPI 893134	This study
	CBS 140150	MW402077	MW402276	MW402421	MW402755	MW402605	Unknown	Unknown		This study
	CBS 140908	MN534027	MN534126	MN534220	MN534266	–	Rice, grain	Kazakhstan	MFG 58255	This study
	CBS 140914	MW402078	MW402277	MW402422	MW402805	MW402606	Wheat, grain	Russia	MFG 58489	This study
	CBS 140944	MW402079	MW402278	MW402423	MW402806	–	Wheat, grain	Russia	MFG 58380	This study
	CBS 143085	MW402084	MW402283	MW402428	–	–	Seed of Asparagus	Netherlands	NFC 1342	This study
	CBS 143087	MW402085	MW402284	MW402429	MW402756	MW402611	Seed of Asparagus	Netherlands	NFC 1355	This study
	CBS 143256	MW402086	MW402285	MW402430	MW402757	–	Unknown	Unknown		This study
	CBS 143592	MW402088	MW402287	MW402431	MW402758	MW402613	Stereum hirsutum	Iran	CPC 30839; TuPo1	This study
	CBS 143594	MW402089	MW402288	–	–	–	Stereum hirsutum	Iran	CPC 30842; TuPo5	This study
	CBS 143599	MW402090	MW402289	–	–	–	Smut	Iran	CPC 30851; MoSm7	This study
	CBS 143601	MW402091	MW402290	MW402432	MW402808	–	Smut	Iran	CPC 30853; MoSm16-1	This study
	CBS 143602	MW402092	MW402291	MW402433	MW402759	MW402614	Smut	Iran	CPC 30854; MoSm16-2	This study
	CBS 143604	MW402093	MW402292	MW402434	MW402833	–	Smut	Iran	CPC 30856; MoSm18-1	This study
	CBS 143605	MW402094	MW402293	MW402435	MW402760	MW402615	Smut	Iran	CPC 30857; MoSm18-2	This study
	NRRL 62905	MN193865	–	–	MN193893	MW402722	Zea mays kernel	USA		Laraba et al. (2020), this study
F. anthophilum	CBS 108.92	MW401965	MW402166	MW402368	MW402783	MW402498	Hippeastrum leaf	Netherlands	NRRL 25062; PD 91/2109	This study
	CBS 136.95	MW402058	MW402257	–	MW402801	MW402584	Amaryllis	Netherlands	PD 91/2109-2	This study
	CBS 119858	MN533990	MN534091	MN534158	MN534232	MW402525	Environmental	USA		This study
	CBS 119859	MN533991	MN534092	MN534164	MN534233	MW402526	Cymbidium sp. leaf spot	New Zealand		This study
	CBS 222.76ET	MW402114	MW402312	MW402451	MW402811	MW402641	Euphorbia pulcherrima stem	Germany	BBA 63270; IMI 196084; IMI 202880; NRRL 22943; NRRL 25216	This study
	CBS 737.97	MN533992	MN534093	MN534160	MN534234	MW402695	Hippeastrum sp.	Germany	NRRL 13602	This study
	NRRL 25214	MN193857	–	–	MN193885	MW402710	Hippeastrum sp.	Germany		Laraba et al. (2020)
F. awaxy	CBS 119831	MN534056	MN534108	MN534167	MN534237	MW402514	Environmental	New Guinea		This study
	CBS 119832	MN534057	MN534106	MN534170	MN534240	MW402515	Unknown	Unknown	MRC 8553; KSU 990	This study
	CBS 139380	MN534058	MN534107	MN534172	MN534238	MW402597	Corn stalk	USA	ATCC 201270; FGSC 7616	This study
	LGMF 1661	MG838954	MG839011	MK766939	–	–	Rotten stalks of Zea mays	Brazil	CMRP4003	Crous et al. (2019b)
	LGMF 1930T	MG839004	MG839013	MK766940	MK766941	–	Rotten stalks of Zea mays	Brazil	CMRP4013	Crous et al. (2019b)
	NRRL 13827	MH582309	–	–	MH582073	–	Corn cob	South Africa	NRRL 13601; MRC115	O’Donnell et al. (2018)
F. bactridioides	CBS 100057T	MN533993	MN534112	MN534173	MN534235	MW402490	Cronartium conigenum on Pinus leiophylla	USA	BBA 4748; BBA 63602; DAOM 225115; IMI 375323; NRRL 22201	This study
	NRRL 20476	AF160290	U34434	AF158343	–	–	Cronartium conigenum	USA		O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. begoniae	CBS 403.97	MN193858	U61543	MW402460	MN193886	MW402654	Begonia elatior hybrid	Germany	BBA 67781; DAOM 225116; IMI 375315; NRRL 25300	Laraba et al. (2020), O’Donnell et al. (1998)
	CBS 452.97T	MN533994	MN534101	MN534163	MN534243	MW402675	Begonia elatior hybrid	Germany	NRRL 25315; BBA 69131; IMI 376114	This study
	CBS 110282	MW401968	MW402169	–	–	–	Begonia elatior hybrid	Netherlands	NRRL 31851; PD 2001/5404	This study
	CBS 110283	MW401969	MW402170	MW402370	MW402784	MW402500	Begonia elatior hybrid	Netherlands	NRRL 31848; PD 2001/514	This study
F. brevicatenulatum	CBS 404.97T	MN533995	MN534063	–	MN534295	MW402655	Striga asiatica	Madagascar	NRRL 25446; BBA 69197; IMI 375329; DAOM 225122	This study
	CBS 100196	MN193859	–	–	MN193887	MW402492	Striga asiatica	Madagascar	BBA 69198; NRRL 25447	Laraba et al. (2020), this study
F. bulbicola	CBS 220.76T	KF466415	KF466437	MW402450	MW402767	–	Nerine bowdenii bulb	Netherlands	BBA 12293; BBA 63628; DAOM 225114; IMI 202877; IMI 375322; NRRL 13618	Proctor et al. (2013), this study
F. chinhoyiense	NRRL 25221T	MN534050	MN534082	MN534196	MN534262	MW402711	Zea mays	Zimbabwe	BBA 69031	This study
	NY 001B5	MN534051	MN534083	MN534197	MN534263	MW402725	Soil	South Africa		This study
F. circinatum	CBS 405.97T	MN533997	MN534097	MN534199	MN534252	MW402656	Pinus radiata	USA	BBA 69720; DAOM 225113; IMI 375321; MRC 7541; NRRL 25331	This study
	CBS 100197	MW401960	MW402161	MW402364	–	MW402493	Pinus taeda	Georgia	BBA 69721; NRRL 25332	This study
	CBS 117843	MW401978	MW402178	–	MW402786	MW402506	Pinus radiata	Spain		This study
	CBS 119864	MW401996	MW402196	MW402389	MW402736	MW402528	Pinus patula	South Africa	MRC 7488; FGSC 9022	This study
	CBS 119865	MW401997	MW402197	–	–	–	Pinus patula	South Africa	MRC 6213; FGSC 9023; KSU 10850	This study
	CBS 122161	MW402005	MW402205	–	–	MW402537	Pinus radiata/Brachyderes incanus	Spain		This study
	CBS 122162	MW402006	MW402206	–	–	MW402538	Pinus radiata/Hylurgops palliatus	Spain		This study
	CBS 122163	MW402007	MW402207	–	–	MW402539	Pinus radiata/Hylurgops palliatus	Spain		This study
	CBS 122164	MW402008	MW402208	–	MW402790	MW402540	Pinus radiata/Hypothenemus eruditus	Spain		This study
	CBS 122165	MW402009	MW402209	–	–	MW402541	Pinus radiata/Hylastes attenuatus	Spain	MRC 6213; FGSC 9023	This study
	CBS 122448	MW402010	MW402210	–	–	–	Pinus radiata/Hylurgops palliatus	Spain		This study
	CBS 138821	MW402063	MW402262	–	–	MW402589	Pinus sp.	USA	CMW 41611; CMWF1954	This study
	CBS 138822	MN533996	MN534096	–	MN534251	MW402590	Unknown	Unknown		This study
	CBS 141668	MW402081	MW402280	MW402425	–	MW402608	Unknown	Unknown		This study
	CBS 141670	MW402082	MW402281	MW402426	–	MW402609	Unknown	Unknown		This study
	CBS 141671	MW402083	MW402282	MW402427	MW402807	MW402610	Unknown	Unknown		This study
F. coicis	NRRL 66233T	KP083251	LT996115	LT996178	KP083274	–	Coix gasteenii	Australia		Laurence et al. (2016), Sandoval-Denis et al. (2018a)
F. concentricum	CBS 450.97T	AF160282	MW402334	MW402467	JF741086	MW402674	Musa fruit	Costa Rica (bought at Berlin market)	BBA 64354; CBS 833.85; DAOM 225146; IMI 375352; NRRL 25181	O’Donnell et al. (2000, 2012), this study
	CBS 453.97	MN533998	MN534123	MN534216	MN534264	MW402676	Musa sapientum	Guatemala	BBA 69857; NRRL 25668	This study
	CBS 102157	MW401963	MW402164	MW402367	MW402728	MW402496	Macaranga pruinosa stem, colonized by ants	Malaysia		This study
F. denticulatum	CBS 406.97	MN533999	MN534067	MN534185	MN534273	MW402657	Ipomoea batatas	Cuba	NRRL 25189; BBA 65244	This study
	CBS 407.97T	MN534000	MN534068	MN534186	MN534274	MW402658	Ipomoea batatas	USA	NRRL 25311; BBA 67772; CC F89-22; IMI 376115	This study
	CBS 735.97	AF160269	U61550	AF158322	LT996143	–	Ipomoea batatas	North Carolina	BBA 67769; DAOM 225112; IMI 375320; NRRL 25302	O’Donnell et al. (1998, 2000), Sandoval-Denis et al. (2018a)
F. dlaminii	CBS 175.88	MN534002	MN534138	MN534150	MN534256	MW402623	Zea mays soil	South Africa	NRRL 13164; FRC M-1637; ATCC 58097; BBA 69859; IMI 375348; DAOM 225120	This study
	CBS 481.94	MN534003	MN534139	MN534151	MN534257	MW402679	Unknown	Unknown		This study
	CBS 671.94	MN534004	MN534136	MN534152	MN534254	MW402690	Soil	South Africa	BBA 69046; MRC 3023	This study
	CBS 672.94	MN534005	MN534137	MN534153	MN534255	MW402691	Soil	South Africa	BBA 69047; MRC 3024	This study
	CBS 119860T	MW401995	MW402195	MW402388	KU171701	KU171681	Plant debris in soil	South Africa	BBA 69859; FRC M-1637; MRC 3032; NRRL 13164	Sandoval-Denis et al. (2018a), this study
	CBS 119861	MN534001	MN534135	MN534149	MN534253	MW402527	Plant debris in soil	South Africa	BBA 69026; FRC M-1557; MRC 3023; NRRL 25442	This study
F. ficicrescens	CBS 125177	MN534006	MN534071	MN534176	MN534281	MW402545	Environmental	Iran		This study
	CBS 125178T	KU604452	KP662896	KU603958	KT154002	MW402546	Environmental	Iran		Al-Hatmi et al. (2016b, 2019), this study
	CBS 125181	MN534007	MN534072	MN534177	MN534282	MW402548	Environmental	Iran		This study
F. fracticaudum	CMW 25245T	PDNT00000000	PDNT00000000	PDNT00000000	PDNT00000000	PDNT00000000	Pinus maximinoi	Colombia		Wingfield et al. (2018)
F. fractiflexum	NRRL 28852T	AF160288	AF160315	AF158341	LT575064	–	Cymbidium sp.	Japan		O’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. fredkrugeri	CBS 408.97	MW402126	MW402324	MW402461	MW402814	–	Soil	Maryland	BBA 69727; NRRL 25355	This study
	CBS 144209T	LT996097	LT996118	LT996181	LT996147	LT996199	Melhania acuminata rhizophere	South Africa	CPC 33747	Sandoval-Denis et al. (2018a)
	CBS 144495	LT996096	LT996117	LT996180	LT996146	LT996198	Melhania acuminata rhizophere	South Africa	CPC 33746	Sandoval-Denis et al. (2018a)
	NRRL 26152	MW402159	–	–	MW402778	MW402714	Striga hermonthica	Niger	BBA 70170	This study
F. fujikuroi	CBS 186.56	MW402108	MW402306	MW402447	MW402765	MW402632	Unknown	Unknown	ATCC 14164; BBA 11321; IMI 112801; NRRL 2284	This study
	CBS 195.34	MW402111	MW402309	–	–	MW402634	Saccharum officinarum	Taiwan		This study
	CBS 221.76T	MN534010	MN534130	–	KU604255	MW402640	Oryza sativa culm	Taiwan	BBA 12428; BBA 63630; IHEM 3821; IMI 196086; IMI 202879; LCP 58.3353; NRRL 13620; NRRL 13998; NRRL 22174	Al-Hatmi et al. (2016a), this study
	CBS 240.64	MW402117	MW402315	–	–	MW402643	Oryza sativa	Japan		This study
	CBS 257.52	MW402119	MW402317	MW402454	MW402812	MW402645	Oryza sativa seedling	Japan		This study
	CBS 262.54	MW402120	MW402318	–	–	MW402647	Oryza sativa	India	BRL 1001; IMI 058291	This study
	CBS 263.54	MW402121	MW402319	–	–	MW402648	Avena sativa	India	ATCC 10052; BRL 1004; IFO 6349; IMI 058292; NRRL 2374; QM 1224	This study
	CBS 264.54	MW402122	MW402320	MW402456	–	MW402649	Oryza sativa	Unknown	ATCC 12617; BRL 1135; IMI 058293	This study
	CBS 265.54	MN534011	MN534132	MN534222	MN534268	MW402650	Oryza sativa	Unknown	ATCC 12618; BRL 1139; IMI 058294	This study
	CBS 440.64	MW402132	MW402331	–	–	MW402670	Unknown	Japan		This study
	CBS 449.95	MW402134	MW402333	–	–	MW402672	Environmental	France		This study
	CBS 530.95	MW402135	MW402335	–	–	–	Unknown	Unknown		This study
	CBS 119854	MW401993	MW402193	–	–	–	Unknown	Unknown	BBA 63873; MRC 1836	This study
	CBS 119855	MW401994	MW402194	MW402387	MW402735	–	Environmental	Unknown	FRC M-1148; MRC 8532	This study
	CBS 121864	MW402003	MW402203	–	–	MW402535	Environmental	Netherlands	FRC M1150; MRC 8534	This study
	CBS 130402	MW402025	MN534131	MN534223	MN534269	–	Human skin	USA		This study
	NRRL 5538	MN193860	–	–	MN193888	MW402719	Unknown	Unknown		Laraba et al. (2020), this study
	NRRL 13289	MW402158	–	–	MW402777	–	Unknown	Unknown	FRC M-1138; from NRRL 6322	This study
	NRRL 13566	AF160279	U34415	AF158332	JX171570	–	Oryza sativa	China		O’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013)
F. globosum	CBS 428.97T	KF466417	MN534124	MN534218	KF466406	MW402668	Zea mays seed	South Africa	NRRL 26131	Proctor et al. (2013), this study
	CBS 429.97	MW402130	MW402329	–	–	–	Zea mays seed	South Africa	MRC 6648; NRRL 26132	This study
	CBS 430.97	MN534013	MN534125	MN534219	MN534265	–	Zea mays seed	South Africa	NRRL 26133	This study
	CBS 431.97	MW402131	MW402330	MW402465	MW402816	MW402669	Zea mays seed	South Africa	MRC 6660; NRRL 26134	This study
	CBS 120992	MW401998	MW402198	MW402390	MW402788	MW402529	Maize kernels	South Africa	FRC M-8014; MRC 6648; NRRL 26132	This study
F. guttiforme	CBS 409.97T	MT010999	MT011048	MT010901	MT010967	MT010938	Ananas comosus	Brazil	NRRL 25295; IMI 376113; BBA 69661; S1832 GJS0290	This study
	NRRL 22945	AF160297	U34420	AF158350	JX171618	JX171505	Ananas comosus	England		O’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013)
F. konzum	CBS 119847	MW401990	MW402190	MW402385	–	MW402518	Unknown	Unknown	MRC 8545	This study
	CBS 119848	MW401991	MW402191	–	–	–	Unknown	Unknown	MRC 8544	This study
	CBS 119849T	LT996098	MN534095	LT996182	MW402733	MW402519	Sorghastrum nuttans	USA	MRC 8427	Sandoval-Denis et al. (2018a), this study
	CBS 139382	MW402071	MW402270	MW402418	MW402804	MW402598	Derived from a cross of KSU 11615 and KSU 10653	Unknown	ATCC MYA-2885; FGSC 8910; KSU 11616	This study
	CBS 139383	MN534014	MN534094	MN534200	MN534244	MW402599	Derived from a cross of KSU 10653 and KSU 10595	Unknown	ATCC MYA-2884; FGSC 8911; KSU 11615	This study
F. lactis	CBS 411.97ET	MN193862	MN534077	MN534178	MN534275	MW402659	Ficus carica	USA	NRRL 25200	Laraba et al. (2020), this study
	CBS 420.97	MN534015	MN534078	MN534181	MN534296	MW402667	Ficus carica	USA	NRRL 25338; TM F13; BBA 68591	This study
F. longicornicola	NRRL 52706T	JF740788	MW402360	MW402487	JF741114	–	Insect	Ethiopia	CBS 147247; ARSEF 6455	O’Donnell et al. (2012), this study
	NRRL 52712	JF740794	MW402361	MW402488	JF741120	MW402716	Insect	Ethiopia	CBS 147248; ARSEF 6451	O’Donnell et al. (2012), this study
	NRRL 52713	JF740795	MW402362	MW402489	JF741121	MW402717	Insect	Ethiopia	CBS 147249; ARSEF 6446	O’Donnell et al. (2012), this study
F. lumajangense	InaCCF872T	LS479441	LS479433	–	LS479850	–	Musa sp. var. Pisang Raja Nangka	Indonesia		Maryani et al. (2019a)
	InaCCF993	LS479442	LS479434	–	LS479851	–	Musa acuminata var. Pisang Mas Kirana	Indonesia		Maryani et al. (2019a)
F. madaense	CBS 146648	MW402095	MW402294	MW402436	MW402761	MW402616	Arachis hypogaea	Nigeria	CPC 38321	This study
	CBS 146651	MW402096	MW402295	MW402437	MW402762	MW402617	Sorghum	Nigeria	CPC 38324	This study
	CBS 146656	MW402097	MW402296	MW402438	MW402763	MW402618	Arachis hypogaea	Nigeria	CPC 38330	This study
	CBS 146669T	MW402098	MW402297	MW402439	MW402764	MW402619	Arachis hypogaea	Nigeria	CPC 38344	This study
F. mangiferae	CBS 119853	MN534016	MN534140	MN534225	MN534270	MW402522	Mango with malformation disease	South Africa	MRC 2730	This study
	CBS 120994T	MN534017	MN534128	MN534224	MN534271	MW402530	Mango with malformation disease	Israel	MRC 7559; MRC 8432	This study
	NRRL 25226	AF160281	U61561	AF158334	HM068353	MW402712	Mangifera indica	Israel		O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011)
F. marasasianum	CMW 25512	Unpublished	Unpublished	Unpublished	Unpublished	Unpublished	Pinus tecunumanii	Colombia		Unpublished
F. mexicanum	NRRL 47473	GU737416	GU737308	GU737389	LR792615	LR792579	Mangifera indica inflorescence	Mexico		Otero-Colina et al. (2010)
	NRRL 53145	GU737280	GU737492	–	–	–	Unknown	Unknown		Otero-Colina et al. (2010)
	NRRL 53147T	GU737282	GU737494	–	MN724973	MG838088	Mangifera indica	Mexico		Otero-Colina et al. (2010), Santillán-Mendoza et al. (2018)
	NRRL 53571	GU737420	GU737312	GU737393	–	–	Mangifera indica	Mexico		Otero-Colina et al. (2010)
	NRRL 53575	GU737286	GU737498	–	–	–	Mangifera indica	Mexico		Otero-Colina et al. (2010)
	NRRL 53580	GU737421	GU737313	GU737394	–	–	Mangifera indica	Mexico		Otero-Colina et al. (2010)
F. mundagurra	RGB5717T	KP083256	MN534146	MN534214	KP083276	–	Soil	Australia	NRRL 66235	Laurence et al. (2016), this study
F. musae	CBS 624.87T	FN552086	FN545368	MW402474	MW402772	MW402689	Musa sapientum fruit	Honduras	NRRL 25059	Van Hove et al. (2011), this study
	CBS 115315	MW401974	MW402174	–	–	–	Man, Tinea corporis	Greece	EMD 13	This study
	NRRL 28893	FN552092	FN545374	FN552070	FN552114	–	Musa sp.	Mexico		Van Hove et al. (2011)
F. napiforme	CBS 674.94	MW402145	MW402345	MW402475	–	MW402692	Unknown	Unknown	BBA 67630	This study
	CBS 748.97T	MN193863	MN534085	MN534192	MN534291	MW402701	Pennisetum typhoides	Namibia	NRRL 13604	Laraba et al. (2020), this study
	CBS 135139	MN534019	MN534084	MN534183	MN534290	MW402572	Keratitis (Human)	India		This study
	CBS 135140	MW402044	MW402243	–	–	–	Clinical (keratitis)	India		This study
	CBS 135141	MW402045	MW402244	–	MW402797	MW402573	Clinical	Unknown		This study
	NRRL 25196	MN193863	–	–	MN193891	MW402709	Pennisetum typhoides	South Africa	BBA 67629; FRC M-3560	Laraba et al. (2020)
F. nirenbergiae	CBS 744.97	AF160312	U34424	AF158365	LT575065	–	Unknown	Unknown		O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. nygamai	CBS 140.95	MW402075	MW402274	–	EF470127	MW402603	Human, immunocompromised blood	Egypt	NRRL 26421	O’Donnell et al. (2007), this study
	CBS 413.97	MW402127	MW402325	MW402462	MW402815	MW402660	Oryza sativa	Morocco	BBA 63175; NRRL 25449	This study
	CBS 572.94	MW402141	MW402341	MW402473	MW402819	–	Cajanus indicus	India	BBA 64375	This study
	CBS 749.97T	MW402151	MW402352	MW402479	EF470114	MW402703	Sorghum bicolor necrotic root	New South Wales	ATCC 58555; BBA 69862; DAOM 225148; FRC M-1375; IMI 375354; NRRL 13448	O’Donnell et al. (2007), this study
	CBS 834.85	MW402154	MW402355	MW402482	MW402821	MW402707	Cajanus cajan	India	BBA 64375; NRRL 22106; NRRL 25312	This study
	CBS 119852	MW401992	MW402192	MW402386	MW402734	MW402521	Unknown	Unknown	MRC 8547	This study
	CBS 120995	MW401999	MW402199	–	–	MW402531	Sorghum root	Australia	MRC 8546	This study
	CBS 131377	MW402035	MW402234	MW402405	–	MW402562	Environmental	Australia		This study
	CBS 139386	MW402072	MW402271	–	–	MW402600	Unknown	Unknown	FGSC 8933; FRC M-7491	This study
	CBS 139387	MW402073	MW402272	MW402419	MW402753	MW402601	Unknown	Unknown	FGSC 8934; FRC M-7492	This study
F. ophioides	CBS 118509	–	MN534116	MN534207	MN534297	–	Phragmites mauritianus	South Africa	CMW 18678; MRC 6748; FCC 1092	This study
	CBS 118510	MN534020	MN534121	MN534201	MN534301	–	Panicum maximum	South Africa	CMW18679; MRC 6747; FCC 1093	This study
	CBS 118511	MN534021	MN534122	MN534204	MN534299	–	Panicum maximum	South Africa		This study
	CBS 118512T	MN534022	MN534118	MN534209	MN534303	–	Panicum maximum	South Africa	CMW 18681; FCC 2979; FCC 2980; MRC 6744	This study
	CBS 118513	MN534023	MN534119	MN534202	MN534300	–	Panicum maximum	South Africa		This study
	CBS 118514	MN534024	MN534117	MN534206	MN534302	–	Panicum maximum	South Africa		This study
	CBS 118515	MN534025	MN534120	MN534205	MN534298	–	Panicum maximum	South Africa		This study
	NRRL 26756	AF160307	AF160322	AF158360	–	–	Ornamental grass	South Africa		O’Donnell et al. (2000)
	NRRL 26757	AF160308	AF160323	AF158361	–	–	Ornamental reed	South Africa		O’Donnell et al. (2000)
F. parvisorum	CMW 25267T	KJ541060	KJ541055	–	–	–	Pinus patula	Colombia	CBS 137236; FCC 5407	Herron et al. (2015)
F. phyllophilum	CBS 216.76T	MN193864	KF466443	KF466333	KF466410	MW402637	Dracaena deremensis leaf	Italy	BBA 11730; BBA 63625; DAOM 225132; IMI 202874; IMI 375338; NRRL 13617	Laraba et al. (2020), Proctor et al. (2013)
	CBS 246.61	MW402118	MW402316	MW402453	–	MW402644	Leaf spot in Sansevieria dooneri	Germany	BBA 7983; NRRL 25053	This study
F. pilosicola	NRRL 29123	MN534054	MN534098	MN534165	MN534247	–	Bidens pilosa	USA		This study
	NRRL 29124T	MN534055	MN534099	MN534159	MN534248	–	Bidens pilosa	USA		This study
F. pininemorale	CMW 25243	NFZR00000000	NFZR00000000	NFZR00000000	NFZR00000000	NFZR00000000	Pinus tecunumanii	Colombia		Wingfield et al. (2017)
F. proliferatum	CBS 480.96ET	MN534059	MN534129	MN534217	MN534272	–	Tropical rain forest soil	Papua New Guinea	NRRL 26427; IAM 14682; NY007.B6	This study
F. pseudoanthophilum	CBS 414.97T	MW402128	MW402326	MW402463	–	MW402661	Zea mays	Zimbabwe	BBA 69002; IMI 376112; NRRL 25211	This study
	CBS 415.97	MW402129	MW402327	–	–	MW402662	Zea mays	Zimbabwe	BBA 69003; NRRL 25209	This study
	CBS 745.97	MW402148	MW402349	MW402476	MW402820	MW402697	Zea mays	Zimbabwe	BBA 69030; DAOM 225134; IMI 375340; NRRL 25206	This study
	CBS 746.97	MW402149	MW402350	MW402477	–	MW402698	Zea mays	Zimbabwe	BBA 70129; IMI 375341; NRRL 26063	This study
F. pseudocircinatum	CBS 449.97T	AF160271	MN534069	MN534190	MN534277	MW402673	Solanum sp.	Ghana	NRRL 22946; CBS 126.73; IMI 375316; BBA 69636; DAOM 225117	O’Donnell et al. (2000), this study
	CBS 455.97	MN534029	MN534070	MN534184	MN534276	–	Heteropsylla incisa	Papua New Guinea	NRRL 25034; ARSEF 2301; FRC M-3856; BBA 69598	This study
	NRRL 36939	MN193866	–	–	MW402779	MW402715	Unknown	Unknown		This study
F. pseudonygamai	CBS 416.97	MN534030	MN534064	MN534194	MN534283	MW402663	Pennisetum typhoides	Nigeria	NRRL 6022; BBA 69551; MRC 1412	This study
	CBS 417.97T	AF160263	MN534066	AF158316	MN534285	MW402664	Pennisetum typhoides	Nigeria	NRRL 13592; FRC M-1166; BBA 69552; IMI 375342; DAOM 225136	O’Donnell et al. (2000), this study
	CBS 484.94	MN534031	MN534065	MN534195	MN534284	MW402681	Soil	Australia	FRC M-1034	This study
F. ramigenum	CBS 418.97T	KF466423	MN534145	MN534187	KF466412	MW402665	Ficus carica	USA	NRRL 25208	Proctor et al. (2013), this study
	CBS 526.97	MN534032	MN534086	MN534188	MN534292	MW402682	Ficus carica	USA	NRRL 25212; BBA 68593; TM F62	This study
F. sacchari	CBS 134.73	MW402041	MW402240	–	–	MW402569	Saccharum officinarum	Guyana	ATCC 24390; IMI 165537a; NRRL 25061	This study
	CBS 147.25	MW402099	MW402298	MW402440	–	MW402620	Unknown	Unknown	BBA 69863; DAOM 225140; IMI 375345; NRRL 20471	This study
	CBS 183.32	MW402104	MW402302	–	–	MW402628	Saccharum officinarum	Unknown		This study
	CBS 185.33	MW402106	MW402304	–	–	MW402630	Saccharum officinarum	India		This study
	CBS 186.33	MW402107	MW402305	MW402446	–	MW402631	Saccharum officinarum with pokkah boeng red stripes	Unknown		This study
	CBS 201.37	MW402112	MW402310	–	–	MW402635	Unknown	Unknown		This study
	CBS 223.76ET	MW402115	MW402313	AF158331	JX171580	–	Saccharum officinarum	India	BBA 63340; DAOM 225138; IMI 202881; NRRL 13999	O’Donnell et al. (2000, 2013), this study
	CBS 119828	MW401984	MW402184	–	–	MW402513	Unknown	Unknown	MRC 8551	This study
	CBS 119829	MW401985	MW402185	–	–	–	Unknown	Unknown	FRC M-3127; MRC 8447; NRRL 20957	This study
	CBS 119830	MW401986	MW402186	MW402381	–	–	Unknown	Unknown	MRC 8552	This study
	CBS 121683	MW402002	MW402202	–	MW402789	MW402534	Man, fungal endophthalmyitis of male patient	India		This study
	CBS 131369	MW402030	MW402229	–	MW402792	–	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 131370	MW402031	MW402230	MW402404	MW402793	MW402558	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 131371	MW402032	MW402231	–	–	MW402559	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 131372	MN534033	MN534134	MN534226	MN534293	MW402560	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 131373	MW402033	MW402232	–	MW402794	MW402561	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 131374	MW402034	MW402233	–	MW402795	–	Oryzae australiensis, stem, first node above soil	Australia		This study
	CBS 135142	MW402046	MW402245	–	MW402798	–	Clinical (corneal ulcer)	India		This study
	CBS 135143	MW402047	MW402246	MW402409	MW402799	–	Clinical (corneal ulcer)	India		This study
	CBS 135144	MW402048	MW402247	–	–	MW402574	Clinical (corneal ulcer)	India		This study
	CBS 135145	MW402049	MW402248	–	–	–	Clinical (corneal ulcer)	India		This study
	CBS 139373	MW402066	MW402265	–	MW402751	MW402593	Unknown	Unknown		This study
	CBS 139376	MW402069	MW402268	–	MW402803	MW402596	lab strain: progeny of ATCC 201262 and ATCC 201263	USA	ATCC 201264; FGSC 7610	This study
	CBS 139377	MW402070	MW402269	–	–	–	lab strain: progeny of ATCC 201262 and ATCC 201263	USA	ATCC 201265; FGSC 7611	This study
	InaCC F950	–	LS479435	–	LS479852	–	Musa sp. var. Pisang Kepok	Indonesia		Maryani et al. (2019a)
	InaCC F951	–	LS479437	–	LS479854	–	Musa sp. var. Pisang Kepok	Indonesia		Maryani et al. (2019a)
	InaCC F952	–	LS479436	–	LS479853	–	Musa sp. var. Pisang Kepok	Indonesia		Maryani et al. (2019a)
	NRRL 66326	MN193868	–	–	MN193896	MW402723	Unknown	Unknown		Laraba et al. (2020), this study
	NY 001E9	MN534034	MN534133	MN534227	MN534294	MW402726	Organic banana	South Africa		This study
F. secorum	NRRL 62593T	KJ189225	–	KJ189235	–	–	Beta vulgaris	USA		Secor et al. (2014)
	NRRL 62594	KJ189228	–	KJ189238	–	–	Beta vulgaris	USA		Secor et al. (2014)
F. siculi	CBS 142222T	LT746214	LT746346	LT746189	LT746327	–	Citrus sinensis	Italy	CPC 27188	Sandoval-Denis et al. (2018b)
	CPC 27189	LT746215	LT746347	LT746190	LT746328	–	Citrus sinensis	Italy		Sandoval-Denis et al. (2018b)
F. sororula	CMW 25513	Unpublished	Unpublished	Unpublished	Unpublished	Unpublished	Pinus tecunumanii	Colombia		Unpublished
F. sterilihyposum	NRRL 25623T	MN193869	AF160316	AF158353	MN193897	MW402713	Mango	South Africa		O’Donnell et al. (2000), Laraba et al. (2020)
	NRRL 53991	GU737413	GU737305	GU737386	–	–	Mangifera indica	Brazil	CML 282; KSU 16215	Otero-Colina et al. (2010)
	NRRL 53997	GU737414	GU737306	GU737387	–	–	Mangifera indica	Brazil	CML 401; KSU 16240	Otero-Colina et al. (2010)
	NRRL 54011	GU737415	GU737307	GU737388	–	–	Unknown	Unknown		Otero-Colina et al. (2010)
F. subglutinans	CBS 215.76	MN534061	MN534109	MN534171	MN534241	MW402636	Zea mays	Germany	NRRL 20844; BBA 10351; BBA 62621	This study
	CBS 479.94	MN534036	MN534105	MN534105	MN534236	MW402678	Zea mays kernel	South Africa	MRC 5655	This study
	CBS 536.95	MW402139	MW402339	MW402471	MW402836	MW402685	Unknown	Unknown		This study
	CBS 747.97NT	MW402150	MW402351	MW402478	MW402773	MW402700	Zea mays	Illinois	BBA 62451; DAOM 225141; FRC M-36; MRC 8554; NRRL 22016; NRRL 22114	This study
	CBS 136481	MW402059	MW402258	MW402413	MW402748	MW402585	Human blood	Italy	NRRL 54158; IUM 96-4102	This study
	NRRL 66333	MN193870	–	–	MN193898	–	Unknown	Unknown		Laraba et al. (2020)
F. succisae	CBS 187.34	MW402109	MW402307	MW402448	MW402810	–	Zostera marina	UK	NRRL 22942	This study
	CBS 219.76ET	AF160291	U34419	AF158344	MW402766	MW402639	Succisa pratensis flower	Germany	BBA 12287; BBA 63627; DAOM 225142; IMI 202876; NRRL 13613	O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), this study
F. sudanense	CBS 454.97T	MN534037	MN534073	MN534179	MN534278	MW402677	Striga hermonthica	Sudan	NRRL 25451	This study
	CBS 675.94	MN534038	MN534074	MN534182	MN534279	MW402693	Striga hermonthica	Sudan	BBA 65862	This study
F. temperatum	CBS 135538	MN534039	MN534111	MN534168	MN534239	MW402575	Pulmonary infection (Human)	Mexico		This study
	CBS 135539	MN534040	MN534110	MN534169	MN534242	MW402576	Pulmonary infection (Human)	Mexico		This study
	CBS 135540	MW402050	MW402249	–	–	MW402577	Human, mycotic keratitis	Mexico		This study
	CBS 135541	MW402051	MW402250	–	–	MW402578	Human, keratitis	Mexico		This study
	MUCL 52463T	–	MW402359	MW402486	MW402776	–	Zea mays	Belgium		This study
	NRRL 25622	AF160301	AF160317	AF158354	LT970765	–	Zea mays	South Africa	NRRL 26616; MUCL 51714	O’Donnell et al. (2000)
F. terricola	CBS 483.94T	MN534042	MN534076	MN534189	LT996156	MW402680	Soil	Australia		Sandoval-Denis et al. (2018a), this study
	CBS 119850	MN534041	MN534075	MN534180	MN534280	MW402520	Soil	Australia		This study
F. thapsinum	CBS 539.79	MW402140	MW402340	MW402472	MW402818	MW402686	Man, white grained mycetoma	Italy	CDC B-2671a	This study
	CBS 733.97	MN534043	MN534079	MN534191	JX171600	–	Sorghum bicolor	South Africa	NRRL 22045	O’Donnell et al. (2013), this study
	CBS 776.96T	MN534044	MN534080	–	MN534289	MW402704	Unknown	Unknown	ATCC 200521; BBA 69583; FGSC 7056; FRC M-6563; NRRL 22049	This study
	CBS 100312	MW401961	MW402162	MW402365	MW402780	MW402494	Unknown	Unknown	ATCC 16263	This study
	CBS 100313	MW401962	MW402163	MW402366	MW402781	MW402495	Contaminant of CBS 100310	Unknown		This study
	CBS 109077	MW401967	MW402168	MW402369	–	MW402499	Sorghum seeds	Ethiopia		This study
	CBS 113963	MW401970	MW402171	MW402371	–	MW402501	Pennisetum	Yemen		This study
	CBS 119833	MW401987	MW402187	MW402382	MW402787	MW402516	Environmental	USA	BBA 70187; FRC M-6564; MRC 8558	This study
	CBS 130176	MW402022	MW402222	–	–	–	Human mycetoma	Italy	NRRL 25229; IMI 240460	This study
	CBS 135920	MW402056	MW402255	–	–	MW402582	Unknown	Unknown		This study
	CBS 135921	MW402057	MW402256	MW402412	MW402800	MW402583	Black biofilm, sink drain	Germany		This study
F. tjaetaba	NRRL 66243T	KP083263	GU737296	LT996187	KP083275	–	Sorghum interjectum	Australia		Otero-Colina et al. (2010), Laurence et al. (2016), Sandoval-Denis et al. (2018a)
F. tupiense	CML345	DQ452861	DQ445783	–	–	–	Mangifera indica	Brazil	KSU 16217; CMM 3656; CMR-UB 22069; BPI 883545	Lima et al. (2012)
	NRRL 53984T	GU737404	GU737296	GU737377	LR792619	LR792583	Mangifera indica	Brazil	CML 262; KSU 16195; CMM 3655	Otero-Colina et al. (2010)
	NRRL 53996	DQ452860	DQ445782	–	–	–	Mangifera indica	Brazil	CML 389; KSU 16233; NRRL 53996; CMM 3657; CMR-UB 22070; BPI 883544	Lima et al. (2012)
F. udum	CBS 178.32	AF160275	U34433	MW402442	LT996172	MW402624	Unknown	Netherlands	BBA 1813; DAOM 225111; IMI 375319; NRRL 22949	O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a), this study
	CBS 419.97	–	MW402328	MW402464	MW402769	MW402666	Crotolaria juncea	India	BBA 65056; NRRL 25192	This study
	CBS 747.79	MN193872	MN534141	MN534154	MN534258	MW402699	Cajanus cajan	India	BBA 62451; NRRL 25194	Laraba et al. (2020), this study
	NRRL 25199ET	KY498862	KY498892	–	KY498875	–	Cajanus cajan	India	BBA 65058	Pfenning et al. (2019)
F. verticillioides	CBS 117.28	MW401977	MW402177	–	MW402729	MW402505	Unknown	France	MUCL 29451; CBS H-9165	This study
	CBS 125.73	MW402012	MW402212	MW402392	MW402791	MW402543	Trichosanthes dioica	India	ATCC 24378; IMI 158047; NRRL 25057	This study
	CBS 139.40	MW402064	MW402263	MW402416	–	MW402591	Phyllocactus hybridus	Italy	NRRL 25056	This study
	CBS 141.59	MW402080	MW402279	MW402424	–	MW402607	Unknown	Unknown		This study
	CBS 167.87	MW402101	MW402300	MW402441	MW402834	MW402622	Pinus seed	USA	NRRL 25058	This study
	CBS 181.31	MW402103	–	MW402444	–	MW402626	Musa sapientum	Central America	NRRL 29294	This study
	CBS 218.76ET	MW402113	MW402311	MW402449	–	MW402638	Zea mays stem	Germany	BBA 11782; DSM 62264; IMI 202875; NRRL 13993	This study
	CBS 447.95	MW402133	MW402332	MW402466	MW402770	MW402671	Asparagus	Unknown		This study
	CBS 531.95	MW402136	MW402336	MW402468	MW402771	MW402683	Zea mays	Unknown		This study
	CBS 576.78	MW402142	MW402342	–	–	MW402687	Mycophilic	USSR	NRRL 22950; VKM F-257	This study
	CBS 579.78	MW402143	MW402343	–	MW402837	–	Human	USA	NRRL 25055	This study
	CBS 734.97	MW402146	MW402346	AF158315	EF470122	MW402694	Zea mays	Germany	BBA 62264; IMI 375318; NRRL 22172	O’Donnell et al. (2000, 2007), this study
	CBS 102699	MW401964	MW402165	–	MW402782	MW402497	Abdominal drain (liver transplant)	Germany		This study
	CBS 108922	MW401966	MW402167	–	MW402823	–	Human, urine	Germany		This study
	CBS 114759	MW401972	–	MW402372	–	MW402502	Unknown	Unknown		This study
	CBS 116665	MW401976	MW402176	MW402375	MW402825	–	Tomato	Unknown		This study
	CBS 119664	MW401981	MW402181	MW402379	–	MW402509	Maize/Corn (Baxxita), Husk	Switzerland		This study
	CBS 119825	MW401982	MW402182	MW402380	MW402826	MW402510	Maize kernels	South Africa	FRC M-1325; MRC 826; NRRL 20960	This study
	CBS 119826	MW401983	MW402183	–	MW402827	MW402511	Unknown	Unknown	MRC 8559	This study
	CBS 119827	MN534046	MN534087	MN534215	MN534287	MW402512	Unknown	Unknown	MRC 8560	This study
	CBS 123670	MW402011	MW402211	–	MN193901	MW402542	Zea mays	USA	FRC M-3125; NRRL 20956	Laraba et al. (2020), this study
	CBS 130180	MW402024	MW402224	–	MW402740	MW402554	Human peritoneal fluid	USA	NRRL 43608; UTHSC 03-2552	This study
	CBS 131389	MN534047	MN534088	MN534193	MN534288	MW402563	Environmental	Australia		This study
	CBS 131390	MW402036	MW402235	–	–	MW402564	Wheat root	Australia		This study
	CBS 135790	MW402053	MW402252	–	–	MW402580	Unknown	Unknown		This study
	CBS 135792	MW402055	MW402254	–	MW402747	–	Unknown	Unknown		This study
	CBS 139374	MW402067	MW402266	–	MW402752	MW402594	Unknown	Unknown	MPMI 8(1) 74-84; FGSC 7600	This study
	CBS 139375	MW402068	MW402267	–	MW402802	MW402595	Corn stalk	USA	ATCC 201261; FGSC 7603	This study
	CBS 140031	MW402076	MW402275	–	–	MW402604	Unknown	Unknown		This study
	CBS 143257	MW402087	MW402286	–	–	MW402612	Unknown	Unknown		This study
F. volatile	CBS 143874T	LR596007	LR596008	MK984595	LR596006	–	Human bronchoalveolar lavage fluid	French Guiana		Al-Hatmi et al. (2019)
	NRRL 25615	AF160304	AF160320	AF158357	–	–	Oryza sativa seed	Nigeria		O’Donnell et al. (2000)
F. werrikimbe	CBS 125535T	–	MN534104	MN534203	MN534304	–	Sorghum leiocladum	Australia	F19361	This study
F. xylarioides	CBS 258.52T	MN193874	AY707118	MW402455	HM068355	MW402646	Coffea trunk	Ivory Coast	NRRL 25486	Geiser et al. (2005), Smith et al. (2011), Laraba et al. (2020)
	CBS 749.79	MN534049	MN534143	AF158326	MN534259	MW402702	Coffea canephora	Guinea	L-102; BBA 62721; NRRL 25804	O’Donnell et al. (2000), this study
F. xyrophilum	NRRL 62710	MN193875	–	–	MN193903	MW402720	Xyris spp.	Guyana		Laraba et al. (2020), this study
	NRRL 62721T	MN193877	–	–	MN193905	MW402721	Xyris spp.	Guyana		Laraba et al. (2020), this study
	NRRL 66890	MN193876	–	–	MN193904	MW402724	Xyris spp.	Guyana		Laraba et al. (2020), this study

a The new species names, described in this study are in bold.

b Abbreviations for the culture collections: the U.S. Agricultural Research Service culture collection (NRRL); the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS); the working collection of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa; the working collection of the author Neriman Yilmaz (NY), University of Pretoria, South Africa; Medical Research Center (MRC) Tygerberg, Cape Town, South Africa; (BBA) Julius Kühn-Institute, Institute for Epidemiology and Pathogen Diagnostics, Berlin & Braunschweig, Germany; F (University of Sydney) Sydney, New South Wales, Australia.

c The sequences deposited to GenBank in this study are in bold.

T Ex-type specimen.

ET Ex-epitype specimen.

NT Ex-neotype specimen.

DNA extraction, PCR and sequencing

Genomic DNA was extracted from 7-d-old fungal cultures, grown on potato dextrose agar (PDA; recipe in Crous et al. 2019a) and incubated at 25 °C, using the Prepman Ultra Sample Preparation Reagent (Thermo Fisher Scientific, Waltham, Massachusetts) following the manufacturer’s instructions. Five loci, namely partial sequences of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase second largest subunit (rpb2) gene regions were amplified and sequenced in both directions using a Bio-Rad iCycler (Bio-Rad, California, USA). Primer pairs and PCR amplification protocols are listed in Table 2. A PCR reaction mixture of 25 μL consisted of 2.5 μL 10× PCR reaction buffer, 2.5 mM MgCl2, 200 μM of each dNTP, 0.8 μM of each primer (forward and reverse), 1 U FastStart Taq DNA Polymerase (Roche, Basel, Switzerland) and 20–50 ng of genomic DNA. Resulting PCR products were separated using 2 % agarose gel electrophoresis, and gels were stained with GelRed (Biotium, Inc., California, USA) and examined under UV light. Amplified fragments were purified using the ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific, Massachusetts, USA). These were sequenced in both directions using the BigDye terminator sequencing kit v. 3.1 (Applied Biosystems, Forster City, California) employing the same primers used for PCR amplification. Reactions were analysed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems). Contigs were assembled and edited in Geneious Prime v. 2019.0.4 (BioMatters Ltd., Auckland, New Zealand). Newly generated sequences were submitted to GenBank, with accession numbers provided in Table 1.

Table 2

Primer pairs, PCR amplification procedures and references used in this study.

Locus	Primer	PCR amplification procedures		References
		Name	Sequence (5′-3′)*
tef1	EF1	ATGGGTAAGGARGACAAGAC	95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak	O’Donnell et al. (1998)
	EF2	GGARGTACCAGTSATCATG		O’Donnell et al. (1998)
cmdA	CL1	GARTWCAAGGAGGCCTTCTC	94 °C 90 s; 35 cycles of 94 °C 45 s, 50 °C 45 s, 72 °C 1 min; 72 °C 10 min; 10 °C soak	O’Donnell et al. (2000)
	CL2A	TTTTTGCATCATGAGTTGGAC		O’Donnell et al. (2000)
rpb1	Fa	CAYAARGARTCYATGATGGGWC	94 °C 90 s; 5 cycles of 94 °C 45 s, 54 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 53 °C 45 s, 72 °C 2 min;	Hofstetter et al. (2007)
	R8	CAATGAGACCTTCTCGACCAGC	35 cycles of 94 °C 45 s, 52 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak	O’Donnell et al. (2010)
	F8	TTCTTCCACGCCATGGCTGGTCG	94 °C 90 s; 5 cycles of 94 °C 45 s, 56 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 55 °C 45 s, 72 °C 2 min;	O’Donnell et al. (2010)
	G2R	GTCATYTGDGTDGCDGGYTCDCC	35 cycles of 94 °C 45 s, 54 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak	O’Donnell et al. (2010)
rpb2	5F2	GGGGWGAYCAGAAGAAGGC	95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak	Reeb et al. (2004)
	7Cr	CCCATRGCTTGYTTRCCCAT		Liu et al. (1999)
	7Cf	ATGGGYAARCAAGCYATGGG	95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak	Liu et al. (1999)
	11ar	GCRTGGATCTTRTCRTCSACC		Liu et al. (1999)
tub2	T1	AACATGCGTGAGATTGTAAGT	95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak	O’Donnell & Cigelnik (1997)
	T2	TAGTGACCCTTGGCCCAGTTG		O’Donnell & Cigelnik (1997)

* R = A or G; S = C or G; W = A or T; Y = C or T.

Phylogenetic analyses

Gene sequences of novel species were compared to reference sequences available on the Fusarium-MLST (https://fusarium.mycobank.org), Fusarium-ID (Geiser et al. 2004) and NCBIs GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi) databases. Based on these comparisons, sequences of relevant Fusarium species/isolates were retrieved (Table 1), contigs were assembled and edited in Geneious Prime v. 2019.2.1 (BioMatters Ltd., Auckland, New Zealand). All datasets were aligned using MAFFT v. 7.427 (Katoh & Standley 2013) selecting the G-INS-I option and, where needed, manually adjusted in Geneious Prime v. 2019.2.1. Phylogenies were calculated for each gene, followed by a concatenated dataset of the five genes (each gene region was treated as separate partitions) and were subsequently analysed using Maximum Likelihood (ML). ML trees were calculated in IQtree v. 2.1.2 (Nguyen et al. 2015) with the most suitable model for each gene and/or partition calculated using Modelfinder (Kalyaanamoorthy et al. 2017) and ultrafast bootstrapping done using UFBoot2 (Hoang et al. 2018), both integrated into IQtree. Bayesian Inference analyses were performed using MrBayes v. 3.2.7 (Ronquist et al. 2012). The most suitable model for each dataset or partition was selected based on the Akaike information criterion (Akaike 1974) using MrModeltest v. 2.4 (Nylander 2004). Trees were visualized in Figtree v. 1.4.4 (https://github.com/rambaut/figtree/releases) and visually edited in Affinity Publisher v. 1.7.1 (Serif (Europe) Ltd, Nottingham, UK). Furthermore, two node-specific concordance factors, the gene concordance factor (gCF) and the site concordance factor (sCF), were calculated as implemented in IQ-TREE v. 2.1.2 (Nguyen et al. 2015, Minh et al. 2020a, b).

Morphology

Fusarium species were characterised and described using macro- and micromorphological features as defined previously (Leslie & Summerell 2006, Aoki et al. 2013, Sandoval-Denis et al. 2018a, b, 2019). Colony morphology, production of pigments and odours were documented on PDA after incubation for 7 d at 25 °C in darkness, under continuous fluorescent light and using a 12/12 h cool fluorescent light/dark cycle. Colony growth rates were also determined on PDA by inoculating overgrown 5 mm agar blocks, obtained from 7-d-old cultures growing on synthetic nutrient poor agar (SNA; Nirenberg 1976) and incubated at 10–35 °C with 5 °C intervals in darkness. Colonies were measured daily over a 7-d-period in four perpendicular directions. Colony morphologies were captured with a Sony NEX-5N camera. Unless otherwise noted, micromorphological observations were made using water as mounting medium from fungal structures grown on carnation leaf agar (CLA; Fisher et al. 1982), incubated at 25 °C under a 12/12 h near-ultraviolet light (nuv)/dark cycle (Fisher et al. 1982, Leslie & Summerell 2006). Colony colour codes were determined following the protocols of Kornerup & Wanscher (1967). All measurements and images were taken using a Nikon Eclipse Ni compound and SMZ18 dissecting microscopes (Nikon, Japan), equipped with a Nikon DS-Ri camera using the NIS-Elements BR imaging software. Up to 50 measurements were made for the conidia and other morphological structures where these were available and maximum – minimum values with averages were determined. Photographic plates were prepared in Affinity Photo v. 1.7.3 (Serif (Europe) Ltd, Nottingham, UK).

RESULTS

Phylogeny

A multigene phylogeny was used to reveal the identities of the isolates studied (Fig. 1). The alignment contained 364 taxa and was 5 359 bp long including the gaps (tef1: 1–677; rpb2: 678–2 405; rpb1: 2 406–4 015; tub2: 4 016–4 613; cmdA: 4 614–5 359). The most appropriate substitution models for each partition were TIM2e+G4 for tef1, TIM2e+I+G4 for rpb2 and TNe+G4 for rpb1, tub2 and cmdA. All trees were rooted to F. nirenbergiae (CBS 744.97) (Fig. 1, Fig. S1–S5). In addition, individual gene phylogenies were generated to assess genealogical concordance of the novel species of FFSC (Fig. S1–S5). Genealogical concordance analyses subsequently confirmed the distinctiveness of the three novel species described in this study. Similar to the results shown by Sandoval-Denis et al. (2018b), the African clade was resolved as polyphyletic, consisting of two distinct and highly supported lineages. The core African clade (clade A) encompassed 31 phylogenetically distinct species, which also included two novel lineages (Fig. 1c–e). The African Clade B consisted of two species, namely F. dlaminii and the recently described F. fredkrugeri (Sandoval-Denis et al. 2018b) (Fig. 1). The other novel lineage resolved in this study, F. pilosicola sp. nov., clustered in the American (Fig. 1) clade.

Fig. 1

Combined phylogeny of the tef1, rpb2, rpb1, tub2 and cmdA gene regions of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Numbers at the branches indicate support values (bootstrap|gCF|sCF) above 80 %. T =.Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25), bIsolates previously described as F. desaboruense (Maryani et al. 2019b).

Taxonomy

In this section, Latin binomials are provided for the three novel phylospecies resolved in this study, namely F. chinhoyiense, F. longicornicola and F. pilosicola spp. nov. In addition, epitypes are designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides. Fusarium acutatum and F. ophioides are validated. Furthermore, a neotype is designated for F. subglutinans and an emended description provided for F. annulatum.

Nirenberg & O’Donnell, sp. nov. — MycoBank MB 838782

Synonym. Fusarium acutatum Nirenberg & O’Donnell, Mycologia 90: 435. 1998, nom. inval., Art. 40.1.

Etymology. Named for the acute apical cell of the sporodochial conidia produced by this species.

Typus. INDIA, unknown substrate, 1995, S.N. Smith (holotype B 70 0001695, designated here, culture ex-type BBA 69580 = NRRL 13309 = FRC 0-1117 = CBS 402.97 = IMI 376110).

For diagnosis — See Nirenberg & O’Donnell, Mycologia 90: 435. 1998.

Notes — Fusarium acutatum was isolated from Aphididae (Hemiptera) on Triticum sp. (wheat) from Pakistan and Cajanus sp. from India (Nirenberg & O’Donnell 1998, Leslie & Summerell 2006). It is known to produce beauvericin, enniatins and moniliformin (Munkvold 2017). Although this species was introduced by Nirenberg & O’Donnell (1998), it was invalidly described (Index of Fungi 6: 435, 1999). In the protologue for F. acutatum (Nirenberg & O’Donnell 1998) no reference was made to the specimen or gathering (Art. 40.1) for the holotype. Therefore, we validate the species here.

Bugnic., Rev. Gén. Bot. 59: 17. 1952 — Fig. 2

Fig. 2

Fusarium annulatum (a, h, j–l. CBS 258.54T; b, c, g, i, m. CBS 531.96; d, f. CBS 139379; e. CBS 134.95; n. CBS 143601). a–b. Sporodochia formed on the surface of carnation leaves; c–h. aerial conidiophores and conidiogenous cells; i–j. aerial conidia; k. sporodochial conidiophores and conidiogenous cells; l–n. sporodochial conidia. — Scale bars: a–d = 50 μm; all others = 10 μm (scale bar in l also applies to m and n).

Typus. NEW CALEDONIA, grain of Oryza sativa, F. Bugnicourt (holotype IMI 202878, ex-type culture CBS 258.54 = BBA 63629 = IMI 202878 = MUCL 8059 = NRRL 13619).

Description & Illustrations — (as F. proliferatum) Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Nirenberg & O’Donnell (1998), Domsch et al. (2007).

Notes — Fusarium annulatum has been extensively studied in the past under the name F. proliferatum, a segregate of Fusarium moniliforme s.lat. (Seifert et al. 2003). The name Fusarium proliferatum, however, is here assigned to a distinct phylogenetic clade based on an isolate collected from the type location and substrate of that species (see notes under F. proliferatum and in Discussion). Fusarium annulatum is a morphologically and phylogenetically diverse species, common in tropical and temperate zones (Domsch et al. 2007), with more than 200 plant host species reported to date. This species is a well-known pathogen of diverse crops worldwide (as F. proliferatum, Farr & Rossman 2021), and has been implicated in human infections, particularly on immunocompromised patients (Summerbell et al. 1988, O’Donnell et al. 2007). Fusarium annulatum is characterised by sympodially proliferating conidiophores producing mono- and polyphialides, and clavate microconidia with truncate bases grouped in moderately long chains and false heads. Chlamydospores are absent. Sporodochia and sporodochial conidia are typical for this species complex, but are seldom produced or can be poorly developed, thus being easily overlooked. According to Gerlach & Nirenberg (1982), the ex-type strain of F. annulatum (CBS 258.54) failed to produce sporodochia; however, as determined here, this strain will produce typical sporodochia under the culture conditions we employed in this study. Unlike other members of this clade, this strain of F. annulatum is unique by producing strongly curved macroconidia (Fig. 2). Nevertheless, Nelson et al. (1983) showed that straight sporodochial conidia are also produced by this strain, which were also observed in this study. Other strains of F. annulatum studied to date produce predominantly straight macroconidia.

(A. Braun) Wollenw., Ann. Mycol. 15: 14. 1917

Basionym. Fusisporium anthophilum A. Braun, in Rabenhorst, Fung. Europ. Exs.: no. 1964. 1875.

Synonyms. Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autogr. Delin. 3: 975. 1930.

Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ, Fusarii (Biologija I sistematika): 251. 1955.

Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987.

Fusarium sanguineum var. pallidius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 196. 1915.

Fusarium wollenweberi Raillo, Fungi of the genus Fusarium: 189. 1950.

Typus. GERMANY, Berchtesgaden, from Succisa pratensis, 1 Sept. 1874, A. Braun (lectotype of Fusisporium anthophilum, MBT 10000411, exsiccate Rabenhorst, Fungi europaei nr. 1964 in B, designated here); Berlin, on Euphorbia pulcherrima, 1975, H. Nirenberg (epitype, MBT 10000412, CBS 222.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 222.76 = BBA 63270 = IMI 196084 = IMI 202880 = NRRL 22943 = NRRL 25216).

Description & Illustrations — See Wollenweber & Reinking (1935), Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Leslie & Summerell (2006).

Notes — Nirenberg (1976) studied the type material from Braun (1875) and found that isolate CBS 222.76 agreed with the type collection in its morphology and locality. This was further supported by Gerlach & Nirenberg (1982). Therefore, in this study the illustration by Braun (1875) is designated as lectotype, and CBS 222.76 is designated as epitype for F. anthophilum.

Yilmaz & Crous, sp. nov. — MycoBank MB 838763; Fig. 3

Fig. 3

Fusarium chinhoyiense sp. nov. (NRRL 25221T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Etymology. Name refers to Chinhoyi, the region, from which the ex-type strain of this fungus was collected.

Typus. ZIMBABWE, Chinhoyi, from Zea mays, unknown date and collector (holotype PREM 63215, designated here, culture ex-type NRRL 25221 = BBA 69031 = IMI 375355 = Frank 5bCn8 = DAOM 225149 = CMWF1187 = NY007.I2).

Conidiophores on CLA borne on the aerial mycelium straight or flexuous, erect or prostrate, smooth- and thin-walled; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 11–25 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal, smooth- and thin-walled, aseptate, (4.5–)5–9(–11) × 2.5–3.5 μm (av. 7 × 3 μm), clustering in discrete false heads at the phialide tips. Sporodochia white to pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves and on the agar surface, often covered with aerial mycelium. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of terminal phialides; sporodochial conidiogenous cells doliiform to subcylindrical, (8–)10–14(–18) × 2.5–4 μm (av. 12 × 3 μm), smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender; apical cell more or less equally sized as the adjacent cell, blunt to slightly papillate; basal cell distinctly foot-shaped or barely notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (20–)22–27(–31) × 2–4 μm (av. 35 × 3 μm; n = 3); 3-septate conidia: (23–)27–38(–42) × 3–4 μm (av. 34 × 4 μm); 4-septate conidia: 40.5 × 3 μm (n = 1). Chlamydospores absent.

Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 5.8–7.3(–7.7–8.5) mm/d and reaching 50–60 mm diam at 25 °C, optimal 25–30 °C (after 7 d). Surface white, flat with abundant aerial mycelia on PDA incubated in dark. Reverse pale yellow (1A2), becoming dark blue at the centre with age. Odour absent. Sporodochia abundant on PDA incubated on constant nuv light.

Additional material examined. SOUTH AFRICA, from soil, Feb. 2018, C.M. Visagie, NY 001.B5.

Notes — This species is phylogenetically closely related to F. mundagurra isolated from soil in Australia (Laurence et al. 2016) and the recently described F. caapi isolated from Brachiaria brizantha from Brazil (Costa et al. 2021). Fusarium mundagurra has 1-septate microconidia and both F. mundagurra and F. caapi abundantly produce chlamydospores in culture, whereas F. chinhoyiense has aseptate microconidia and lacks chlamydospores. Fusarium chinhoyiense shares the common morphological features of those in FFSC, such as lack of chlamydospores, and oval to clavate microconidia. Moreover, microconidia are produced in relatively short chains from phialides forming false heads, somewhat resembling those produced by F. oxysporum rather than most members of the FFSC (Leslie & Summerell 2006). However, F. chinhoyiense is distinguished from F. oxysporum by the absence of chlamydospores. Although F. chinhoyiense also resembles F. subglutinans, the latter species is distinct in producing sterile, coiled hyphae.

Pirotta, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3: 316. 1879 — Fig. 4

Fig. 4

Lectotype of Fusarium lactis (Pirotta & Riboni 1879).

Synonyms. ?Fusarium pyrinum Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834.

?Fusarium apiogenum Sacc., Syll. Fung. 4: 717. 1886.

Fusarium rubrum Parav., Ann. Mycol. 16: 311. 1918.

Typus. ITALY, Pavia, on clotted milk, 1879, R. Pirotta & G. Riboni (lectotype, MBT 10000413, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3, t. 21, f. 1–6, designated here). – USA, California, on Ficus carica, 1994, T. Michailides (epitype, MBT 10000414, B 70 0001686, designated here, culture ex-epitype BBA 68590 = NRRL 25200 = CBS 411.97 = IMI 375351).

Description & Illustrations — See Nirenberg & O‘Donnell (1998), Leslie & Summerell (2006).

Notes — As the type specimen of F. lactis could not be located in PAV or PAD (Herbarium Saccardo), Nirenberg & O’Donnell (1998) neotypified the species based on NRRL 25200 (= BBA 68590 = CBS 411.97 = IMI 375351 = DAOM 225145) which was isolated from Ficus carica in the USA. However, the neotypification of F. lactis by Nirenberg & O’Donnell (1998) was not Code compliant (ICN; Art. 9.13) as an illustration was provided along with the original protologue. Therefore, the original illustration is designated as the lectotype and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype.

Sand.-Den., Yilmaz & Crous, sp. nov. — MycoBank MB 838764; Fig. 5

Fig. 5

Fusarium longicornicola sp. nov. (NRRL 52706T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b–c. sporodochia formed on the surface of carnation leaves; d–g. aerial conidiophores and phialides; h. aerial conidia; i–j. sporodochial conidiophores and phialides; k. sporodochial conidia. — Scale bars: d–k = 10 μm.

Etymology. Name refers to the substrate, Aiolopus longicornis, from which the ex-type strain of this fungus was isolated.

Typus. ETHIOPIA, Kobo, Welo, from a grasshopper (Aiolopus longicornis), unknown date and collector (holotype CBS H-24661, designated here, culture ex-type CBS 147247 = NRRL 52706 = ARSEF 6455).

Conidiophores on CLA produced laterally and abundantly on aerial and substrate mycelium, straight or flexuous, smooth- and thin-walled, simple or loosely irregularly and verticillately branched, up to 95 μm tall, copiously proliferating percurrently, or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate to subcylindrical, smooth- and thin-walled, 11–22.5 μm long, 2.5–4.5 μm at the widest point, periclinal thickening inconspicuous or absent; microconidia formed sparsely, hyaline, ellipsoidal, reniform to subclavate, smooth- and thin-walled, 0(–1)-septate, 5–9.5(–14) × 2–3.5 μm (av. 7.5 × 2.5 μm), clustering in discrete false heads at the phialide tips. Sporodochia pale to bright orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of 2–3 phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10–16 × 2.5–4 μm, smooth- and thin-walled, with conspicuous periclinal thickening and often with a short apical collarette. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the basal part; apical cell blunt to hooked; basal cell barely to distinctly notched, 1–3-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (14.5–)16–21(–23) × 2.5–4 μm (av. 18.7 × 3.2 μm); 2-septate conidia: (18.5–)20–25.5(–28) × 3–4 μm (av. 22.7 × 3.4 μm); 3-septate conidia: (16.5–)21.5–29.5 × 3–5 μm (av. 25.3 × 3.7 μm). Chlamydospores absent.

Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.7 mm/d and reaching 42–80 mm diam at 25 °C, optimal 20–30 °C after 7 d. Surface velvety to floccose, grey-magenta (13E6–14D4) to red-grey (9B2) towards margin, flat, filamentous to rhizoid with filiform margin. Reverse red-brown (9D6) to red-grey (12E2). Odour absent to mouldy.

Additional isolates examined. ETHIOPIA, Kobo, Welo, from Aiolopus longicornis, unknown date and collector, CBS 147248 = NRRL 52712 = ARSEF 6451; CBS 147249 = NRRL 52713 = ARSEF 6446.

Notes — Pfenning et al. (2019) recently redefined and fixed the typification of F. udum to a well-delimited phylogenetic clade and distinct mating population in the FFSC. Additional isolates previously assigned to F. udum were found not to belong to the current phylogenetic and biological circumscription of the species, most likely representing distinct species. Our phylogenetic and morphological results confirm those observations. The three insecticolous isolates here ascribed to F. longicornicola cluster in a well-differentiated and supported phylogenetic lineage. Apart from its different host association, F. longicornicola differs morphologically from F. udum. The latter species produces only monophialides on its aerial conidiophores, cream coloured sporodochial conidial masses bearing longer and more regularly septate sporodochial conidia, and abundant chlamydospores. The two closest phylogenetic relatives of F. longicornicola, F. phyllophilum and F. xylarioides, are both morphologically distinguishable from the former species. Fusarium phyllophilum mainly differs by lacking sporodochia, although, 5-septate sporodochial conidia are rarely observed in the latter species. Additionally, F. longicornicola differs from F. phyllophilum by its ellipsoidal and reniform microconidia (vs clavate in F. phyllophilum) and ecological traits (insecticolous vs foliicolous in F. phyllophilum; Nirenberg & O’Donnell (1998), Leslie & Summerell (2006)). Differences between F. longicornicola and F. xylarioides are more striking, as the latter species, which is a vascular pathogen of Coffea sp., produces aseptate, allantoid microconidia formed on monophialides only, strongly curved sporodochial conidia and chlamydospores (Gerlach & Nirenberg 1982).

A. Jacobs, T.A. Cout. & Marasas, sp. nov. — MycoBank MB 838783; Fig. 6

Fig. 6

Fusarium ophioides (CBS 118512T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b–c. sporodochia formed on the surface of carnation leaves; d–e. sporodochial conidiophores and phialides; f–j. aerial conidiophores and conidiogenous cells; k–l. microconidia; m. mesoconidia; n. serpentine hyphae (adapted from Jacobs 2010); o. sporodochial conidia. — Scale bars: d, f–g = 50 μm; k, n = 5 μm; all others = 10 μm.

Synonym. Fusarium ophioides (as ‘ophiodes’) A. Jacobs, T.A. Cout. & Marasas, Taxonomy of species within the Gibberella fujikuroi complex: 83. 2010, nom. inval. Art 30.9.

Etymology. The specific epithet is from the Greek ophis that means snake and refers to the serpentine hyphae produced by this species in culture.

Typus. SOUTH AFRICA, Mpumulanga, Ngodwana, from Panicum maximum, G. Kemp (holotype CBS H-24659, designated here, culture ex-type CBS 118512 = CMW 18681 = FCC 2979 = FCC 2980 = MRC 6744).

Conidiophores on CLA produced prostrate on substrate mycelium and laterally on aerial mycelium, straight or flexuous, smooth- and thin-walled, rarely simple, commonly sympodially to irregularly branched, up to 190 μm tall, proliferating percurrently; phialides mono- and polyphialidic, subulate to cylindrical, smooth- and thin-walled, 6.5–22.5 μm long, 2.5–4 μm at the widest point, periclinal thickening and collarettes inconspicuous to absent; microconidia hyaline, obovate, ellipsoidal to short falcate, smooth- and thin-walled, 0(–1)-septate, (5–)6.5–15(–20.5) × 2–4.5(–5.5) μm (av. 11 × 3.3 μm), clustering in false heads at the tip of phialides. Mesoconidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the apical part; apical cell pyramidal to slightly hooked; basal cell rounded to barely notched 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (19.5–)20–27(–28) × 3.5–4.5(–5.5) μm (av. 23.9 × 4.3 μm); 3-septate conidia: (29–)33.5–47(–60) × 3–4.5(–5.5) μm (av. 40.4 × 3.9 μm); 4-septate conidia: (45–)47.5–59.5 × 3–4.5 μm (av. 53.2 × 3.8 μm); 5-septate conidia: (56–)58–66.5 × 3–4.5 μm (av. 62.3 × 3.4 μm), formed abundantly on polyblastic conidiogenous cells on aerial mycelium and conidiophores. Sporodochia luteous to orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of up to four phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10.5–21 × 2.5–4 μm, smooth- and thin-walled periclinal thickening and collarettes inconspicuous to absent. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved tapering toward the basal part; apical cell elongated to hooked; basal cell barely to distinctly notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: 23–25 × 3.5–4 μm (av. 24.1 × 3.9 μm); 3-septate conidia: (30.5–)37–54(–60.5) × 3–5 μm (av. 45.3 × 4.1 μm); 4-septate conidia: (49–)53.5–65(–69.5) × 3.5–5 μm (av. 59.2 × 4.3 μm); 5-septate conidia: (53.5–)57–70(–75.5) × 3.5–5.5 μm (av. 63.5 × 4.4 μm). Chlamydospores absent. Sterile, curved hyphae with alternating curvature direction (serpentine hyphae) abundantly formed on the surface of CLA and SNA.

Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.4 mm/d and reaching 42–76 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface brown-red (10D8) to violet brown (11E5), velvety to wholly, flat with filiform margin. Reverse grey-ruby (12D4–12E6). Odour absent.

Additional isolates examined. SOUTH AFRICA, Mpumulanga, Ngodwana, from Phragmites mauritianus, G. Kemp, CBS 118509 = CMW 18678 = MRC 6748 = FCC 1092; from Panicum maximum, G. Kemp, CBS 118510 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118511 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118513 = CMW 18682 = MRC 6745 = FCC 2997, CBS 118514 = CMW 18683 = MRC 6750 = FCC 2972, CBS 118515 = CMW 18684 = MRC 6754 = FCC 2974.

Notes — Strains assigned to F. ophioides were isolated during a survey of South African grasses. The species was invalidly described in a doctoral thesis lacking an ISSN number (Art. 30.9). Here, we validate the name based on its original material deposited at the CBS (Jacobs 2010). Moreover, a morphological description is included to account for previously undocumented features, i.e., sporodochia and sporodochial conidia, and the nature of the aerial falcate, multiseptate conidia, here found to emerge singly from well-developed, predominately polyblastic and commonly sympodially proliferating conidiogenous cells, conforming to the description of mesoconidia sensu Pascoe (1990). For additional images and discussions about pathogenicity, mating behaviour and closely related taxa see Jacobs (2010).

Yilmaz, B.D. Wingf. & Crous, sp. nov. — MycoBank MB 838766; Fig. 7

Fig. 7

Fusarium pilosicola sp. nov. (NRRL 29124T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Etymology. Referring to the substrate, Bidens pilosa, from which the ex-type strain of this fungus was collected.

Typus. USA, Florida, from Bidens pilosa, unknown date and collector (holotype PREM 63216, designated here, culture ex-type NRRL 29124 = CMWF 1183 = NY007.H7).

Conidiophores on CLA sparse on aerial mycelium, straight or flexuous, erect or prostrate, smooth- and thin-walled, commonly unbranched, up to 90 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 8.5–24 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal to ovoid, smooth- and thin-walled, mostly aseptate, (5.5–)7–12 × 2–4 μm (av. 9 × 3 μm), rarely 1-septate, 16–19 × 3–4 μm (av. 18 × 4 μm; n = 2), clustering in discrete false heads at the phialide tips. Sporodochia orange or sometimes pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells elongated subulate to subcylindrical, 11–24 × 3–4 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, slightly curved and slender or sometimes strongly curved; apical cell papillate; basal cell foot-shaped, (3–)4(–5)-septate, hyaline, thin- and smooth-walled, 3-septate conidia: (33–)44–56 × 4.5–5.5 μm (av. 48.6 × 5 μm; n = 4); 4-septate conidia: (48–)50–70(–75) × 4–6.5 μm (av. 59 × 5 μm); 5-septate conidia: 55–70(–80) × 4–5(–6) μm (av. 66.5 × 5 μm; n = 2). Chlamydospores absent.

Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of (6.2–)7.2–7.8 mm/d and reaching 45–55 mm diam at 25 °C, optimal 25 °C after 7 d. Surface floccose, abundantly sporulating on PDA, white interspersed with purple mycelia at 25 °C (orange-pink under light and nuv light). Reverse with dark blue (20F4) centre fading into yellow-white (4A2) to orange-white (5A2) in dark. Odour absent.

Additional isolate examined. USA, Florida, from Bidens pilosa, unknown date and collector, NRRL 29123 = CMWF 1189= NY 007.I4.

Notes — Fusarium pilosicola is a relatively slow-growing species. This species is phylogenetically closely related to F. circinatum and also resembles F. circinatum and F. subglutinans by producing microconidia in false heads. However, F. circinatum is characterised by the formation of sterile, coiled hyphae on SNA and sometimes on CLA, whereas this was not observed for F. pilosicola. On PDA F. subglutinans produces shades of purple pigment ranging from a dark purple to nearly black, whereas F. pilosicola lacks purple pigmentation.

(Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 209: 309. 1982 — Fig. 8, 9

Fig. 8

Lectotype of Fusarium proliferatum (Matsushima 1971).

Fig. 9

Fusarium proliferatum (CBS 480.96ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f–g. sporodochial conidiophores and phialides; h. sporodochial conidia. — Scale bars: c–h = 10 μm.

Basionym. Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 11. 1971.

Synonyms. Fusarium proliferatum (Matsush.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 38. 1976, nom. inval., Art. 41.3.

Fusarium proliferatum var. minus Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 43. 1976, nom. inval., Art. 41.3.

Typus. PAPUA NEW GUINEA, forest soil, Matsushima (lectotype of Cephalosporium proliferatum, MBT 10000437, Matsushima T. 1971. Microfungi of the Solomon Islands and Papua New Guinea: 11, f. 121.2, designated here); Papua New Guinea, Morobe province, Bulolo, forest soil, Nov. 1995, collected by A. Aptroot and isolated by A. van Iperen (epitype, MBT 10000438, CBS 480.96 (metabolically inactive) designated here; cultures ex-epitype CBS 480.96 = IAM 14682 = NRRL 26427 = NY007.B6).

Conidiophores on CLA difficult to locate, sparse on the aerial mycelium, straight or flexuous, erect, smooth- and thin-walled, commonly unbranched or irregularly branched, up to 85 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate, to subcylindrical, smooth- and thin-walled, 7.5–18 × 2–3 μm, without periclinal thickening; microconidia formed sparsely, hyaline, ovoid to pear-shaped, smooth- and thin-walled, aseptate, (5–)6–11(–13) × 2–3(–4) μm (av. 8.5 × 3 μm), rarely 1-septate (11.5–)13–14(–17.5) × 2.5–3.5 μm (av. 14 × 3 μm; n = 3), clustering in discrete false heads at the tip of phialides. Sporodochia white to pale yellow, often somewhat translucent, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells monophialidic and polyphialidic, subulate to doliiform, 5.5–18 × 2.5–5 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender and sometimes strongly curved; apical cell papillate; basal cell foot-shaped to barely notched, (1–)3(–4)-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (16.5–)20–30(–36.5) × (1.5–)2–3(–4) μm (av. 24 × 3 μm; n = 7); 2-septate conidia: 26–28 × 2–4 μm (n = 1); 3-septate conidia: (28–)30–50(–56) × 2.5–4.5 μm (av. 42.3 × 3.3 μm); 4-septate conidia: 46.5–60.5 × 3–4 μm (n = 2). Chlamydospores absent.

Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 10.3–10.7 mm/d and reaching 69–71 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface floccose, white to pale pink, abundantly sporulating on PDA incubated in the dark. Reverse with pale greyish ruby (12C7) centre fading into greyish rose (11B3), becoming dark violet to blue at centre with age. Odour absent.

Notes — For original descriptions and illustrations, see Matsushima (1971), Nirenberg (1976) and Gerlach & Nirenberg (1982). Fusarium proliferatum was originally described as Cephalosporium proliferatum by Matsushima and isolated from soil from Papua New Guinea (Matsushima 1971). When Matsushima described the species, it was based on pear-shaped (pyriform) microconidia and striking polyphialides (Fig. 8). The culture (MFC-2683) did not produce any sporodochial conidia. Gams & Lacey (1972) made the assumption that C. proliferatum probably belonged to Fusarium sect. Liseola. In 1976, Nirenberg had the opportunity to examine the ex-type specimen of F. proliferatum (Nirenberg 1976), but also failed to observe any sporodochial conidia. Although isolate NRRL 13289 was preserved in the NRRL collection as ‘type’ of F. proliferatum, it was derived from NRRL 6322 (MRC 1784 = ATCC 76097 = FRC M-1138) which was originally isolated from cotton collected in North Carolina (Marasas et al. 1988). As shown in our results, NRRL 13289 belongs to the F. fujikuroi clade. As there is no living ex-type strain available to serve as phylogenetic anchor for F. proliferatum, we designate the original illustration as lectotype, and CBS 480.96 (same substrate, location and morphology, and deposited in 1995 as F. proliferatum) as epitype for F. proliferatum.

(E.J. Butler) W. Gams, Cephalosporium-artige Schimmelpilze: 218. 1971 — Fig. 10

Fig. 10

Lectotype of Fusarium sacchari (Butler & Khan 1913).

Basionym. Cephalosporium sacchari E.J. Butler, Mem. Dept. Agric. India, Bot. Ser. 6: 185. 1913.

Synonyms. Fusarium neoceras Wollenw. & Reinking, Phytopathology 15: 164. 1925.

Gibberella sacchari Summerell & J.F. Leslie, Mycologia 97: 719. 2005, nom. illeg., Art. 53.1, non Gibberella sacchari Speg. 1896.

Fusarium desaboruense N. Maryani et al., Persoonia 43: 59. 2019.

Typus. INDIA, from culms of Saccharum officinarum, E.J. Butler (lectotype of Cephalosporium sacchari, MBT 10000416, Mem. Dept. Agric. India, Bot. Ser. 6: 185, pl. II, f. 1–13 (1913), designated here); from Saccharum officinarum, 1975, Schaft (epitype, MBT 10000417, CBS 223.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 223.76 = BBA 63340 = DAOM 225138 = IMI 202881 = NRRL 13999).

Description & Illustrations — See Gams (1971), Gerlach & Nirenberg (1982), Leslie et al. (2005), Leslie & Summerell (2006).

Notes — Because the original type specimen is no longer available, Leslie et al. (2005) neotypified F. sacchari based on isolate KSU B-03852 (ATCC 201264 = FGSC 7610 = FRC M6865). However, in the protologue of F. sacchari, Butler & Khan (1913) did include an illustration which is designated here as lectotype. This supersedes the neotype (Art. 9.13) designation by Leslie et al. (2005). Therefore, CBS 223.76, isolated from Saccharum officinarum collected in India, is designated here as epitype. Additionally, this ex-epitype isolate has been used as the representative isolate of F. sacchari in recent phylogenetic studies on the F. fujikuroi species complex (O’Donnell et al. 1998, 2013, Herron et al. 2015). The inclusion of a larger sampling of F. sacchari isolates for the multigene phylogenies in this study clearly resolved F. desaboruense (Maryani et al. 2019b), isolated from banana collected in Indonesia, within the F. sacchari clade. Therefore, we consider F. desaboruense as a synonym of F. sacchari. The molecular data also showed that F. sacchari and F. neoceras are conspecific, therefore we synonymize F. neoceras with F. sacchari.

(Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983 — Fig. 11

Fig. 11

Fusarium subglutinans (CBS 747.97ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidia, conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Basionym. Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathology 15: 163. 1925.

Synonyms. Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agric. Gaz. New South Wales 44: 895. 1933, Art. F.8.1, Note 2, Exs. 2.

Fusarium moniliforme f. subglutinans (Wollenw. & Reinking) C. Moreau, Rev. Mycol. (Paris) 17: 23. 1952.

Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 53. 1976.

Gibberella subglutinans (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983.

Typus. USA, Illinois, St. Elmo, from Zea mays, date unknown, J.F. Leslie (neotype of Fusarium moniliforme var. subglutinans MBT 10000418, CBS 747.97 (preserved as metabolically inactive culture), designated here, culture ex-neotype CBS 747.97 = BBA 62451 = DAOM 225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL 22114).

Description & Illustrations — See Booth (1971), Nirenberg (1976, 1981), Nelson et al. (1983), Pascoe (1990), Leslie & Summerell (2006).

Notes — No living type material or holotype specimen is available for F. subglutinans. Therefore, CBS 747.97 (= NRRL 22016) isolated from corn in the USA, is designated as the neotype for this species. Historically, this strain has been used as representative of F. subglutinans in various phylogenetic studies (Zeller et al. 2003, O’Donnell et al. 2013, Herron et al. 2015), and thus we conserve the modern interpretation of this species.

J. Schröt. ex Sacc., Syll. Fung. 10: 724. 1892

Synonym. Fusisporium succisae J. Schröt., Hedwigia 13: 180. 1874, nom. inval., Art. 36.1(a).

Typus. GERMANY, Bavaria, Borussia, from Succisa pratensis, 1875, de Thuemen (lectotype, MBT 10000419, ILL00076313 (Thuemen, Mycoth. Univ. nr. 675) designated here); from flower of Succisa pratensis, 1973, H. Nirenberg (epitype, MBT 10000420, IMI 202876, designated here, culture ex-epitype BBA 12287 = BBA 63627 = CBS 219.76 = DAOM 225142 = IMI 202876 = NRRL 13613).

Description & Illustrations — See Nirenberg (1976), Gerlach & Nirenberg (1982).

Notes — This taxon was first described as a species of Fusisporium by Schröter in 1874 and then as a species of Fusarium in 1892 by Saccardo. Although Wollenweber & Reinking (1935) considered this species as a synonym of F. anthophilum (as F. moniliforme var. anthophilum), both Nirenberg (1976) and Gerlach & Nirenberg (1982) recognised this species, indicating CBS 219.76 (= NRRL 13613 = IMI 202876) as a representative isolate of F. succisae. Therefore, this specimen is designated as epitype for this species.

(Sacc.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 26. 1976 — Fig. 12, 13

Fig. 12

Lectotype of Fusarium verticillioides (Saccardo 1881).

Fig. 13

Fusarium verticillioides (CBS 218.76ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. aerial conidia produced in chains; c. aerial conidia; d–e. aerial conidia, conidiophores and phialides. — Scale bars: c–g = 10 μm.

Basionym. Oospora verticillioides Sacc., Fung. Ital., Fasc. 17–28: pl. 879. 1881.

Synonyms. Alysidium verticillioides (Sacc.) Kuntze, Revis. Gen. Pl. 3: 442. 1898.

Fusarium moniliforme J. Sheld., Annual Rep. Nebraska Agric. Exp. Sta. 17: 23. 1904.

Gibberella moniliformis Wineland, J. Agric. Res. 28: 909. 1924.

Typus. ITALY, Zea mays, 1877, unknown collector (lectotype of Oospora verticillioides, MBT 10000421, pl. 879 in Saccardo, Fung. Ital. (1881), designated here); GERMANY, on stem of Zea mays, 1968, H. Nirenberg (epitype, MBT 10000422, CBS 218.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 218.76 = BBA 11782 = DSM 62264 = IMI 202875 = NRRL 13993).

Description & Illustrations — See Nirenberg (1976, 1981), Gerlach & Nirenberg (1982), Leslie & Summerell (2006).

Notes — Fusarium verticillioides was first isolated from maize in Italy in 1877 as Oospora verticillioides (Saccardo 1886) and became known as F. moniliforme after it was associated with animal toxicoses (Sheldon 1904). Nirenberg (1976) synonymised O. verticillioides under F. moniliforme, associated with the sexual morph Gibberella moniliformis (Wineland 1924). Previously, the name F. moniliforme was applied in a broad sense to include at least six, and probably more, reproductively isolated mating populations. Therefore, Seifert et al. (2003) restricted the application of the name F. verticillioides to what is presently known as the mating population A and the main fumonisin producing species. Other mating populations known within the collective ‘F. moniliforme’ group have now been resolved to species level, e.g., F. thapsinum from sorghum, F. sacchari from sugar cane, F. mangiferae from mango and F. fujikuroi from rice (Leslie & Summerell 2006). No type material could be located for the true F. verticillioides as reported by Nirenberg (1976), but the original plate published in Saccardo (1881) is selected as lectotype here. Gerlach & Nirenberg (1982) considered CBS 218.76 an authentic strain of F. verticillioides. Therefore, this metabolically inactive culture is designated as an epitype for F. verticillioides.

DISCUSSION

Fusarium was first described by Link (1809) based on the presence of its distinctive banana- or canoe-shaped conidia as its primary character. From recent taxonomic revisions based on molecular work, we now know that this character does not only apply to Fusarium s.lat., but several other genera (Gräfenhan et al. 2011, Schroers et al. 2011, Lombard et al. 2015, Sandoval-Denis et al. 2019). Throughout history, Fusarium species delineation was based on three main species concepts, namely morphological, biological, and phylogenetic species concepts (Leslie et al. 2001). Today, however, the general consensus is to apply a polyphasic or consilient approach which takes into account as many characters as possible, noting a bias towards phylogenetic data. The biological species concept was widely employed within the FFSC, with at least 11 mating populations identified (Martin et al. 2011). However, several of these mating populations have now been described as new species (Britz et al. 2002, Leslie et al. 2005). A major drawback of this approach is the fact that many Fusarium species have no known sexual morph/cycle and the limited number of isolates that do have a sexual morph/cycle, make crosses cumbersome. Although mycologists try to collect as many strains as possible of a proposed new species, in many cases it is not possible. Indeed, several recently described Fusarium species have been based on one or a few isolates, especially when strains are sequenced for re-identification purposes from culture collections (Nirenberg & O’Donnell 1998, Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019, Lombard et al. 2019a, b). Notably, in a number of cases where descriptions were based on too few strains, or the species were presumed unimportant due to their original ecological niches, these taxa have turned out to be more widely distributed and more economically important than earlier perceived. An example is F. pseudonygamai which was described based on two strains found from Pennisetum typhoides in Africa (Nirenberg & O’Donnell 1998). Since its formal description, this species has been recovered from a much wider range of substrates and locations. These include rice affected by bakanae disease in India, and sugarcane affected by pokkah boeng disease and stalk borer (Eldana saccharina) (McFarlane et al. 2009, Bashyal et al. 2016, Summerell 2019). This shows the importance of introducing names for unique phylogenetic lineages when supported by conclusive genetic and phenotypic evidence. Therefore, in this study, Latin binomials are provided for three phylospecies that have been resolved in previous studies, but remained unnamed (Herron et al. 2015, Laurence et al. 2016, Pfenning et al. 2019).

The FFSC contains 65 accepted species, which include a large number of cryptic species only identifiable based on phylogenetic inference. The purpose of this study was to characterise and describe a large collection of FFSC strains accessioned in the CBS, CMW and NRRL culture collections using a polyphasic approach. Phylogenetic analyses of a five-gene dataset strongly supported the novelty of the three Fusarium phylospecies previously identified, with strong monophyletic statistical support values (Fig. 1).

O’Donnell et al. (1998) concluded that the FFSC includes three main clades classified as the Asian, American and African clades at that time. In this study, we found that the African clade is not monophyletic, and that F. dlaminii and F. fredkrugeri form a separate group (the African clade B), making the use of this informal classification system for the FFSC redundant and confusing. Similar results were also observed in previous studies (Herron et al. 2015, O’Donnell et al. 2000, Sandoval-Denis et al. 2018b). Furthermore, for several species, the relationship between the geographical origin and the proposed informal clade classification is not compatible.

Two of the newly named species in this study, F. chinhoyiense sp. nov. and F. pilosicola sp. nov., were resolved in the core African clade. Two strains of F. chinhoyiense used in this study (NRRL 25221T and NY 001B5) were isolated from Zea mays in Zimbabwe and soil from Limpopo, South Africa, respectively. The closest relative to F. chinhoyiense is F. mundagurra and the recently described species F. caapi (Laurence et al. 2016, Costa et al. 2021). Fusarium chinhoyiense is distinguished from the latter species by the lack of chlamydospores. Additionally, microconidia are produced in sliding chains by F. mundagurra, whereas those of F. chinhoyiense are borne in false heads. Although F. subglutinans also produces microconidia from false heads, its ability to produce distinctive sterile coiled hyphae can easily distinguish it from F. chinhoyiense. Two strains of F. pilosicola were obtained from the NRRL collection (NRRL 29123 and NRRL 29124T) and isolated from Bidens pilosa collected in the USA. Based on phylogenetic inference, F. pilosicola is closely related to F. circinatum, the causal agent of the devastating Pitch canker disease of several Pinus species. This species readily produces orange sporodochia with abundant sporodochial conidia, whereas F. circinatum does not readily produce sporodochia and produces sterile hyphal coils which were not observed in this study for F. pilosicola (Leslie & Summerell 2006). Additionally, the basal cells of sporodochial conidia in F. pilosicola are well-developed in contrast to those of F. circinatum. There are a number of species that are morphologically similar to F. pilosicola due to the production of microconidia in false heads, including F. bulbicola, F. circinatum, F. guttiforme, F. mangiferae, F. pseudocircinatum, F. sacchari, F. subglutinans and F. sterilihyphosum (Leslie & Summerell 2006). Many of these species are quite difficult to differentiate from one another unless molecular markers are used.

Fusarium longicornicola sp. nov. was resolved in the African core clade in this study (Fig. 1). The species was isolated from the tef grasshopper (Aiolopus longicornis) from Ethiopia. The isolates were originally identified as F. udum by O’Donnell et al. (2012). However, Pfenning et al. (2019) illustrated that they do not cluster with other F. udum s.str. strains and suggested that they may represent a distinct species. Unfortunately, no morphological data are available for these isolates at present, and therefore in this study we described the species as F. longicornicola.

Fusarium is regarded as one of the most important fungal genera known and therefore in much need of a stable and concise taxonomy. Especially as it is now recognised that species of this genus can adjust rapidly to climate change, have the ability to move into new ecosystems and cause diseases on new crops, highlighting the importance of accurate species identification (Maryani et al. 2019a). The newly described Fusarium species in this study have not been linked to any pathogenicity on their hosts. However, they should not be ignored as the host range of several species in the FFSC have not yet been determined. For some researchers it may be irrelevant to describe species without information pertaining to its pathogenic and/or mycotoxigenic potential. Regardless, it is still of utmost importance to better understanding the biodiversity and phylogeographical range of a specific Fusarium species. Even though some of the newly proposed species constitute a single lineage in this study, providing Latin binomials for these will allow the opportunity to more easily find additional isolates of these species in future studies.

One of the most important concepts and cornerstone of a stable fungal taxonomy system is the correct application of types. These specimens and living ex-type strains play a fundamental role to provide anchorage for species names in especially taxonomic phylogenetic studies of a particular fungal group that suffers from an inconsistent taxonomic system. In practical terms, it also serves as the foundation to make informed morphological or phylogenetic comparisons. Ideally, having a living ex-type strain with all associated metadata including high quality DNA sequences along with multiple strains of the same species would provide essential information on the infra-species variation found in a certain species.

A perturbing issue for several older Fusarium species/names is the lack of nomenclatural types that are either not available or have been lost. The International Code of Nomenclature for algae, fungi, and plants allows for re-typification in these cases, when material from the original protologue (like a drawing or exsiccate) can be applied as lectotype (Art. 9.3) and a new specimen/strain can then be designated as epitype/ex-epitype. Therefore, in this study, lectotypes could be designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides to provide taxonomic stability for these established species. Furthermore, a neotype is designated for F. subglutinans, as no authentic material linked to the original protologue, could be located.

Fusarium anthophilum is a cosmopolitan fungus and found on various plant species in temperate regions (Leslie & Summerell 2006). It is known to produce beauvericin, fumonisins, fusaproliferin and moniliformin (Munkvold 2017). The type specimen from the original description by Braun (1875) was not available. Therefore, the original protologue’s illustration is designated as the lectotype and CBS 222.76 isolated from a stem of Euphorbia pulcherrima collected in Germany designated as an epitype.

Fusarium lactis was described by two Italian mycologists, Pirotta and Riboni, on clotted milk from Pavia, Italy (Pirotta & Riboni 1879). It produces beauvericin, and some of the isolates produce moniliformin and fumonisin B1 (Yang et al. 2011, Munkvold 2017). This species is also a known pathogen of fig (Ficus carica; Nirenberg & O’Donnell 1998) and sweet pepper (Capsicum annuum; Yang et al. 2009). As no living type material for F. lactis was available, Nirenberg & O’Donnell (1998) neotypified the species. However, a drawing as part of the original protologue (Fig. 4) is available, and therefore is designated as the lectotype here, and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype.

Fusarium sacchari is the causal agent for pokkah boeng of sugarcane and also causes mycotic keratitis among the sugarcane farmers in North India (Bansal et al. 2016, Costa et al. 2019, Viswanathan 2020). Fusarium sacchari was first described as Cephalosporium sacchari from sugarcane in India (Butler & Khan 1913). The protologue of the species did not include any mention of sporodochial conidia. Later, Wollenweber & Reinking (1925) described several cultures that produced sporodochial conidia as Fusarium neoceras (CBS 147.25, the ex-holotype of F. neoceras). However, Gams (1971) synonymised the two names, which is further supported by the molecular data in O’Donnell et al. (1998) and this study. Since the original type specimen is not available, Leslie et al. (2005) neotypified F. sacchari. However, the original illustration by Butler & Khan (1913; Fig. 10) designated here as lectotype, invalidates the neotype of Leslie et al. (2005). Therefore, in this study, CBS 223.76 isolated from Saccharum officinarum in India is designated as epitype for this species. In addition, the multigene phylogeny resolved the recently described F. desaboruense (Maryani et al. 2019b) within the F. sacchari clade and therefore, the later species is synonymised under F. sacchari.

Fusarium succisae was first described as a species of Fusisporium by Schröter in 1874 and subsequently transferred to the genus Fusarium in 1892 by Saccardo. It was originally isolated from Succisa pratensis in Germany. It is not known to produce mycotoxins and limited information is available on the ecology and biology of this species (Leslie & Summerell 2006). No living ex-type strain exists for this species although an illustration accompanying the original protologue is available, which is designated as the lectotype. This, in turn, allows for CBS 219.76 to be designated as epitype here, which shares the same substrate and the locality as indicated in the original protologue.

Fusarium verticillioides is the most common pathogen on maize and found throughout the world wherever maize is cultivated (Leslie & Summerell 2006). It causes Fusarium ear rot on maize and results in significant yield losses and reduction of grain quality (Leslie & Summerell 2006). It is also known to be isolated from different grains including millet, sorghum and sunflower (Leslie & Summerell 2006). Fusarium verticillioides is known to produce fumonisins which cause fatal livestock diseases and are considered potentially carcinogenic mycotoxins for humans, especially in China and Southern Africa. It is also known to produce beauvericin, fusaric acid and fusarisins (Munkvold 2017). Fusarium verticillioides was traditionally known as the A-mating population of F. moniliforme s.lat. Even though the key characters of F. verticillioides were illustrated by Leslie & Summerell (2006), we provided a photographic plate illustrating F. verticillioides based on the epitype (CBS 218.76; Fig. 13).

Fusarium subglutinans is an important cosmopolitan maize pathogen which causes seedling disease, stalk and ear rot (Moretti et al. 1995, Steenkamp et al. 2002). The production of mycotoxins might differ from strain to strain but little to no fumonisins are generally produced by this species (Desjardins et al. 2000, Proctor et al. 2004, Fumero et al. 2015, 2020). However, F. subglutinans is known to produce beauvericin, fusaric acid, moniliformin, and high levels of fusaproliferin which are known to be emerging mycotoxins (Fumero et al. 2015, 2020). Even though it is a very well-known and used species name, no living type material or holotype specimen are available for this important cereal pathogen and mycotoxin producer. Therefore, CBS 747.97 is designated as neotype to facilitate a stable taxonomy for this species. Both F. acutatum and F. ophioides were invalidly published, and are therefore validated in this study.

Fusarium marasasianum, F. parvisorum, F. pininemorale and F. sororula were originally described by Herron et al. (2015) from diseased Pinus species collected in Colombian plantations and nurseries. Ex-type cultures for these taxa were subsequently deposited in the CBS culture collection. DNA sequences generated from the ex-type cultures of F. marasasianum, F. parvisorum and F. sororula resolved these taxa within the F. circinatum clade. While some isolates for F. marasasianum, F. pininemorale and F. sororula correspond with the placement obtained by Herron et al. (2015), all F. parvisorum isolates deposited at the CMW and CBS collection resolved as F. circinatum. Therefore, in our study we used the tef1 and tub2 sequences that were submitted to GenBank by Herron et al. (2015) (Fig. 1). Wingfield et al. (2017) released the full genome sequence for F. pininemorale (CMW 25243), while unpublished whole genome sequences for F. marasasianum (CMW 25512) and F. sororula (CMW 25513) were recently generated (De Vos et al. pers. comm.). Gene regions of phylogenetic interest were extracted from these genomes and the resulting multigene phylogeny suggest that F. pininemorale and F. marasasianum are conspecific, with F. pininemorale resolving as close relative to F. sororula (Fig. 1). Considering the significant uncertainty and confusion related to the ex-type cultures available for these taxa, a future study will be required to generate sequence data from the dried holotype specimens deposited at PREM (fungarium of the National Collections of Fungi hosted at the Agricultural Research Council, Roodeplaat, South Africa) in order to resolve their phylogeny.

Fusarium proliferatum isolates are known to cause diseases in maize, sorghum, mango and asparagus (Leslie & Summerell 2006). They are also known to produce beauvericin, enniatins, fumonisins, fusaproliferin, fusaric acid, fusarins and moniliformin (Munkvold 2017). Even though F. proliferatum is a well-studied species, from the taxonomic point of view the name remains phylogenetically unresolved. Fusarium proliferatum was first described as Cephalosporium proliferatum by Matsushima (1971) and renamed as a Fusarium species by Nirenberg (1976). Unfortunately, the ex-type culture of F. proliferatum has not been preserved. Therefore, the identification of F. proliferatum isolates has mostly been based on the morphological concept derived by Nirenberg (1976). During our survey, we included a representative reference strain in the WI collection (CBS 480.96), which was isolated from the same substrate (forest soil) and location (Papua New Guinea) as the original Cephalosporium proliferatum. Morphological characters of this strain also match both the original description of Matsushima (1971) and Nirenberg (1976), with the addition of sporodochial formation. In the multi-gene phylogenies, however, CBS 480.96 resolved on a distinct branch to isolates which were traditionally identified as F. annulatum/proliferatum (Fig. 1). To bring taxonomic stability to F. proliferatum, the original line drawing in Matsushima (1971) is designated as lectotype, and CBS 480.96 as epitype of F. proliferatum. O’Donnell et al. (1998) demonstrated that the ex-type of F. annulatum (CBS 258.54) groups together with other isolates previously identified as ‘F. proliferatum’, which is confirmed here in our phylogenetic analysis. Fusarium annulatum is a species described by Bugnicourt (1952), based on a single isolate from Oryza sativa, New Caledonia. According to the original description by Bugnicourt (1952), F. annulatum produces microconidia in chains from false heads on abundant mono- and polyphialides. Sporodochial conidia are thin-walled, strongly curved and almost ring-shaped, with the basal cell distinctly foot-shaped, and chlamydospores are absent. Nelson et al. (1983) mentioned that F. annulatum is essentially a F. proliferatum with strongly curved sporodochial conidia. The resulting confusion in literature is largely based on the fact that the ex-type strain of F. annulatum is atypical for the species, as most isolates of F. annulatum actually only produce straight macroconidia (see Fig. 2). To further understand variation within this complex, whole-genome sequences of the ex-epitype of F. proliferatum and ex-type of F. annulatum will be generated as a follow-up study. A stable and robust taxonomy is anchored by the availability of ex-type material which acts as the reference point and anchor for phylogenetic analyses. Therefore epi- and/or neotypification plays a very important and crucial role in the classification of Fusarium species, especially those that produce mycotoxins and cause diseases of animals, humans and plants.