Literature DB >> 35935895

Redefining species limits in the Fusarium fujikuroi species complex.

N Yilmaz1, M Sandoval-Denis2, L Lombard2, C M Visagie1, B D Wingfield1, P W Crous1,2.   

Abstract

The Fusarium fujikuroi species complex (FFSC) includes more than 60 phylogenetic species (phylospecies) with both phytopathological and clinical importance. Because of their economical relevance, a stable taxonomy and nomenclature is crucial for species in the FFSC. To attain this goal, we examined type specimens and representative cultures of several species by employing morphology and phylogenetic analyses based on partial gene fragments of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase II second largest subunit (rpb2). Based on these results three new species were delimited in the FFSC. Two of these phylospecies clustered within the African clade, and one in the American clade. Epitypes were also designated for six previously described FFSC species including F. proliferatum and F. verticillioides, and a neotype designated for F. subglutinans. Furthermore, both F. acutatum and F. ophioides, which were previously invalidly published, are validated. Citation: Yilmaz N, Sandoval-Denis M, Lombard L, et al. 2021. Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46: 129-162. https://doi.org/10.3767/persoonia.2021.46.05.
© 2021 Naturalis Biodiversity Center & Westerdijk Fungal Biodiversity Institute.

Entities:  

Keywords:  epitypification; fungal taxonomy; morphology; neotypification; new taxa; validation

Year:  2021        PMID: 35935895      PMCID: PMC9311392          DOI: 10.3767/persoonia.2021.46.05

Source DB:  PubMed          Journal:  Persoonia        ISSN: 0031-5850            Impact factor:   11.658


INTRODUCTION

The genus Fusarium is considered one of the most important plant pathogenic genera globally and includes more than 330 species. Fusarium graminearum s.lat. and F. oxysporum s.lat. are regarded as two of the most important fungal pathogens in plant pathology based on a survey done within the international phytopathological community (Dean et al. 2012). Fusarium species cause diseases that universally influence both the agricultural and forestry sectors. In addition, some species produce regulated mycotoxins which are responsible for further devastating losses to agricultural crops worldwide and threaten global food security (Wu 2007). Recently, Fusarium species have also become more prevalent in the clinical setting causing various diseases and infections in humans and animals for which limited clinical treatments are available (Jain et al. 2011). The Fusarium fujikuroi species complex (FFSC) is one of the larger and best studied species complexes within the genus displaying various ecologies (Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019). The FFSC was first established by Wollenweber et al. (1925) as section Liseola for species that produce sporodochial conidia (macroconidia), microconidia in chains and/or false heads, and do not produce chlamydospores. However, in subsequent years several species were described, namely F. dlamini (Marasas et al. 1985), F. nygamai (Burgess & Trimboli 1986) and F. napiforme (Marasas et al. 1987) that conformed to the characteristics of section Liseola, but notably also produced chlamydospores. To accommodate these species, Kwasna et al. (1991) introduced the section Dlaminia. Subsequent molecular studies nonetheless showed that section Liseola was paraphyletic, with species in section Dlaminia resolving within Liseola (O’Donnell et al. 1998, 2000). This clearly exemplified the complications of using phenotypic characters to predict relatedness and evolutionary histories, where morphology often displayed discord with DNA sequence data. In light of these limitations, the term ‘species complex’ was introduced which essentially served as a way to name phylogenetic clades (O’Donnell & Cigelnik 1997, O’Donnell et al. 1998). Throughout the years, Fusarium species in the FFSC have been extensively studied due to their ability to cause infections in plants, producing mycotoxins (e.g., beauvericin, fumonisins, moniliformin), and causing opportunistic human infections (Nirenberg & O’Donnell 1998, Munkvold 2017, Al-Hatmi et al. 2019). A biogeographic hypothesis was developed by O’Donnell et al. (1998) for FFSC, which clustered isolates into three relatively well-supported phylogenetic clades named the African, American and Asian clades. Subsequent studies split the African clade into two distinct and highly supported lineages (African Clade A & B; Herron et al. 2015, Sandoval-Denis et al. 2018b). The core African clade (African Clade A) included maize and coffee pathogens such as F. verticillioides and F. xylarioides, whereas the African Clade B included F. fredkrugeri and F. dlaminii (Geiser et al. 2005, O’Donnell et al. 2018, Sandoval-Denis et al. 2018b). The American clade included species like F. circinatum, the causal agent of pitch canker in pine trees, and F. temperatum, a maize pathogen producing several mycotoxins (Aoki et al. 2014, Fumero et al. 2015). The Asian clade included species such as F. mangiferae, a tree pathogen, and F. proliferatum known for its ability to cause significant levels of disease on a wide range of plant hosts (Britz et al. 2002, Leslie & Summerell 2006). Presently there are more than 60 distinct phylogenetic species recognised in the FFSC. However, several phylogenetically distinct species within this complex have still not been officially named. A well-defined species with a Latin binomial will help end-users to more robustly identify Fusarium strains, better diagnose diseases, help to intimately understand their biology, and ultimately develop better management and quarantine strategies. The purpose of this study was to introduce Latin binomials for unnamed FFSC phylospecies based on a number of strains accessioned within the Westerdijk Fungal Biodiversity Institute (CBS), and the USDA Agricultural Research Service (NRRL) culture collections and correct seven species typifications which have been neglected in the past.

MATERIALS AND METHODS

Isolates

Isolates included in this study were obtained from diverse culture collections, namely the U.S. Agricultural Research Service culture collection (NRRL), the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS), the working collections of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa, Neriman Yilmaz (NY), University of Pretoria, South Africa, the Medical Research Center (MRC) Tygerberg, Cape Town, South Africa, and Mycothèque de l’Université catholique de Louvain (MUCL), Louvain-la-Neuve, Belgium (Table 1).
Table 1

Fusarium strains used in this study.

SpeciesaCulture collectionbGenBank accession numberc
SubstrateCountryOther collection numbersReferences
tef1 tub2 cmdA rpb2 rpb1
F. acutatum CBS 401.97 MW402124 MW402322 MW402458 MW402813 MW402652 Cajanus cajan IndiaBBA 63520; NRRL 25731This study
CBS 402.97T MW402125 MW402323 MW402459 MW402768 MW402653 EnvironmentalIndiaBBA 69580; FRC O-1117; NRRL 13309This study
CBS 739.97AF160276 MW402348 AF158329MN193883 MW402696 EnvironmentalIndiaBBA 69553; DAOM 225121; FRC O-1116; IMI 375327; NRRL 13308Scauflaire et al. (2011), O’Donnell et al. (2000), Laraba et al. (2020)
CBS 113964 MW401971 MW402172 Triticum aestivum, grains in siloEgyptThis study
CBS 131573 MW402037 MW402236 MW402406 MW402796 MW402565 WheatIranThis study
CBS 137545 MN533987 MN534062 MN534147 MN534228 MW402587 Human nailQatarThis study
CBS 137634 MW402061 MW402260 MW402415 MW402588 Human nailPakistanThis study
CBS 138572 MW402062 MW402261 Human nailIndiaThis study
F. agapanthi CBS 100193 MW401959 MW402160 MW402363 MW402727 MW402491 Agapanthus praecox New ZealandThis study
NRRL 54463TKU900630KU900635KU900611KU900625KU900620Agapanthus sp.Australia Edwards et al. (2016)
NRRL 54464MN193856KU900637KU900613KU900627 MW402718 Agapanthus sp.AustraliaEdwards et al. (2016), Laraba et al. (2020), this study
F. ananatum CBS 118516TLT996091 MN534089 MW402376 LT996137 MW402507 Ananas comosus South AfricaMRC 8165; FCC 2986; CMW 18685Sandoval-Denis et al. (2018a), this study
CBS 118517 MN533988 MN534090 MN534157 MN534229 MW402508 Ananas comosus South AfricaMRC 8166; FCC 2988; CMW 18686This study
CBS 118518 MW401979 MW402179 MW402377 MW402730 Ananas comosus South AfricaMRC 8167; FCC 2990; CMW 18687This study
CBS 118519 MW401980 MW402180 MW402378 MW402731 Ananas comosus South AfricaMRC 8168; FCC 2991; CMW 18688This study
CBS 184.29 MW402105 MW402303 MW402445 MW402809 MW402629 Ananas sativus EnglandDAOM 225144; IMI 375350; NRRL 22945This study
CMW 28597 MW402155 MW402356 MW402483 MW402822 Ananas comosus South AfricaFCC 4251This study
CMW 28598 MW402156 MW402357 MW402484 MW402708 Ananas comosus South AfricaFCC 4252This study
CMW 28599 MW402157 MW402358 MW402485 MW402775 Ananas comosus South AfricaFCC 4253This study
F. andiyazi CBS 119856 MN533989 MN534081 MN534174 MN534286 MW402523 Sorghum grainEthiopiaMRC 8046This study
CBS 119857TMN193854LT996113 MN534175 LT996138 MW402524 Sorghum bicolor soil debrisSouth AfricaFRC M-8413; MRC 6122Laraba et al. (2020), Sandoval-Denis et al. (2018a), this study
F. annulatum CBS 115.97 MW401973 MW402173 MW402373 MW402785 MW402503 Dianthus caryophyllus ItalyCECT 20569This study
CBS 133.95 MW402040 MW402239 MW402407 MW402743 MW402568 Dianthus caryophyllus NetherlandsPD 90/76This study
CBS 134.95 MW402042 MW402241 MW402744 MW402570 Dianthus caryophyllus NetherlandsPD 90/214This study
CBS 135.95 MW402043 MW402242 MW402408 MW402745 MW402571 Dianthus caryophyllus NetherlandsPD 90/1262 aThis study
CBS 153.27 MW402100 MW402299 MW402621 Saccharum officinarum with pokkah boengUnknownThis study
CBS 181.30 MW402102 MW402301 MW402443 MW402625 Zea mays USAMUCL 1130This study
CBS 189.38 MW402110 MW402308 MW402633 UnknownIndiaIMI 035108; MUCL 1129This study
CBS 217.76AF160280U34416AF158333HM068352Cattleya pseudobulb, hybridGermanyBBA 11341; BBA 63624; DAOM 225133; IMI 202873; IMI 375339; NRRL 22944O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011)
CBS 226.49 MW402116 MW402314 MW402452 MW402642 Gossypium seedUnknownThis study
CBS 258.54TMT010994MT011041MT010908MT010983MT010944Oryza sativaNew CaledoniaBBA 63629; IMI 202878; MUCL 8059; NRRL 13619 Yang et al. 2020
CBS 267.93 MN534028 MN534127 MN534221 MN534267 UnknownIndonesiaNRRL 22948This study
CBS 299.96 MW402123 MW402321 MW402457 MW402835 MW402651 Sunflower oil with garlic clovesFranceIAM 14683This study
CBS 531.96 MW402137 MW402337 MW402469 MW402684 soilIvory CoastIAM 14680; NRRL 26424This study
CBS 533.95 MW402138 MW402338 MW402470 MW402817 VanillaUnknownThis study
CBS 620.80 MW402144 MW402344 MW402838 MW402688 Sitobion avenae EnglandNRRL 25054This study
CBS 738.97 MW402147 MW402347 Soil in Zea mays fieldSouth AfricaBBA 69859; FRC M-1636; NRRL 13614This study
CBS 791.91 MW402152 MW402353 MW402480 MW402839 MW402705 Gladiolus NetherlandsThis study
CBS 792.91 MW402153 MW402354 MW402481 MW402774 MW402706 Gladiolus NetherlandsThis study
CBS 116324 MW401975 MW402175 MW402374 MW402824 MW402504 Man, eye, clinical sampleSpainThis study
CBS 119836 MW401988 MW402188 MW402383 MW402732 UnknownUnknownMRC 8550; KSU 4853This study
CBS 119837 MW401989 MW402189 MW402384 MW402517 Corn stalkCaliforniaFRC M-1153; MRC 2301This study
CBS 120996 MW402000 MW402200 MW402391 MW402532 Corn stalkCaliforniaMRC 8549This study
CBS 121447 MW402001 MW402201 MW402828 MW402533 Declined grape vineSyriaThis study
CBS 122158 MW402004 MW402204 MW402829 MW402536 Pinus radiata/Hylurgops palliatus SpainThis study
CBS 125014 MW402013 MW402213 MW402393 MW402544 HumanUSAIHEM 3828This study
CBS 125179 MW402014 MW402214 MW402394 FigsIranEp17This study
CBS 125180 MW402015 MW402215 MW402547 FigsIranEp4This study
CBS 125182 MW402016 MW402216 MW402395 FigsIranThis study
CBS 125183 MW402017 MW402217 MW402396 MW402549 UnknownIranThis study
CBS 125713 MW402018 MW402218 MW402397 MW402737 MW402550 UnknownUnknownThis study
CBS 125714 MW402019 MW402219 MW402830 MW402551 UnknownUnknownThis study
CBS 125716 MW402020 MW402220 MW402398 MW402552 UnknownUnknownThis study
CBS 127316 MW402021 MW402221 MW402399 MW402738 UnknownUnknownThis study
CBS 130179 MW402023 MW402223 MW402400 MW402739 MW402553 Human bloodUSANRRL 43617; UTHSC 03-60This study
CBS 131191 MW402026 MW402225 MW402831 MW402555 UnknownUnknownThis study
CBS 131192 MW402027 MW402226 MW402401 UnknownUnknownThis study
CBS 131256 MW402028 MW402227 MW402402 MW402741 MW402556 UnknownUnknownThis study
CBS 131259 MW402029 MW402228 MW402403 MW402742 MW402557 UnknownUnknownThis study
CBS 131574 MW402038 MW402237 MW402566 WheatIrandH 22560; Z36This study
CBS 131581 MW402039 MW402238 MW402832 MW402567 UnknownUnknownThis study
CBS 135783 MW402052 MW402251 MW402410 MW402579 WheatIranZ31; dH 23109This study
CBS 135791 MW402054 MW402253 MW402411 MW402746 MW402581 UnknownUnknownThis study
CBS 137537 MW402060 MW402259 MW402414 MW402749 MW402586 Human tissuePakistanThis study
CBS 139334 MW402065 MW402264 MW402417 MW402750 MW402592 Human woundPakistanThis study
CBS 139739 MW402074 MW402273 MW402420 MW402754 MW402602 Xylosandrus amputatas galleries in Cinnamonum camphora branchUSAC 3445; BPI 893134This study
CBS 140150 MW402077 MW402276 MW402421 MW402755 MW402605 UnknownUnknownThis study
CBS 140908 MN534027 MN534126 MN534220 MN534266 Rice, grainKazakhstanMFG 58255This study
CBS 140914 MW402078 MW402277 MW402422 MW402805 MW402606 Wheat, grainRussiaMFG 58489This study
CBS 140944 MW402079 MW402278 MW402423 MW402806 Wheat, grainRussiaMFG 58380This study
CBS 143085 MW402084 MW402283 MW402428 Seed of AsparagusNetherlandsNFC 1342This study
CBS 143087 MW402085 MW402284 MW402429 MW402756 MW402611 Seed of AsparagusNetherlandsNFC 1355This study
CBS 143256 MW402086 MW402285 MW402430 MW402757 UnknownUnknownThis study
CBS 143592 MW402088 MW402287 MW402431 MW402758 MW402613 Stereum hirsutum IranCPC 30839; TuPo1This study
CBS 143594 MW402089 MW402288 Stereum hirsutum IranCPC 30842; TuPo5This study
CBS 143599 MW402090 MW402289 SmutIranCPC 30851; MoSm7This study
CBS 143601 MW402091 MW402290 MW402432 MW402808 SmutIranCPC 30853; MoSm16-1This study
CBS 143602 MW402092 MW402291 MW402433 MW402759 MW402614 SmutIranCPC 30854; MoSm16-2This study
CBS 143604 MW402093 MW402292 MW402434 MW402833 SmutIranCPC 30856; MoSm18-1This study
CBS 143605 MW402094 MW402293 MW402435 MW402760 MW402615 SmutIranCPC 30857; MoSm18-2This study
NRRL 62905MN193865MN193893 MW402722 Zea mays kernelUSALaraba et al. (2020), this study
F. anthophilum CBS 108.92 MW401965 MW402166 MW402368 MW402783 MW402498 Hippeastrum leafNetherlandsNRRL 25062; PD 91/2109This study
CBS 136.95 MW402058 MW402257 MW402801 MW402584 Amaryllis NetherlandsPD 91/2109-2This study
CBS 119858 MN533990 MN534091 MN534158 MN534232 MW402525 EnvironmentalUSAThis study
CBS 119859 MN533991 MN534092 MN534164 MN534233 MW402526 Cymbidium sp. leaf spotNew ZealandThis study
CBS 222.76ET MW402114 MW402312 MW402451 MW402811 MW402641 Euphorbia pulcherrima stemGermanyBBA 63270; IMI 196084; IMI 202880; NRRL 22943; NRRL 25216This study
CBS 737.97 MN533992 MN534093 MN534160 MN534234 MW402695 Hippeastrum sp.GermanyNRRL 13602This study
NRRL 25214MN193857 MN193885 MW402710 Hippeastrum sp.Germany Laraba et al. (2020)
F. awaxy CBS 119831 MN534056 MN534108 MN534167 MN534237 MW402514 EnvironmentalNew GuineaThis study
CBS 119832 MN534057 MN534106 MN534170 MN534240 MW402515 UnknownUnknownMRC 8553; KSU 990This study
CBS 139380 MN534058 MN534107 MN534172 MN534238 MW402597 Corn stalkUSAATCC 201270; FGSC 7616This study
LGMF 1661MG838954MG839011MK766939Rotten stalks of Zea maysBrazilCMRP4003 Crous et al. (2019b)
LGMF 1930TMG839004MG839013MK766940MK766941Rotten stalks of Zea maysBrazilCMRP4013 Crous et al. (2019b)
NRRL 13827MH582309MH582073Corn cobSouth AfricaNRRL 13601; MRC115 O’Donnell et al. (2018)
F. bactridioides CBS 100057T MN533993 MN534112 MN534173 MN534235 MW402490 Cronartium conigenum on Pinus leiophyllaUSABBA 4748; BBA 63602; DAOM 225115; IMI 375323; NRRL 22201This study
NRRL 20476AF160290U34434AF158343 Cronartium conigenum USAO’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. begoniae CBS 403.97MN193858U61543 MW402460 MN193886 MW402654 Begonia elatior hybridGermanyBBA 67781; DAOM 225116; IMI 375315; NRRL 25300Laraba et al. (2020), O’Donnell et al. (1998)
CBS 452.97T MN533994 MN534101 MN534163 MN534243 MW402675 Begonia elatior hybridGermanyNRRL 25315; BBA 69131; IMI 376114This study
CBS 110282 MW401968 MW402169 Begonia elatior hybridNetherlandsNRRL 31851; PD 2001/5404This study
CBS 110283 MW401969 MW402170 MW402370 MW402784 MW402500 Begonia elatior hybridNetherlandsNRRL 31848; PD 2001/514This study
F. brevicatenulatum CBS 404.97T MN533995 MN534063 MN534295 MW402655 Striga asiatica MadagascarNRRL 25446; BBA 69197; IMI 375329; DAOM 225122This study
CBS 100196MN193859MN193887 MW402492 Striga asiatica MadagascarBBA 69198; NRRL 25447Laraba et al. (2020), this study
F. bulbicola CBS 220.76TKF466415KF466437 MW402450 MW402767 Nerine bowdenii bulbNetherlandsBBA 12293; BBA 63628; DAOM 225114; IMI 202877; IMI 375322; NRRL 13618Proctor et al. (2013), this study
F. chinhoyiense NRRL 25221T MN534050 MN534082 MN534196 MN534262 MW402711 Zea mays ZimbabweBBA 69031This study
NY 001B5 MN534051 MN534083 MN534197 MN534263 MW402725 SoilSouth AfricaThis study
F. circinatum CBS 405.97T MN533997 MN534097 MN534199 MN534252 MW402656 Pinus radiata USABBA 69720; DAOM 225113; IMI 375321; MRC 7541; NRRL 25331This study
CBS 100197 MW401960 MW402161 MW402364 MW402493 Pinus taeda GeorgiaBBA 69721; NRRL 25332This study
CBS 117843 MW401978 MW402178 MW402786 MW402506 Pinus radiata SpainThis study
CBS 119864 MW401996 MW402196 MW402389 MW402736 MW402528 Pinus patula South AfricaMRC 7488; FGSC 9022This study
CBS 119865 MW401997 MW402197 Pinus patula South AfricaMRC 6213; FGSC 9023; KSU 10850This study
CBS 122161 MW402005 MW402205 MW402537 Pinus radiata/Brachyderes incanus SpainThis study
CBS 122162 MW402006 MW402206 MW402538 Pinus radiata/Hylurgops palliatus SpainThis study
CBS 122163 MW402007 MW402207 MW402539 Pinus radiata/Hylurgops palliatus SpainThis study
CBS 122164 MW402008 MW402208 MW402790 MW402540 Pinus radiata/Hypothenemus eruditus SpainThis study
CBS 122165 MW402009 MW402209 MW402541 Pinus radiata/Hylastes attenuatus SpainMRC 6213; FGSC 9023This study
CBS 122448 MW402010 MW402210 Pinus radiata/Hylurgops palliatus SpainThis study
CBS 138821 MW402063 MW402262 MW402589 Pinus sp.USACMW 41611; CMWF1954This study
CBS 138822 MN533996 MN534096 MN534251 MW402590 UnknownUnknownThis study
CBS 141668 MW402081 MW402280 MW402425 MW402608 UnknownUnknownThis study
CBS 141670 MW402082 MW402281 MW402426 MW402609 UnknownUnknownThis study
CBS 141671 MW402083 MW402282 MW402427 MW402807 MW402610 UnknownUnknownThis study
F. coicis NRRL 66233TKP083251LT996115LT996178KP083274 Coix gasteenii AustraliaLaurence et al. (2016), Sandoval-Denis et al. (2018a)
F. concentricum CBS 450.97TAF160282 MW402334 MW402467 JF741086 MW402674 Musa fruitCosta Rica (bought at Berlin market)BBA 64354; CBS 833.85; DAOM 225146; IMI 375352; NRRL 25181O’Donnell et al. (2000, 2012), this study
CBS 453.97 MN533998 MN534123 MN534216 MN534264 MW402676 Musa sapientum GuatemalaBBA 69857; NRRL 25668This study
CBS 102157 MW401963 MW402164 MW402367 MW402728 MW402496 Macaranga pruinosa stem, colonized by antsMalaysiaThis study
F. denticulatum CBS 406.97 MN533999 MN534067 MN534185 MN534273 MW402657 Ipomoea batatas CubaNRRL 25189; BBA 65244This study
CBS 407.97T MN534000 MN534068 MN534186 MN534274 MW402658 Ipomoea batatas USANRRL 25311; BBA 67772; CC F89-22; IMI 376115This study
CBS 735.97AF160269U61550AF158322LT996143 Ipomoea batatas North CarolinaBBA 67769; DAOM 225112; IMI 375320; NRRL 25302O’Donnell et al. (1998, 2000), Sandoval-Denis et al. (2018a)
F. dlaminii CBS 175.88 MN534002 MN534138 MN534150 MN534256 MW402623 Zea mays soilSouth AfricaNRRL 13164; FRC M-1637; ATCC 58097; BBA 69859; IMI 375348; DAOM 225120This study
CBS 481.94 MN534003 MN534139 MN534151 MN534257 MW402679 UnknownUnknownThis study
CBS 671.94 MN534004 MN534136 MN534152 MN534254 MW402690 SoilSouth AfricaBBA 69046; MRC 3023This study
CBS 672.94 MN534005 MN534137 MN534153 MN534255 MW402691 SoilSouth AfricaBBA 69047; MRC 3024This study
CBS 119860T MW401995 MW402195 MW402388 KU171701KU171681Plant debris in soilSouth AfricaBBA 69859; FRC M-1637; MRC 3032; NRRL 13164Sandoval-Denis et al. (2018a), this study
CBS 119861 MN534001 MN534135 MN534149 MN534253 MW402527 Plant debris in soilSouth AfricaBBA 69026; FRC M-1557; MRC 3023; NRRL 25442This study
F. ficicrescens CBS 125177 MN534006 MN534071 MN534176 MN534281 MW402545 EnvironmentalIranThis study
CBS 125178TKU604452KP662896KU603958KT154002 MW402546 EnvironmentalIranAl-Hatmi et al. (2016b, 2019), this study
CBS 125181 MN534007 MN534072 MN534177 MN534282 MW402548 EnvironmentalIranThis study
F. fracticaudum CMW 25245TPDNT00000000PDNT00000000PDNT00000000PDNT00000000PDNT00000000 Pinus maximinoi Colombia Wingfield et al. (2018)
F. fractiflexum NRRL 28852TAF160288AF160315AF158341LT575064Cymbidium sp.JapanO’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. fredkrugeri CBS 408.97 MW402126 MW402324 MW402461 MW402814 SoilMarylandBBA 69727; NRRL 25355This study
CBS 144209TLT996097LT996118LT996181LT996147LT996199Melhania acuminata rhizophereSouth AfricaCPC 33747 Sandoval-Denis et al. (2018a)
CBS 144495LT996096LT996117LT996180LT996146LT996198Melhania acuminata rhizophereSouth AfricaCPC 33746 Sandoval-Denis et al. (2018a)
NRRL 26152 MW402159 MW402778 MW402714 Striga hermonthica NigerBBA 70170This study
F. fujikuroi CBS 186.56 MW402108 MW402306 MW402447 MW402765 MW402632 UnknownUnknownATCC 14164; BBA 11321; IMI 112801; NRRL 2284This study
CBS 195.34 MW402111 MW402309 MW402634 Saccharum officinarum TaiwanThis study
CBS 221.76T MN534010 MN534130 KU604255 MW402640 Oryza sativa culmTaiwanBBA 12428; BBA 63630; IHEM 3821; IMI 196086; IMI 202879; LCP 58.3353; NRRL 13620; NRRL 13998; NRRL 22174Al-Hatmi et al. (2016a), this study
CBS 240.64 MW402117 MW402315 MW402643 Oryza sativa JapanThis study
CBS 257.52 MW402119 MW402317 MW402454 MW402812 MW402645 Oryza sativa seedlingJapanThis study
CBS 262.54 MW402120 MW402318 MW402647 Oryza sativa IndiaBRL 1001; IMI 058291This study
CBS 263.54 MW402121 MW402319 MW402648 Avena sativa IndiaATCC 10052; BRL 1004; IFO 6349; IMI 058292; NRRL 2374; QM 1224This study
CBS 264.54 MW402122 MW402320 MW402456 MW402649 Oryza sativa UnknownATCC 12617; BRL 1135; IMI 058293This study
CBS 265.54 MN534011 MN534132 MN534222 MN534268 MW402650 Oryza sativa UnknownATCC 12618; BRL 1139; IMI 058294This study
CBS 440.64 MW402132 MW402331 MW402670 UnknownJapanThis study
CBS 449.95 MW402134 MW402333 MW402672 EnvironmentalFranceThis study
CBS 530.95 MW402135 MW402335 UnknownUnknownThis study
CBS 119854 MW401993 MW402193 UnknownUnknownBBA 63873; MRC 1836This study
CBS 119855 MW401994 MW402194 MW402387 MW402735 EnvironmentalUnknownFRC M-1148; MRC 8532This study
CBS 121864 MW402003 MW402203 MW402535 EnvironmentalNetherlandsFRC M1150; MRC 8534This study
CBS 130402 MW402025 MN534131 MN534223 MN534269 Human skinUSAThis study
NRRL 5538MN193860 MN193888 MW402719 UnknownUnknownLaraba et al. (2020), this study
NRRL 13289 MW402158 MW402777 UnknownUnknownFRC M-1138; from NRRL 6322This study
NRRL 13566AF160279U34415AF158332JX171570 Oryza sativa ChinaO’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013)
F. globosum CBS 428.97TKF466417 MN534124 MN534218 KF466406 MW402668 Zea mays seedSouth AfricaNRRL 26131Proctor et al. (2013), this study
CBS 429.97 MW402130 MW402329 Zea mays seedSouth AfricaMRC 6648; NRRL 26132This study
CBS 430.97 MN534013 MN534125 MN534219 MN534265 Zea mays seedSouth AfricaNRRL 26133This study
CBS 431.97 MW402131 MW402330 MW402465 MW402816 MW402669 Zea mays seedSouth AfricaMRC 6660; NRRL 26134This study
CBS 120992 MW401998 MW402198 MW402390 MW402788 MW402529 Maize kernelsSouth AfricaFRC M-8014; MRC 6648; NRRL 26132This study
F. guttiforme CBS 409.97TMT010999MT011048MT010901MT010967MT010938 Ananas comosus BrazilNRRL 25295; IMI 376113; BBA 69661; S1832 GJS0290This study
NRRL 22945AF160297U34420AF158350JX171618JX171505 Ananas comosus EnglandO’Donnell & Cigelnik (1997), O’Donnell et al. (2000, 2013)
F. konzum CBS 119847 MW401990 MW402190 MW402385 MW402518 UnknownUnknownMRC 8545This study
CBS 119848 MW401991 MW402191 UnknownUnknownMRC 8544This study
CBS 119849TLT996098 MN534095 LT996182 MW402733 MW402519 Sorghastrum nuttans USAMRC 8427Sandoval-Denis et al. (2018a), this study
CBS 139382 MW402071 MW402270 MW402418 MW402804 MW402598 Derived from a cross of KSU 11615 and KSU 10653UnknownATCC MYA-2885; FGSC 8910; KSU 11616This study
CBS 139383 MN534014 MN534094 MN534200 MN534244 MW402599 Derived from a cross of KSU 10653 and KSU 10595UnknownATCC MYA-2884; FGSC 8911; KSU 11615This study
F. lactis CBS 411.97ETMN193862 MN534077 MN534178 MN534275 MW402659 Ficus carica USANRRL 25200Laraba et al. (2020), this study
CBS 420.97 MN534015 MN534078 MN534181 MN534296 MW402667 Ficus carica USANRRL 25338; TM F13; BBA 68591This study
F. longicornicola NRRL 52706T JF740788 MW402360 MW402487 JF741114InsectEthiopiaCBS 147247; ARSEF 6455O’Donnell et al. (2012), this study
NRRL 52712 JF740794 MW402361 MW402488 JF741120 MW402716 InsectEthiopiaCBS 147248; ARSEF 6451O’Donnell et al. (2012), this study
NRRL 52713 JF740795 MW402362 MW402489 JF741121 MW402717 InsectEthiopiaCBS 147249; ARSEF 6446O’Donnell et al. (2012), this study
F. lumajangense InaCCF872TLS479441LS479433LS479850Musa sp. var. Pisang Raja NangkaIndonesia Maryani et al. (2019a)
InaCCF993LS479442LS479434LS479851Musa acuminata var. Pisang Mas KiranaIndonesia Maryani et al. (2019a)
F. madaense CBS 146648 MW402095 MW402294 MW402436 MW402761 MW402616 Arachis hypogaea NigeriaCPC 38321This study
CBS 146651 MW402096 MW402295 MW402437 MW402762 MW402617 SorghumNigeriaCPC 38324This study
CBS 146656 MW402097 MW402296 MW402438 MW402763 MW402618 Arachis hypogaea NigeriaCPC 38330This study
CBS 146669T MW402098 MW402297 MW402439 MW402764 MW402619 Arachis hypogaea NigeriaCPC 38344This study
F. mangiferae CBS 119853 MN534016 MN534140 MN534225 MN534270 MW402522 Mango with malformation diseaseSouth AfricaMRC 2730This study
CBS 120994T MN534017 MN534128 MN534224 MN534271 MW402530 Mango with malformation diseaseIsraelMRC 7559; MRC 8432This study
NRRL 25226AF160281U61561AF158334HM068353 MW402712 Mangifera indica IsraelO’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Smith et al. (2011)
F. marasasianum CMW 25512UnpublishedUnpublishedUnpublishedUnpublishedUnpublished Pinus tecunumanii ColombiaUnpublished
F. mexicanum NRRL 47473GU737416GU737308GU737389LR792615LR792579Mangifera indica inflorescenceMexico Otero-Colina et al. (2010)
NRRL 53145GU737280GU737492UnknownUnknown Otero-Colina et al. (2010)
NRRL 53147TGU737282GU737494MN724973MG838088 Mangifera indica MexicoOtero-Colina et al. (2010), Santillán-Mendoza et al. (2018)
NRRL 53571GU737420GU737312GU737393 Mangifera indica Mexico Otero-Colina et al. (2010)
NRRL 53575GU737286GU737498 Mangifera indica Mexico Otero-Colina et al. (2010)
NRRL 53580GU737421GU737313GU737394 Mangifera indica Mexico Otero-Colina et al. (2010)
F. mundagurra RGB5717TKP083256 MN534146 MN534214 KP083276SoilAustraliaNRRL 66235Laurence et al. (2016), this study
F. musae CBS 624.87TFN552086FN545368 MW402474 MW402772 MW402689 Musa sapientum fruitHondurasNRRL 25059Van Hove et al. (2011), this study
CBS 115315 MW401974 MW402174 Man, Tinea corporisGreeceEMD 13This study
NRRL 28893FN552092FN545374FN552070FN552114Musa sp.Mexico Van Hove et al. (2011)
F. napiforme CBS 674.94 MW402145 MW402345 MW402475 MW402692 UnknownUnknownBBA 67630This study
CBS 748.97T MN193863 MN534085 MN534192 MN534291 MW402701 Pennisetum typhoides NamibiaNRRL 13604Laraba et al. (2020), this study
CBS 135139 MN534019 MN534084 MN534183 MN534290 MW402572 Keratitis (Human)IndiaThis study
CBS 135140 MW402044 MW402243 Clinical (keratitis)IndiaThis study
CBS 135141 MW402045 MW402244 MW402797 MW402573 ClinicalUnknownThis study
NRRL 25196 MN193863 MN193891 MW402709 Pennisetum typhoides South AfricaBBA 67629; FRC M-3560 Laraba et al. (2020)
F. nirenbergiae CBS 744.97AF160312U34424AF158365LT575065UnknownUnknownO’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a)
F. nygamai CBS 140.95 MW402075 MW402274 EF470127 MW402603 Human, immunocompromised bloodEgyptNRRL 26421O’Donnell et al. (2007), this study
CBS 413.97 MW402127 MW402325 MW402462 MW402815 MW402660 Oryza sativa MoroccoBBA 63175; NRRL 25449This study
CBS 572.94 MW402141 MW402341 MW402473 MW402819 Cajanus indicus IndiaBBA 64375This study
CBS 749.97T MW402151 MW402352 MW402479 EF470114 MW402703 Sorghum bicolor necrotic rootNew South WalesATCC 58555; BBA 69862; DAOM 225148; FRC M-1375; IMI 375354; NRRL 13448O’Donnell et al. (2007), this study
CBS 834.85 MW402154 MW402355 MW402482 MW402821 MW402707 Cajanus cajan IndiaBBA 64375; NRRL 22106; NRRL 25312This study
CBS 119852 MW401992 MW402192 MW402386 MW402734 MW402521 UnknownUnknownMRC 8547This study
CBS 120995 MW401999 MW402199 MW402531 Sorghum rootAustraliaMRC 8546This study
CBS 131377 MW402035 MW402234 MW402405 MW402562 EnvironmentalAustraliaThis study
CBS 139386 MW402072 MW402271 MW402600 UnknownUnknownFGSC 8933; FRC M-7491This study
CBS 139387 MW402073 MW402272 MW402419 MW402753 MW402601 UnknownUnknownFGSC 8934; FRC M-7492This study
F. ophioides CBS 118509 MN534116 MN534207 MN534297 Phragmites mauritianus South AfricaCMW 18678; MRC 6748; FCC 1092This study
CBS 118510 MN534020 MN534121 MN534201 MN534301 Panicum maximum South AfricaCMW18679; MRC 6747; FCC 1093This study
CBS 118511 MN534021 MN534122 MN534204 MN534299 Panicum maximum South AfricaThis study
CBS 118512T MN534022 MN534118 MN534209 MN534303 Panicum maximum South AfricaCMW 18681; FCC 2979; FCC 2980; MRC 6744This study
CBS 118513 MN534023 MN534119 MN534202 MN534300 Panicum maximum South AfricaThis study
CBS 118514 MN534024 MN534117 MN534206 MN534302 Panicum maximum South AfricaThis study
CBS 118515 MN534025 MN534120 MN534205 MN534298 Panicum maximum South AfricaThis study
NRRL 26756AF160307AF160322AF158360Ornamental grassSouth Africa O’Donnell et al. (2000)
NRRL 26757AF160308AF160323AF158361Ornamental reedSouth Africa O’Donnell et al. (2000)
F. parvisorum CMW 25267TKJ541060KJ541055 Pinus patula ColombiaCBS 137236; FCC 5407 Herron et al. (2015)
F. phyllophilum CBS 216.76TMN193864KF466443KF466333KF466410 MW402637 Dracaena deremensis leafItalyBBA 11730; BBA 63625; DAOM 225132; IMI 202874; IMI 375338; NRRL 13617Laraba et al. (2020), Proctor et al. (2013)
CBS 246.61 MW402118 MW402316 MW402453 MW402644 Leaf spot in Sansevieria dooneriGermanyBBA 7983; NRRL 25053This study
F. pilosicola NRRL 29123 MN534054 MN534098 MN534165 MN534247 Bidens pilosa USAThis study
NRRL 29124T MN534055 MN534099 MN534159 MN534248 Bidens pilosa USAThis study
F. pininemorale CMW 25243NFZR00000000NFZR00000000NFZR00000000NFZR00000000NFZR00000000 Pinus tecunumanii Colombia Wingfield et al. (2017)
F. proliferatum CBS 480.96ET MN534059 MN534129 MN534217 MN534272 Tropical rain forest soilPapua New GuineaNRRL 26427; IAM 14682; NY007.B6This study
F. pseudoanthophilum CBS 414.97T MW402128 MW402326 MW402463 MW402661 Zea mays ZimbabweBBA 69002; IMI 376112; NRRL 25211This study
CBS 415.97 MW402129 MW402327 MW402662 Zea mays ZimbabweBBA 69003; NRRL 25209This study
CBS 745.97 MW402148 MW402349 MW402476 MW402820 MW402697 Zea mays ZimbabweBBA 69030; DAOM 225134; IMI 375340; NRRL 25206This study
CBS 746.97 MW402149 MW402350 MW402477 MW402698 Zea mays ZimbabweBBA 70129; IMI 375341; NRRL 26063This study
F. pseudocircinatum CBS 449.97TAF160271 MN534069 MN534190 MN534277 MW402673 Solanum sp.GhanaNRRL 22946; CBS 126.73; IMI 375316; BBA 69636; DAOM 225117O’Donnell et al. (2000), this study
CBS 455.97 MN534029 MN534070 MN534184 MN534276 Heteropsylla incisa Papua New GuineaNRRL 25034; ARSEF 2301; FRC M-3856; BBA 69598This study
NRRL 36939MN193866 MW402779 MW402715 UnknownUnknownThis study
F. pseudonygamai CBS 416.97 MN534030 MN534064 MN534194 MN534283 MW402663 Pennisetum typhoides NigeriaNRRL 6022; BBA 69551; MRC 1412This study
CBS 417.97TAF160263 MN534066 AF158316 MN534285 MW402664 Pennisetum typhoides NigeriaNRRL 13592; FRC M-1166; BBA 69552; IMI 375342; DAOM 225136O’Donnell et al. (2000), this study
CBS 484.94 MN534031 MN534065 MN534195 MN534284 MW402681 SoilAustraliaFRC M-1034This study
F. ramigenum CBS 418.97TKF466423 MN534145 MN534187 KF466412 MW402665 Ficus carica USANRRL 25208Proctor et al. (2013), this study
CBS 526.97 MN534032 MN534086 MN534188 MN534292 MW402682 Ficus carica USANRRL 25212; BBA 68593; TM F62This study
F. sacchari CBS 134.73 MW402041 MW402240 MW402569 Saccharum officinarum GuyanaATCC 24390; IMI 165537a; NRRL 25061This study
CBS 147.25 MW402099 MW402298 MW402440 MW402620 UnknownUnknownBBA 69863; DAOM 225140; IMI 375345; NRRL 20471This study
CBS 183.32 MW402104 MW402302 MW402628 Saccharum officinarum UnknownThis study
CBS 185.33 MW402106 MW402304 MW402630 Saccharum officinarum IndiaThis study
CBS 186.33 MW402107 MW402305 MW402446 MW402631 Saccharum officinarum with pokkah boeng red stripesUnknownThis study
CBS 201.37 MW402112 MW402310 MW402635 UnknownUnknownThis study
CBS 223.76ET MW402115 MW402313 AF158331JX171580 Saccharum officinarum IndiaBBA 63340; DAOM 225138; IMI 202881; NRRL 13999O’Donnell et al. (2000, 2013), this study
CBS 119828 MW401984 MW402184 MW402513 UnknownUnknownMRC 8551This study
CBS 119829 MW401985 MW402185 UnknownUnknownFRC M-3127; MRC 8447; NRRL 20957This study
CBS 119830 MW401986 MW402186 MW402381 UnknownUnknownMRC 8552This study
CBS 121683 MW402002 MW402202 MW402789 MW402534 Man, fungal endophthalmyitis of male patientIndiaThis study
CBS 131369 MW402030 MW402229 MW402792 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 131370 MW402031 MW402230 MW402404 MW402793 MW402558 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 131371 MW402032 MW402231 MW402559 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 131372 MN534033 MN534134 MN534226 MN534293 MW402560 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 131373 MW402033 MW402232 MW402794 MW402561 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 131374 MW402034 MW402233 MW402795 Oryzae australiensis, stem, first node above soilAustraliaThis study
CBS 135142 MW402046 MW402245 MW402798 Clinical (corneal ulcer)IndiaThis study
CBS 135143 MW402047 MW402246 MW402409 MW402799 Clinical (corneal ulcer)IndiaThis study
CBS 135144 MW402048 MW402247 MW402574 Clinical (corneal ulcer)IndiaThis study
CBS 135145 MW402049 MW402248 Clinical (corneal ulcer)IndiaThis study
CBS 139373 MW402066 MW402265 MW402751 MW402593 UnknownUnknownThis study
CBS 139376 MW402069 MW402268 MW402803 MW402596 lab strain: progeny of ATCC 201262 and ATCC 201263USAATCC 201264; FGSC 7610This study
CBS 139377 MW402070 MW402269 lab strain: progeny of ATCC 201262 and ATCC 201263USAATCC 201265; FGSC 7611This study
InaCC F950LS479435LS479852Musa sp. var. Pisang KepokIndonesia Maryani et al. (2019a)
InaCC F951LS479437LS479854Musa sp. var. Pisang KepokIndonesia Maryani et al. (2019a)
InaCC F952LS479436LS479853Musa sp. var. Pisang KepokIndonesia Maryani et al. (2019a)
NRRL 66326MN193868MN193896 MW402723 UnknownUnknownLaraba et al. (2020), this study
NY 001E9 MN534034 MN534133 MN534227 MN534294 MW402726 Organic bananaSouth AfricaThis study
F. secorum NRRL 62593TKJ189225KJ189235 Beta vulgaris USA Secor et al. (2014)
NRRL 62594KJ189228KJ189238 Beta vulgaris USA Secor et al. (2014)
F. siculi CBS 142222TLT746214LT746346LT746189LT746327 Citrus sinensis ItalyCPC 27188 Sandoval-Denis et al. (2018b)
CPC 27189LT746215LT746347LT746190LT746328 Citrus sinensis Italy Sandoval-Denis et al. (2018b)
F. sororula CMW 25513UnpublishedUnpublishedUnpublishedUnpublishedUnpublished Pinus tecunumanii ColombiaUnpublished
F. sterilihyposum NRRL 25623TMN193869AF160316AF158353MN193897 MW402713 MangoSouth AfricaO’Donnell et al. (2000), Laraba et al. (2020)
NRRL 53991GU737413GU737305GU737386 Mangifera indica BrazilCML 282; KSU 16215 Otero-Colina et al. (2010)
NRRL 53997GU737414GU737306GU737387 Mangifera indica BrazilCML 401; KSU 16240 Otero-Colina et al. (2010)
NRRL 54011GU737415GU737307GU737388UnknownUnknown Otero-Colina et al. (2010)
F. subglutinans CBS 215.76 MN534061 MN534109 MN534171 MN534241 MW402636 Zea mays GermanyNRRL 20844; BBA 10351; BBA 62621This study
CBS 479.94 MN534036 MN534105 MN534105 MN534236 MW402678 Zea mays kernelSouth AfricaMRC 5655This study
CBS 536.95 MW402139 MW402339 MW402471 MW402836 MW402685 UnknownUnknownThis study
CBS 747.97NT MW402150 MW402351 MW402478 MW402773 MW402700 Zea mays IllinoisBBA 62451; DAOM 225141; FRC M-36; MRC 8554; NRRL 22016; NRRL 22114This study
CBS 136481 MW402059 MW402258 MW402413 MW402748 MW402585 Human bloodItalyNRRL 54158; IUM 96-4102This study
NRRL 66333MN193870MN193898UnknownUnknown Laraba et al. (2020)
F. succisae CBS 187.34 MW402109 MW402307 MW402448 MW402810 Zostera marina UKNRRL 22942This study
CBS 219.76ETAF160291U34419AF158344 MW402766 MW402639 Succisa pratensis flowerGermanyBBA 12287; BBA 63627; DAOM 225142; IMI 202876; NRRL 13613O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), this study
F. sudanense CBS 454.97T MN534037 MN534073 MN534179 MN534278 MW402677 Striga hermonthica SudanNRRL 25451This study
CBS 675.94 MN534038 MN534074 MN534182 MN534279 MW402693 Striga hermonthica SudanBBA 65862This study
F. temperatum CBS 135538 MN534039 MN534111 MN534168 MN534239 MW402575 Pulmonary infection (Human)MexicoThis study
CBS 135539 MN534040 MN534110 MN534169 MN534242 MW402576 Pulmonary infection (Human)MexicoThis study
CBS 135540 MW402050 MW402249 MW402577 Human, mycotic keratitisMexicoThis study
CBS 135541 MW402051 MW402250 MW402578 Human, keratitisMexicoThis study
MUCL 52463T MW402359 MW402486 MW402776 Zea mays BelgiumThis study
NRRL 25622AF160301AF160317AF158354LT970765 Zea mays South AfricaNRRL 26616; MUCL 51714 O’Donnell et al. (2000)
F. terricola CBS 483.94T MN534042 MN534076 MN534189 LT996156 MW402680 SoilAustraliaSandoval-Denis et al. (2018a), this study
CBS 119850 MN534041 MN534075 MN534180 MN534280 MW402520 SoilAustraliaThis study
F. thapsinum CBS 539.79 MW402140 MW402340 MW402472 MW402818 MW402686 Man, white grained mycetomaItalyCDC B-2671aThis study
CBS 733.97 MN534043 MN534079 MN534191 JX171600 Sorghum bicolor South AfricaNRRL 22045O’Donnell et al. (2013), this study
CBS 776.96T MN534044 MN534080 MN534289 MW402704 UnknownUnknownATCC 200521; BBA 69583; FGSC 7056; FRC M-6563; NRRL 22049This study
CBS 100312 MW401961 MW402162 MW402365 MW402780 MW402494 UnknownUnknownATCC 16263This study
CBS 100313 MW401962 MW402163 MW402366 MW402781 MW402495 Contaminant of CBS 100310UnknownThis study
CBS 109077 MW401967 MW402168 MW402369 MW402499 Sorghum seedsEthiopiaThis study
CBS 113963 MW401970 MW402171 MW402371 MW402501 Pennisetum YemenThis study
CBS 119833 MW401987 MW402187 MW402382 MW402787 MW402516 EnvironmentalUSABBA 70187; FRC M-6564; MRC 8558This study
CBS 130176 MW402022 MW402222 Human mycetomaItalyNRRL 25229; IMI 240460This study
CBS 135920 MW402056 MW402255 MW402582 UnknownUnknownThis study
CBS 135921 MW402057 MW402256 MW402412 MW402800 MW402583 Black biofilm, sink drainGermanyThis study
F. tjaetaba NRRL 66243TKP083263GU737296LT996187KP083275 Sorghum interjectum AustraliaOtero-Colina et al. (2010), Laurence et al. (2016), Sandoval-Denis et al. (2018a)
F. tupiense CML345DQ452861DQ445783 Mangifera indica BrazilKSU 16217; CMM 3656; CMR-UB 22069; BPI 883545 Lima et al. (2012)
NRRL 53984TGU737404GU737296GU737377LR792619LR792583 Mangifera indica BrazilCML 262; KSU 16195; CMM 3655 Otero-Colina et al. (2010)
NRRL 53996DQ452860DQ445782 Mangifera indica BrazilCML 389; KSU 16233; NRRL 53996; CMM 3657; CMR-UB 22070; BPI 883544 Lima et al. (2012)
F. udum CBS 178.32AF160275U34433 MW402442 LT996172 MW402624 UnknownNetherlandsBBA 1813; DAOM 225111; IMI 375319; NRRL 22949O’Donnell & Cigelnik (1997), O’Donnell et al. (2000), Sandoval-Denis et al. (2018a), this study
CBS 419.97 MW402328 MW402464 MW402769 MW402666 Crotolaria juncea IndiaBBA 65056; NRRL 25192This study
CBS 747.79MN193872MN534141 MN534154 MN534258 MW402699 Cajanus cajan IndiaBBA 62451; NRRL 25194Laraba et al. (2020), this study
NRRL 25199ETKY498862KY498892KY498875 Cajanus cajan IndiaBBA 65058 Pfenning et al. (2019)
F. verticillioides CBS 117.28 MW401977 MW402177 MW402729 MW402505 UnknownFranceMUCL 29451; CBS H-9165This study
CBS 125.73 MW402012 MW402212 MW402392 MW402791 MW402543 Trichosanthes dioica IndiaATCC 24378; IMI 158047; NRRL 25057This study
CBS 139.40 MW402064 MW402263 MW402416 MW402591 Phyllocactus hybridus ItalyNRRL 25056This study
CBS 141.59 MW402080 MW402279 MW402424 MW402607 UnknownUnknownThis study
CBS 167.87 MW402101 MW402300 MW402441 MW402834 MW402622 Pinus seedUSANRRL 25058This study
CBS 181.31 MW402103 MW402444 MW402626 Musa sapientum Central AmericaNRRL 29294This study
CBS 218.76ET MW402113 MW402311 MW402449 MW402638 Zea mays stemGermanyBBA 11782; DSM 62264; IMI 202875; NRRL 13993This study
CBS 447.95 MW402133 MW402332 MW402466 MW402770 MW402671 AsparagusUnknownThis study
CBS 531.95 MW402136 MW402336 MW402468 MW402771 MW402683 Zea mays UnknownThis study
CBS 576.78 MW402142 MW402342 MW402687 MycophilicUSSRNRRL 22950; VKM F-257This study
CBS 579.78 MW402143 MW402343 MW402837 HumanUSANRRL 25055This study
CBS 734.97 MW402146 MW402346 AF158315 EF470122 MW402694 Zea mays GermanyBBA 62264; IMI 375318; NRRL 22172O’Donnell et al. (2000, 2007), this study
CBS 102699 MW401964 MW402165 MW402782 MW402497 Abdominal drain (liver transplant)GermanyThis study
CBS 108922 MW401966 MW402167 MW402823 Human, urineGermanyThis study
CBS 114759 MW401972 MW402372 MW402502 UnknownUnknownThis study
CBS 116665 MW401976 MW402176 MW402375 MW402825 TomatoUnknownThis study
CBS 119664 MW401981 MW402181 MW402379 MW402509 Maize/Corn (Baxxita), HuskSwitzerlandThis study
CBS 119825 MW401982 MW402182 MW402380 MW402826 MW402510 Maize kernelsSouth AfricaFRC M-1325; MRC 826; NRRL 20960This study
CBS 119826 MW401983 MW402183 MW402827 MW402511 UnknownUnknownMRC 8559This study
CBS 119827 MN534046 MN534087 MN534215 MN534287 MW402512 UnknownUnknownMRC 8560This study
CBS 123670 MW402011 MW402211 MN193901 MW402542 Zea mays USAFRC M-3125; NRRL 20956Laraba et al. (2020), this study
CBS 130180 MW402024 MW402224 MW402740 MW402554 Human peritoneal fluidUSANRRL 43608; UTHSC 03-2552This study
CBS 131389 MN534047 MN534088 MN534193 MN534288 MW402563 EnvironmentalAustraliaThis study
CBS 131390 MW402036 MW402235 MW402564 Wheat rootAustraliaThis study
CBS 135790 MW402053 MW402252 MW402580 UnknownUnknownThis study
CBS 135792 MW402055 MW402254 MW402747 UnknownUnknownThis study
CBS 139374 MW402067 MW402266 MW402752 MW402594 UnknownUnknownMPMI 8(1) 74-84; FGSC 7600This study
CBS 139375 MW402068 MW402267 MW402802 MW402595 Corn stalkUSAATCC 201261; FGSC 7603This study
CBS 140031 MW402076 MW402275 MW402604 UnknownUnknownThis study
CBS 143257 MW402087 MW402286 MW402612 UnknownUnknownThis study
F. volatile CBS 143874TLR596007LR596008MK984595LR596006Human bronchoalveolar lavage fluidFrench Guiana Al-Hatmi et al. (2019)
NRRL 25615AF160304AF160320AF158357Oryza sativa seedNigeria O’Donnell et al. (2000)
F. werrikimbe CBS 125535T MN534104 MN534203 MN534304 Sorghum leiocladum AustraliaF19361This study
F. xylarioides CBS 258.52TMN193874AY707118 MW402455 HM068355 MW402646 Coffea trunkIvory CoastNRRL 25486Geiser et al. (2005), Smith et al. (2011), Laraba et al. (2020)
CBS 749.79 MN534049 MN534143 AF158326 MN534259 MW402702 Coffea canephora GuineaL-102; BBA 62721; NRRL 25804O’Donnell et al. (2000), this study
F. xyrophilum NRRL 62710MN193875MN193903 MW402720 Xyris spp.GuyanaLaraba et al. (2020), this study
NRRL 62721TMN193877MN193905 MW402721 Xyris spp.GuyanaLaraba et al. (2020), this study
NRRL 66890MN193876MN193904 MW402724 Xyris spp.GuyanaLaraba et al. (2020), this study

a The new species names, described in this study are in bold.

b Abbreviations for the culture collections: the U.S. Agricultural Research Service culture collection (NRRL); the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS); the working collection of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa; the working collection of the author Neriman Yilmaz (NY), University of Pretoria, South Africa; Medical Research Center (MRC) Tygerberg, Cape Town, South Africa; (BBA) Julius Kühn-Institute, Institute for Epidemiology and Pathogen Diagnostics, Berlin & Braunschweig, Germany; F (University of Sydney) Sydney, New South Wales, Australia.

c The sequences deposited to GenBank in this study are in bold.

T Ex-type specimen.

ET Ex-epitype specimen.

NT Ex-neotype specimen.

DNA extraction, PCR and sequencing

Genomic DNA was extracted from 7-d-old fungal cultures, grown on potato dextrose agar (PDA; recipe in Crous et al. 2019a) and incubated at 25 °C, using the Prepman Ultra Sample Preparation Reagent (Thermo Fisher Scientific, Waltham, Massachusetts) following the manufacturer’s instructions. Five loci, namely partial sequences of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (cmdA), RNA polymerase largest subunit (rpb1) and RNA polymerase second largest subunit (rpb2) gene regions were amplified and sequenced in both directions using a Bio-Rad iCycler (Bio-Rad, California, USA). Primer pairs and PCR amplification protocols are listed in Table 2. A PCR reaction mixture of 25 μL consisted of 2.5 μL 10× PCR reaction buffer, 2.5 mM MgCl2, 200 μM of each dNTP, 0.8 μM of each primer (forward and reverse), 1 U FastStart Taq DNA Polymerase (Roche, Basel, Switzerland) and 20–50 ng of genomic DNA. Resulting PCR products were separated using 2 % agarose gel electrophoresis, and gels were stained with GelRed (Biotium, Inc., California, USA) and examined under UV light. Amplified fragments were purified using the ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher Scientific, Massachusetts, USA). These were sequenced in both directions using the BigDye terminator sequencing kit v. 3.1 (Applied Biosystems, Forster City, California) employing the same primers used for PCR amplification. Reactions were analysed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems). Contigs were assembled and edited in Geneious Prime v. 2019.0.4 (BioMatters Ltd., Auckland, New Zealand). Newly generated sequences were submitted to GenBank, with accession numbers provided in Table 1.
Table 2

Primer pairs, PCR amplification procedures and references used in this study.

LocusPrimerPCR amplification procedures
References
NameSequence (5′-3′)*
tef1 EF1ATGGGTAAGGARGACAAGAC95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak O’Donnell et al. (1998)
EF2GGARGTACCAGTSATCATG O’Donnell et al. (1998)
cmdA CL1GARTWCAAGGAGGCCTTCTC94 °C 90 s; 35 cycles of 94 °C 45 s, 50 °C 45 s, 72 °C 1 min; 72 °C 10 min; 10 °C soak O’Donnell et al. (2000)
CL2ATTTTTGCATCATGAGTTGGAC O’Donnell et al. (2000)
rpb1 FaCAYAARGARTCYATGATGGGWC94 °C 90 s; 5 cycles of 94 °C 45 s, 54 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 53 °C 45 s, 72 °C 2 min; Hofstetter et al. (2007)
R8CAATGAGACCTTCTCGACCAGC35 cycles of 94 °C 45 s, 52 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak O’Donnell et al. (2010)
F8TTCTTCCACGCCATGGCTGGTCG94 °C 90 s; 5 cycles of 94 °C 45 s, 56 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 55 °C 45 s, 72 °C 2 min; O’Donnell et al. (2010)
G2RGTCATYTGDGTDGCDGGYTCDCC35 cycles of 94 °C 45 s, 54 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak O’Donnell et al. (2010)
rpb2 5F2GGGGWGAYCAGAAGAAGGC95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak Reeb et al. (2004)
7CrCCCATRGCTTGYTTRCCCAT Liu et al. (1999)
7CfATGGGYAARCAAGCYATGGG95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak Liu et al. (1999)
11arGCRTGGATCTTRTCRTCSACC Liu et al. (1999)
tub2 T1AACATGCGTGAGATTGTAAGT95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak O’Donnell & Cigelnik (1997)
T2TAGTGACCCTTGGCCCAGTTG O’Donnell & Cigelnik (1997)

* R = A or G; S = C or G; W = A or T; Y = C or T.

Phylogenetic analyses

Gene sequences of novel species were compared to reference sequences available on the Fusarium-MLST (https://fusarium.mycobank.org), Fusarium-ID (Geiser et al. 2004) and NCBIs GenBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi) databases. Based on these comparisons, sequences of relevant Fusarium species/isolates were retrieved (Table 1), contigs were assembled and edited in Geneious Prime v. 2019.2.1 (BioMatters Ltd., Auckland, New Zealand). All datasets were aligned using MAFFT v. 7.427 (Katoh & Standley 2013) selecting the G-INS-I option and, where needed, manually adjusted in Geneious Prime v. 2019.2.1. Phylogenies were calculated for each gene, followed by a concatenated dataset of the five genes (each gene region was treated as separate partitions) and were subsequently analysed using Maximum Likelihood (ML). ML trees were calculated in IQtree v. 2.1.2 (Nguyen et al. 2015) with the most suitable model for each gene and/or partition calculated using Modelfinder (Kalyaanamoorthy et al. 2017) and ultrafast bootstrapping done using UFBoot2 (Hoang et al. 2018), both integrated into IQtree. Bayesian Inference analyses were performed using MrBayes v. 3.2.7 (Ronquist et al. 2012). The most suitable model for each dataset or partition was selected based on the Akaike information criterion (Akaike 1974) using MrModeltest v. 2.4 (Nylander 2004). Trees were visualized in Figtree v. 1.4.4 (https://github.com/rambaut/figtree/releases) and visually edited in Affinity Publisher v. 1.7.1 (Serif (Europe) Ltd, Nottingham, UK). Furthermore, two node-specific concordance factors, the gene concordance factor (gCF) and the site concordance factor (sCF), were calculated as implemented in IQ-TREE v. 2.1.2 (Nguyen et al. 2015, Minh et al. 2020a, b).

Morphology

Fusarium species were characterised and described using macro- and micromorphological features as defined previously (Leslie & Summerell 2006, Aoki et al. 2013, Sandoval-Denis et al. 2018a, b, 2019). Colony morphology, production of pigments and odours were documented on PDA after incubation for 7 d at 25 °C in darkness, under continuous fluorescent light and using a 12/12 h cool fluorescent light/dark cycle. Colony growth rates were also determined on PDA by inoculating overgrown 5 mm agar blocks, obtained from 7-d-old cultures growing on synthetic nutrient poor agar (SNA; Nirenberg 1976) and incubated at 10–35 °C with 5 °C intervals in darkness. Colonies were measured daily over a 7-d-period in four perpendicular directions. Colony morphologies were captured with a Sony NEX-5N camera. Unless otherwise noted, micromorphological observations were made using water as mounting medium from fungal structures grown on carnation leaf agar (CLA; Fisher et al. 1982), incubated at 25 °C under a 12/12 h near-ultraviolet light (nuv)/dark cycle (Fisher et al. 1982, Leslie & Summerell 2006). Colony colour codes were determined following the protocols of Kornerup & Wanscher (1967). All measurements and images were taken using a Nikon Eclipse Ni compound and SMZ18 dissecting microscopes (Nikon, Japan), equipped with a Nikon DS-Ri camera using the NIS-Elements BR imaging software. Up to 50 measurements were made for the conidia and other morphological structures where these were available and maximum – minimum values with averages were determined. Photographic plates were prepared in Affinity Photo v. 1.7.3 (Serif (Europe) Ltd, Nottingham, UK).

RESULTS

Phylogeny

A multigene phylogeny was used to reveal the identities of the isolates studied (Fig. 1). The alignment contained 364 taxa and was 5 359 bp long including the gaps (tef1: 1–677; rpb2: 678–2 405; rpb1: 2 406–4 015; tub2: 4 016–4 613; cmdA: 4 614–5 359). The most appropriate substitution models for each partition were TIM2e+G4 for tef1, TIM2e+I+G4 for rpb2 and TNe+G4 for rpb1, tub2 and cmdA. All trees were rooted to F. nirenbergiae (CBS 744.97) (Fig. 1, Fig. S1–S5). In addition, individual gene phylogenies were generated to assess genealogical concordance of the novel species of FFSC (Fig. S1–S5). Genealogical concordance analyses subsequently confirmed the distinctiveness of the three novel species described in this study. Similar to the results shown by Sandoval-Denis et al. (2018b), the African clade was resolved as polyphyletic, consisting of two distinct and highly supported lineages. The core African clade (clade A) encompassed 31 phylogenetically distinct species, which also included two novel lineages (Fig. 1c–e). The African Clade B consisted of two species, namely F. dlaminii and the recently described F. fredkrugeri (Sandoval-Denis et al. 2018b) (Fig. 1). The other novel lineage resolved in this study, F. pilosicola sp. nov., clustered in the American (Fig. 1) clade.
Fig. 1

Combined phylogeny of the tef1, rpb2, rpb1, tub2 and cmdA gene regions of species from Fusarium fujikuroi species complex. Fusarium nirenbergiae (CBS 744.97) was selected as out-group. Strains belonging to new species are indicated in bold. Numbers at the branches indicate support values (bootstrap|gCF|sCF) above 80 %. T =.Ex-type, NT = neotype, ET = epitype. aEx-type of F. neoceras (CBS 147.25), bIsolates previously described as F. desaboruense (Maryani et al. 2019b).

Taxonomy

In this section, Latin binomials are provided for the three novel phylospecies resolved in this study, namely F. chinhoyiense, F. longicornicola and F. pilosicola spp. nov. In addition, epitypes are designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides. Fusarium acutatum and F. ophioides are validated. Furthermore, a neotype is designated for F. subglutinans and an emended description provided for F. annulatum. Nirenberg & O’Donnell, sp. nov. — MycoBank MB 838782 Synonym. Fusarium acutatum Nirenberg & O’Donnell, Mycologia 90: 435. 1998, nom. inval., Art. 40.1. Etymology. Named for the acute apical cell of the sporodochial conidia produced by this species. Typus. INDIA, unknown substrate, 1995, S.N. Smith (holotype B 70 0001695, designated here, culture ex-type BBA 69580 = NRRL 13309 = FRC 0-1117 = CBS 402.97 = IMI 376110). For diagnosis — See Nirenberg & O’Donnell, Mycologia 90: 435. 1998. Notes — Fusarium acutatum was isolated from Aphididae (Hemiptera) on Triticum sp. (wheat) from Pakistan and Cajanus sp. from India (Nirenberg & O’Donnell 1998, Leslie & Summerell 2006). It is known to produce beauvericin, enniatins and moniliformin (Munkvold 2017). Although this species was introduced by Nirenberg & O’Donnell (1998), it was invalidly described (Index of Fungi 6: 435, 1999). In the protologue for F. acutatum (Nirenberg & O’Donnell 1998) no reference was made to the specimen or gathering (Art. 40.1) for the holotype. Therefore, we validate the species here. Bugnic., Rev. Gén. Bot. 59: 17. 1952 — Fig. 2
Fig. 2

Fusarium annulatum (a, h, j–l. CBS 258.54T; b, c, g, i, m. CBS 531.96; d, f. CBS 139379; e. CBS 134.95; n. CBS 143601). a–b. Sporodochia formed on the surface of carnation leaves; c–h. aerial conidiophores and conidiogenous cells; i–j. aerial conidia; k. sporodochial conidiophores and conidiogenous cells; l–n. sporodochial conidia. — Scale bars: a–d = 50 μm; all others = 10 μm (scale bar in l also applies to m and n).

Typus. NEW CALEDONIA, grain of Oryza sativa, F. Bugnicourt (holotype IMI 202878, ex-type culture CBS 258.54 = BBA 63629 = IMI 202878 = MUCL 8059 = NRRL 13619). Description & Illustrations — (as F. proliferatum) Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Nirenberg & O’Donnell (1998), Domsch et al. (2007). Notes — Fusarium annulatum has been extensively studied in the past under the name F. proliferatum, a segregate of Fusarium moniliforme s.lat. (Seifert et al. 2003). The name Fusarium proliferatum, however, is here assigned to a distinct phylogenetic clade based on an isolate collected from the type location and substrate of that species (see notes under F. proliferatum and in Discussion). Fusarium annulatum is a morphologically and phylogenetically diverse species, common in tropical and temperate zones (Domsch et al. 2007), with more than 200 plant host species reported to date. This species is a well-known pathogen of diverse crops worldwide (as F. proliferatum, Farr & Rossman 2021), and has been implicated in human infections, particularly on immunocompromised patients (Summerbell et al. 1988, O’Donnell et al. 2007). Fusarium annulatum is characterised by sympodially proliferating conidiophores producing mono- and polyphialides, and clavate microconidia with truncate bases grouped in moderately long chains and false heads. Chlamydospores are absent. Sporodochia and sporodochial conidia are typical for this species complex, but are seldom produced or can be poorly developed, thus being easily overlooked. According to Gerlach & Nirenberg (1982), the ex-type strain of F. annulatum (CBS 258.54) failed to produce sporodochia; however, as determined here, this strain will produce typical sporodochia under the culture conditions we employed in this study. Unlike other members of this clade, this strain of F. annulatum is unique by producing strongly curved macroconidia (Fig. 2). Nevertheless, Nelson et al. (1983) showed that straight sporodochial conidia are also produced by this strain, which were also observed in this study. Other strains of F. annulatum studied to date produce predominantly straight macroconidia. (A. Braun) Wollenw., Ann. Mycol. 15: 14. 1917 Basionym. Fusisporium anthophilum A. Braun, in Rabenhorst, Fung. Europ. Exs.: no. 1964. 1875. Synonyms. Fusarium moniliforme var. anthophilum (A. Braun) Wollenw., Fusaria Autogr. Delin. 3: 975. 1930. Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ, Fusarii (Biologija I sistematika): 251. 1955. Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987. Fusarium sanguineum var. pallidius Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6: 196. 1915. Fusarium wollenweberi Raillo, Fungi of the genus Fusarium: 189. 1950. Typus. GERMANY, Berchtesgaden, from Succisa pratensis, 1 Sept. 1874, A. Braun (lectotype of Fusisporium anthophilum, MBT 10000411, exsiccate Rabenhorst, Fungi europaei nr. 1964 in B, designated here); Berlin, on Euphorbia pulcherrima, 1975, H. Nirenberg (epitype, MBT 10000412, CBS 222.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 222.76 = BBA 63270 = IMI 196084 = IMI 202880 = NRRL 22943 = NRRL 25216). Description & Illustrations — See Wollenweber & Reinking (1935), Nirenberg (1976), Gerlach & Nirenberg (1982), Nelson et al. (1983), Leslie & Summerell (2006). Notes — Nirenberg (1976) studied the type material from Braun (1875) and found that isolate CBS 222.76 agreed with the type collection in its morphology and locality. This was further supported by Gerlach & Nirenberg (1982). Therefore, in this study the illustration by Braun (1875) is designated as lectotype, and CBS 222.76 is designated as epitype for F. anthophilum. Yilmaz & Crous, sp. nov. — MycoBank MB 838763; Fig. 3
Fig. 3

Fusarium chinhoyiense sp. nov. (NRRL 25221T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Etymology. Name refers to Chinhoyi, the region, from which the ex-type strain of this fungus was collected. Typus. ZIMBABWE, Chinhoyi, from Zea mays, unknown date and collector (holotype PREM 63215, designated here, culture ex-type NRRL 25221 = BBA 69031 = IMI 375355 = Frank 5bCn8 = DAOM 225149 = CMWF1187 = NY007.I2). Conidiophores on CLA borne on the aerial mycelium straight or flexuous, erect or prostrate, smooth- and thin-walled; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 11–25 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal, smooth- and thin-walled, aseptate, (4.5–)5–9(–11) × 2.5–3.5 μm (av. 7 × 3 μm), clustering in discrete false heads at the phialide tips. Sporodochia white to pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves and on the agar surface, often covered with aerial mycelium. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of terminal phialides; sporodochial conidiogenous cells doliiform to subcylindrical, (8–)10–14(–18) × 2.5–4 μm (av. 12 × 3 μm), smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender; apical cell more or less equally sized as the adjacent cell, blunt to slightly papillate; basal cell distinctly foot-shaped or barely notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (20–)22–27(–31) × 2–4 μm (av. 35 × 3 μm; n = 3); 3-septate conidia: (23–)27–38(–42) × 3–4 μm (av. 34 × 4 μm); 4-septate conidia: 40.5 × 3 μm (n = 1). Chlamydospores absent. Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 5.8–7.3(–7.7–8.5) mm/d and reaching 50–60 mm diam at 25 °C, optimal 25–30 °C (after 7 d). Surface white, flat with abundant aerial mycelia on PDA incubated in dark. Reverse pale yellow (1A2), becoming dark blue at the centre with age. Odour absent. Sporodochia abundant on PDA incubated on constant nuv light. Additional material examined. SOUTH AFRICA, from soil, Feb. 2018, C.M. Visagie, NY 001.B5. Notes — This species is phylogenetically closely related to F. mundagurra isolated from soil in Australia (Laurence et al. 2016) and the recently described F. caapi isolated from Brachiaria brizantha from Brazil (Costa et al. 2021). Fusarium mundagurra has 1-septate microconidia and both F. mundagurra and F. caapi abundantly produce chlamydospores in culture, whereas F. chinhoyiense has aseptate microconidia and lacks chlamydospores. Fusarium chinhoyiense shares the common morphological features of those in FFSC, such as lack of chlamydospores, and oval to clavate microconidia. Moreover, microconidia are produced in relatively short chains from phialides forming false heads, somewhat resembling those produced by F. oxysporum rather than most members of the FFSC (Leslie & Summerell 2006). However, F. chinhoyiense is distinguished from F. oxysporum by the absence of chlamydospores. Although F. chinhoyiense also resembles F. subglutinans, the latter species is distinct in producing sterile, coiled hyphae. Pirotta, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3: 316. 1879 — Fig. 4
Fig. 4

Lectotype of Fusarium lactis (Pirotta & Riboni 1879).

Synonyms. ?Fusarium pyrinum Schwein., Trans. Amer. Philos. Soc., n.s. 4: 302. 1834. ?Fusarium apiogenum Sacc., Syll. Fung. 4: 717. 1886. Fusarium rubrum Parav., Ann. Mycol. 16: 311. 1918. Typus. ITALY, Pavia, on clotted milk, 1879, R. Pirotta & G. Riboni (lectotype, MBT 10000413, Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3, t. 21, f. 1–6, designated here). – USA, California, on Ficus carica, 1994, T. Michailides (epitype, MBT 10000414, B 70 0001686, designated here, culture ex-epitype BBA 68590 = NRRL 25200 = CBS 411.97 = IMI 375351). Description & Illustrations — See Nirenberg & O‘Donnell (1998), Leslie & Summerell (2006). Notes — As the type specimen of F. lactis could not be located in PAV or PAD (Herbarium Saccardo), Nirenberg & O’Donnell (1998) neotypified the species based on NRRL 25200 (= BBA 68590 = CBS 411.97 = IMI 375351 = DAOM 225145) which was isolated from Ficus carica in the USA. However, the neotypification of F. lactis by Nirenberg & O’Donnell (1998) was not Code compliant (ICN; Art. 9.13) as an illustration was provided along with the original protologue. Therefore, the original illustration is designated as the lectotype and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype. Sand.-Den., Yilmaz & Crous, sp. nov. — MycoBank MB 838764; Fig. 5
Fig. 5

Fusarium longicornicola sp. nov. (NRRL 52706T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b–c. sporodochia formed on the surface of carnation leaves; d–g. aerial conidiophores and phialides; h. aerial conidia; i–j. sporodochial conidiophores and phialides; k. sporodochial conidia. — Scale bars: d–k = 10 μm.

Etymology. Name refers to the substrate, Aiolopus longicornis, from which the ex-type strain of this fungus was isolated. Typus. ETHIOPIA, Kobo, Welo, from a grasshopper (Aiolopus longicornis), unknown date and collector (holotype CBS H-24661, designated here, culture ex-type CBS 147247 = NRRL 52706 = ARSEF 6455). Conidiophores on CLA produced laterally and abundantly on aerial and substrate mycelium, straight or flexuous, smooth- and thin-walled, simple or loosely irregularly and verticillately branched, up to 95 μm tall, copiously proliferating percurrently, or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate to subcylindrical, smooth- and thin-walled, 11–22.5 μm long, 2.5–4.5 μm at the widest point, periclinal thickening inconspicuous or absent; microconidia formed sparsely, hyaline, ellipsoidal, reniform to subclavate, smooth- and thin-walled, 0(–1)-septate, 5–9.5(–14) × 2–3.5 μm (av. 7.5 × 2.5 μm), clustering in discrete false heads at the phialide tips. Sporodochia pale to bright orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of 2–3 phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10–16 × 2.5–4 μm, smooth- and thin-walled, with conspicuous periclinal thickening and often with a short apical collarette. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the basal part; apical cell blunt to hooked; basal cell barely to distinctly notched, 1–3-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (14.5–)16–21(–23) × 2.5–4 μm (av. 18.7 × 3.2 μm); 2-septate conidia: (18.5–)20–25.5(–28) × 3–4 μm (av. 22.7 × 3.4 μm); 3-septate conidia: (16.5–)21.5–29.5 × 3–5 μm (av. 25.3 × 3.7 μm). Chlamydospores absent. Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.7 mm/d and reaching 42–80 mm diam at 25 °C, optimal 20–30 °C after 7 d. Surface velvety to floccose, grey-magenta (13E6–14D4) to red-grey (9B2) towards margin, flat, filamentous to rhizoid with filiform margin. Reverse red-brown (9D6) to red-grey (12E2). Odour absent to mouldy. Additional isolates examined. ETHIOPIA, Kobo, Welo, from Aiolopus longicornis, unknown date and collector, CBS 147248 = NRRL 52712 = ARSEF 6451; CBS 147249 = NRRL 52713 = ARSEF 6446. Notes — Pfenning et al. (2019) recently redefined and fixed the typification of F. udum to a well-delimited phylogenetic clade and distinct mating population in the FFSC. Additional isolates previously assigned to F. udum were found not to belong to the current phylogenetic and biological circumscription of the species, most likely representing distinct species. Our phylogenetic and morphological results confirm those observations. The three insecticolous isolates here ascribed to F. longicornicola cluster in a well-differentiated and supported phylogenetic lineage. Apart from its different host association, F. longicornicola differs morphologically from F. udum. The latter species produces only monophialides on its aerial conidiophores, cream coloured sporodochial conidial masses bearing longer and more regularly septate sporodochial conidia, and abundant chlamydospores. The two closest phylogenetic relatives of F. longicornicola, F. phyllophilum and F. xylarioides, are both morphologically distinguishable from the former species. Fusarium phyllophilum mainly differs by lacking sporodochia, although, 5-septate sporodochial conidia are rarely observed in the latter species. Additionally, F. longicornicola differs from F. phyllophilum by its ellipsoidal and reniform microconidia (vs clavate in F. phyllophilum) and ecological traits (insecticolous vs foliicolous in F. phyllophilum; Nirenberg & O’Donnell (1998), Leslie & Summerell (2006)). Differences between F. longicornicola and F. xylarioides are more striking, as the latter species, which is a vascular pathogen of Coffea sp., produces aseptate, allantoid microconidia formed on monophialides only, strongly curved sporodochial conidia and chlamydospores (Gerlach & Nirenberg 1982). A. Jacobs, T.A. Cout. & Marasas, sp. nov. — MycoBank MB 838783; Fig. 6
Fig. 6

Fusarium ophioides (CBS 118512T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b–c. sporodochia formed on the surface of carnation leaves; d–e. sporodochial conidiophores and phialides; f–j. aerial conidiophores and conidiogenous cells; k–l. microconidia; m. mesoconidia; n. serpentine hyphae (adapted from Jacobs 2010); o. sporodochial conidia. — Scale bars: d, f–g = 50 μm; k, n = 5 μm; all others = 10 μm.

Synonym. Fusarium ophioides (as ‘ophiodes’) A. Jacobs, T.A. Cout. & Marasas, Taxonomy of species within the Gibberella fujikuroi complex: 83. 2010, nom. inval. Art 30.9. Etymology. The specific epithet is from the Greek ophis that means snake and refers to the serpentine hyphae produced by this species in culture. Typus. SOUTH AFRICA, Mpumulanga, Ngodwana, from Panicum maximum, G. Kemp (holotype CBS H-24659, designated here, culture ex-type CBS 118512 = CMW 18681 = FCC 2979 = FCC 2980 = MRC 6744). Conidiophores on CLA produced prostrate on substrate mycelium and laterally on aerial mycelium, straight or flexuous, smooth- and thin-walled, rarely simple, commonly sympodially to irregularly branched, up to 190 μm tall, proliferating percurrently; phialides mono- and polyphialidic, subulate to cylindrical, smooth- and thin-walled, 6.5–22.5 μm long, 2.5–4 μm at the widest point, periclinal thickening and collarettes inconspicuous to absent; microconidia hyaline, obovate, ellipsoidal to short falcate, smooth- and thin-walled, 0(–1)-septate, (5–)6.5–15(–20.5) × 2–4.5(–5.5) μm (av. 11 × 3.3 μm), clustering in false heads at the tip of phialides. Mesoconidia falcate, almost straight to moderately dorsiventrally curved, tapering toward the apical part; apical cell pyramidal to slightly hooked; basal cell rounded to barely notched 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: (19.5–)20–27(–28) × 3.5–4.5(–5.5) μm (av. 23.9 × 4.3 μm); 3-septate conidia: (29–)33.5–47(–60) × 3–4.5(–5.5) μm (av. 40.4 × 3.9 μm); 4-septate conidia: (45–)47.5–59.5 × 3–4.5 μm (av. 53.2 × 3.8 μm); 5-septate conidia: (56–)58–66.5 × 3–4.5 μm (av. 62.3 × 3.4 μm), formed abundantly on polyblastic conidiogenous cells on aerial mycelium and conidiophores. Sporodochia luteous to orange, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, bearing single terminal phialides or groups of up to four phialides; sporodochial conidiogenous cells monophialidic, subulate to subcylindrical, 10.5–21 × 2.5–4 μm, smooth- and thin-walled periclinal thickening and collarettes inconspicuous to absent. Sporodochial conidia falcate, almost straight to moderately dorsiventrally curved tapering toward the basal part; apical cell elongated to hooked; basal cell barely to distinctly notched, 2–5-septate, hyaline, thin- and smooth-walled, 2-septate conidia: 23–25 × 3.5–4 μm (av. 24.1 × 3.9 μm); 3-septate conidia: (30.5–)37–54(–60.5) × 3–5 μm (av. 45.3 × 4.1 μm); 4-septate conidia: (49–)53.5–65(–69.5) × 3.5–5 μm (av. 59.2 × 4.3 μm); 5-septate conidia: (53.5–)57–70(–75.5) × 3.5–5.5 μm (av. 63.5 × 4.4 μm). Chlamydospores absent. Sterile, curved hyphae with alternating curvature direction (serpentine hyphae) abundantly formed on the surface of CLA and SNA. Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 3–5.4 mm/d and reaching 42–76 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface brown-red (10D8) to violet brown (11E5), velvety to wholly, flat with filiform margin. Reverse grey-ruby (12D4–12E6). Odour absent. Additional isolates examined. SOUTH AFRICA, Mpumulanga, Ngodwana, from Phragmites mauritianus, G. Kemp, CBS 118509 = CMW 18678 = MRC 6748 = FCC 1092; from Panicum maximum, G. Kemp, CBS 118510 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118511 = CMW 18679 = MRC 6747 = FCC 1093, CBS 118513 = CMW 18682 = MRC 6745 = FCC 2997, CBS 118514 = CMW 18683 = MRC 6750 = FCC 2972, CBS 118515 = CMW 18684 = MRC 6754 = FCC 2974. Notes — Strains assigned to F. ophioides were isolated during a survey of South African grasses. The species was invalidly described in a doctoral thesis lacking an ISSN number (Art. 30.9). Here, we validate the name based on its original material deposited at the CBS (Jacobs 2010). Moreover, a morphological description is included to account for previously undocumented features, i.e., sporodochia and sporodochial conidia, and the nature of the aerial falcate, multiseptate conidia, here found to emerge singly from well-developed, predominately polyblastic and commonly sympodially proliferating conidiogenous cells, conforming to the description of mesoconidia sensu Pascoe (1990). For additional images and discussions about pathogenicity, mating behaviour and closely related taxa see Jacobs (2010). Yilmaz, B.D. Wingf. & Crous, sp. nov. — MycoBank MB 838766; Fig. 7
Fig. 7

Fusarium pilosicola sp. nov. (NRRL 29124T). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Etymology. Referring to the substrate, Bidens pilosa, from which the ex-type strain of this fungus was collected. Typus. USA, Florida, from Bidens pilosa, unknown date and collector (holotype PREM 63216, designated here, culture ex-type NRRL 29124 = CMWF 1183 = NY007.H7). Conidiophores on CLA sparse on aerial mycelium, straight or flexuous, erect or prostrate, smooth- and thin-walled, commonly unbranched, up to 90 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subcylindrical, smooth- and thin-walled, 8.5–24 × 2–3.5 μm, without periclinal thickening; microconidia formed on aerial conidiophores, hyaline, oval to ellipsoidal to ovoid, smooth- and thin-walled, mostly aseptate, (5.5–)7–12 × 2–4 μm (av. 9 × 3 μm), rarely 1-septate, 16–19 × 3–4 μm (av. 18 × 4 μm; n = 2), clustering in discrete false heads at the phialide tips. Sporodochia orange or sometimes pale yellow, often somewhat translucent, formed abundantly on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells elongated subulate to subcylindrical, 11–24 × 3–4 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, slightly curved and slender or sometimes strongly curved; apical cell papillate; basal cell foot-shaped, (3–)4(–5)-septate, hyaline, thin- and smooth-walled, 3-septate conidia: (33–)44–56 × 4.5–5.5 μm (av. 48.6 × 5 μm; n = 4); 4-septate conidia: (48–)50–70(–75) × 4–6.5 μm (av. 59 × 5 μm); 5-septate conidia: 55–70(–80) × 4–5(–6) μm (av. 66.5 × 5 μm; n = 2). Chlamydospores absent. Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of (6.2–)7.2–7.8 mm/d and reaching 45–55 mm diam at 25 °C, optimal 25 °C after 7 d. Surface floccose, abundantly sporulating on PDA, white interspersed with purple mycelia at 25 °C (orange-pink under light and nuv light). Reverse with dark blue (20F4) centre fading into yellow-white (4A2) to orange-white (5A2) in dark. Odour absent. Additional isolate examined. USA, Florida, from Bidens pilosa, unknown date and collector, NRRL 29123 = CMWF 1189= NY 007.I4. Notes — Fusarium pilosicola is a relatively slow-growing species. This species is phylogenetically closely related to F. circinatum and also resembles F. circinatum and F. subglutinans by producing microconidia in false heads. However, F. circinatum is characterised by the formation of sterile, coiled hyphae on SNA and sometimes on CLA, whereas this was not observed for F. pilosicola. On PDA F. subglutinans produces shades of purple pigment ranging from a dark purple to nearly black, whereas F. pilosicola lacks purple pigmentation. (Matsush.) Nirenberg ex Gerlach & Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 209: 309. 1982 — Fig. 8, 9
Fig. 8

Lectotype of Fusarium proliferatum (Matsushima 1971).

Fig. 9

Fusarium proliferatum (CBS 480.96ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidiophores and phialides; f–g. sporodochial conidiophores and phialides; h. sporodochial conidia. — Scale bars: c–h = 10 μm.

Basionym. Cephalosporium proliferatum Matsush., Microfungi of the Solomon Islands and Papua-New Guinea: 11. 1971. Synonyms. Fusarium proliferatum (Matsush.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 38. 1976, nom. inval., Art. 41.3. Fusarium proliferatum var. minus Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 43. 1976, nom. inval., Art. 41.3. Typus. PAPUA NEW GUINEA, forest soil, Matsushima (lectotype of Cephalosporium proliferatum, MBT 10000437, Matsushima T. 1971. Microfungi of the Solomon Islands and Papua New Guinea: 11, f. 121.2, designated here); Papua New Guinea, Morobe province, Bulolo, forest soil, Nov. 1995, collected by A. Aptroot and isolated by A. van Iperen (epitype, MBT 10000438, CBS 480.96 (metabolically inactive) designated here; cultures ex-epitype CBS 480.96 = IAM 14682 = NRRL 26427 = NY007.B6). Conidiophores on CLA difficult to locate, sparse on the aerial mycelium, straight or flexuous, erect, smooth- and thin-walled, commonly unbranched or irregularly branched, up to 85 μm tall or reduced to conidiogenous cells borne laterally on hyphae; conidiogenous cells mono- and polyphialidic, subulate, to subcylindrical, smooth- and thin-walled, 7.5–18 × 2–3 μm, without periclinal thickening; microconidia formed sparsely, hyaline, ovoid to pear-shaped, smooth- and thin-walled, aseptate, (5–)6–11(–13) × 2–3(–4) μm (av. 8.5 × 3 μm), rarely 1-septate (11.5–)13–14(–17.5) × 2.5–3.5 μm (av. 14 × 3 μm; n = 3), clustering in discrete false heads at the tip of phialides. Sporodochia white to pale yellow, often somewhat translucent, formed on the surface of carnation leaves. Sporodochial conidiophores densely aggregated, irregularly and verticillately branched, typically producing dense whorls of 2–4 phialides; sporodochial conidiogenous cells monophialidic and polyphialidic, subulate to doliiform, 5.5–18 × 2.5–5 μm, smooth- and thin-walled, with periclinal thickening and an inconspicuous apical collarette. Sporodochial conidia straight to falcate, tapering toward the basal part, robust, moderately curved and slender and sometimes strongly curved; apical cell papillate; basal cell foot-shaped to barely notched, (1–)3(–4)-septate, hyaline, thin- and smooth-walled, 1-septate conidia: (16.5–)20–30(–36.5) × (1.5–)2–3(–4) μm (av. 24 × 3 μm; n = 7); 2-septate conidia: 26–28 × 2–4 μm (n = 1); 3-septate conidia: (28–)30–50(–56) × 2.5–4.5 μm (av. 42.3 × 3.3 μm); 4-septate conidia: 46.5–60.5 × 3–4 μm (n = 2). Chlamydospores absent. Culture characteristics — Colonies on PDA growing in the dark with an average radial growth rate of 10.3–10.7 mm/d and reaching 69–71 mm diam at 25 °C, optimal 25–30 °C after 7 d. Surface floccose, white to pale pink, abundantly sporulating on PDA incubated in the dark. Reverse with pale greyish ruby (12C7) centre fading into greyish rose (11B3), becoming dark violet to blue at centre with age. Odour absent. Notes — For original descriptions and illustrations, see Matsushima (1971), Nirenberg (1976) and Gerlach & Nirenberg (1982). Fusarium proliferatum was originally described as Cephalosporium proliferatum by Matsushima and isolated from soil from Papua New Guinea (Matsushima 1971). When Matsushima described the species, it was based on pear-shaped (pyriform) microconidia and striking polyphialides (Fig. 8). The culture (MFC-2683) did not produce any sporodochial conidia. Gams & Lacey (1972) made the assumption that C. proliferatum probably belonged to Fusarium sect. Liseola. In 1976, Nirenberg had the opportunity to examine the ex-type specimen of F. proliferatum (Nirenberg 1976), but also failed to observe any sporodochial conidia. Although isolate NRRL 13289 was preserved in the NRRL collection as ‘type’ of F. proliferatum, it was derived from NRRL 6322 (MRC 1784 = ATCC 76097 = FRC M-1138) which was originally isolated from cotton collected in North Carolina (Marasas et al. 1988). As shown in our results, NRRL 13289 belongs to the F. fujikuroi clade. As there is no living ex-type strain available to serve as phylogenetic anchor for F. proliferatum, we designate the original illustration as lectotype, and CBS 480.96 (same substrate, location and morphology, and deposited in 1995 as F. proliferatum) as epitype for F. proliferatum. (E.J. Butler) W. Gams, Cephalosporium-artige Schimmelpilze: 218. 1971 — Fig. 10
Fig. 10

Lectotype of Fusarium sacchari (Butler & Khan 1913).

Basionym. Cephalosporium sacchari E.J. Butler, Mem. Dept. Agric. India, Bot. Ser. 6: 185. 1913. Synonyms. Fusarium neoceras Wollenw. & Reinking, Phytopathology 15: 164. 1925. Gibberella sacchari Summerell & J.F. Leslie, Mycologia 97: 719. 2005, nom. illeg., Art. 53.1, non Gibberella sacchari Speg. 1896. Fusarium desaboruense N. Maryani et al., Persoonia 43: 59. 2019. Typus. INDIA, from culms of Saccharum officinarum, E.J. Butler (lectotype of Cephalosporium sacchari, MBT 10000416, Mem. Dept. Agric. India, Bot. Ser. 6: 185, pl. II, f. 1–13 (1913), designated here); from Saccharum officinarum, 1975, Schaft (epitype, MBT 10000417, CBS 223.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 223.76 = BBA 63340 = DAOM 225138 = IMI 202881 = NRRL 13999). Description & Illustrations — See Gams (1971), Gerlach & Nirenberg (1982), Leslie et al. (2005), Leslie & Summerell (2006). Notes — Because the original type specimen is no longer available, Leslie et al. (2005) neotypified F. sacchari based on isolate KSU B-03852 (ATCC 201264 = FGSC 7610 = FRC M6865). However, in the protologue of F. sacchari, Butler & Khan (1913) did include an illustration which is designated here as lectotype. This supersedes the neotype (Art. 9.13) designation by Leslie et al. (2005). Therefore, CBS 223.76, isolated from Saccharum officinarum collected in India, is designated here as epitype. Additionally, this ex-epitype isolate has been used as the representative isolate of F. sacchari in recent phylogenetic studies on the F. fujikuroi species complex (O’Donnell et al. 1998, 2013, Herron et al. 2015). The inclusion of a larger sampling of F. sacchari isolates for the multigene phylogenies in this study clearly resolved F. desaboruense (Maryani et al. 2019b), isolated from banana collected in Indonesia, within the F. sacchari clade. Therefore, we consider F. desaboruense as a synonym of F. sacchari. The molecular data also showed that F. sacchari and F. neoceras are conspecific, therefore we synonymize F. neoceras with F. sacchari. (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983 — Fig. 11
Fig. 11

Fusarium subglutinans (CBS 747.97ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. sporodochia formed on the surface of carnation leaves; c. aerial conidia; d–e. aerial conidia, conidiophores and phialides; f. sporodochial conidiophores and phialides; g. sporodochial conidia. — Scale bars: c–g = 10 μm.

Basionym. Fusarium moniliforme var. subglutinans Wollenw. & Reinking, Phytopathology 15: 163. 1925. Synonyms. Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T. Edwards, Agric. Gaz. New South Wales 44: 895. 1933, Art. F.8.1, Note 2, Exs. 2. Fusarium moniliforme f. subglutinans (Wollenw. & Reinking) C. Moreau, Rev. Mycol. (Paris) 17: 23. 1952. Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 53. 1976. Gibberella subglutinans (Wollenw. & Reinking) P.E. Nelson et al., Fusarium species: An illustrated manual for identification: 135. 1983. Typus. USA, Illinois, St. Elmo, from Zea mays, date unknown, J.F. Leslie (neotype of Fusarium moniliforme var. subglutinans MBT 10000418, CBS 747.97 (preserved as metabolically inactive culture), designated here, culture ex-neotype CBS 747.97 = BBA 62451 = DAOM 225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL 22114). Description & Illustrations — See Booth (1971), Nirenberg (1976, 1981), Nelson et al. (1983), Pascoe (1990), Leslie & Summerell (2006). Notes — No living type material or holotype specimen is available for F. subglutinans. Therefore, CBS 747.97 (= NRRL 22016) isolated from corn in the USA, is designated as the neotype for this species. Historically, this strain has been used as representative of F. subglutinans in various phylogenetic studies (Zeller et al. 2003, O’Donnell et al. 2013, Herron et al. 2015), and thus we conserve the modern interpretation of this species. J. Schröt. ex Sacc., Syll. Fung. 10: 724. 1892 Synonym. Fusisporium succisae J. Schröt., Hedwigia 13: 180. 1874, nom. inval., Art. 36.1(a). Typus. GERMANY, Bavaria, Borussia, from Succisa pratensis, 1875, de Thuemen (lectotype, MBT 10000419, ILL00076313 (Thuemen, Mycoth. Univ. nr. 675) designated here); from flower of Succisa pratensis, 1973, H. Nirenberg (epitype, MBT 10000420, IMI 202876, designated here, culture ex-epitype BBA 12287 = BBA 63627 = CBS 219.76 = DAOM 225142 = IMI 202876 = NRRL 13613). Description & Illustrations — See Nirenberg (1976), Gerlach & Nirenberg (1982). Notes — This taxon was first described as a species of Fusisporium by Schröter in 1874 and then as a species of Fusarium in 1892 by Saccardo. Although Wollenweber & Reinking (1935) considered this species as a synonym of F. anthophilum (as F. moniliforme var. anthophilum), both Nirenberg (1976) and Gerlach & Nirenberg (1982) recognised this species, indicating CBS 219.76 (= NRRL 13613 = IMI 202876) as a representative isolate of F. succisae. Therefore, this specimen is designated as epitype for this species. (Sacc.) Nirenberg, Mitt. Biol. Bundesanst. Land-Forstw. 169: 26. 1976 — Fig. 12, 13
Fig. 12

Lectotype of Fusarium verticillioides (Saccardo 1881).

Fig. 13

Fusarium verticillioides (CBS 218.76ET). a. Colonies in PDA after 7 d at 25 °C light, dark and nuv (from left to right), respectively; b. aerial conidia produced in chains; c. aerial conidia; d–e. aerial conidia, conidiophores and phialides. — Scale bars: c–g = 10 μm.

Basionym. Oospora verticillioides Sacc., Fung. Ital., Fasc. 17–28: pl. 879. 1881. Synonyms. Alysidium verticillioides (Sacc.) Kuntze, Revis. Gen. Pl. 3: 442. 1898. Fusarium moniliforme J. Sheld., Annual Rep. Nebraska Agric. Exp. Sta. 17: 23. 1904. Gibberella moniliformis Wineland, J. Agric. Res. 28: 909. 1924. Typus. ITALY, Zea mays, 1877, unknown collector (lectotype of Oospora verticillioides, MBT 10000421, pl. 879 in Saccardo, Fung. Ital. (1881), designated here); GERMANY, on stem of Zea mays, 1968, H. Nirenberg (epitype, MBT 10000422, CBS 218.76 (preserved as metabolically inactive culture), designated here, culture ex-epitype CBS 218.76 = BBA 11782 = DSM 62264 = IMI 202875 = NRRL 13993). Description & Illustrations — See Nirenberg (1976, 1981), Gerlach & Nirenberg (1982), Leslie & Summerell (2006). Notes — Fusarium verticillioides was first isolated from maize in Italy in 1877 as Oospora verticillioides (Saccardo 1886) and became known as F. moniliforme after it was associated with animal toxicoses (Sheldon 1904). Nirenberg (1976) synonymised O. verticillioides under F. moniliforme, associated with the sexual morph Gibberella moniliformis (Wineland 1924). Previously, the name F. moniliforme was applied in a broad sense to include at least six, and probably more, reproductively isolated mating populations. Therefore, Seifert et al. (2003) restricted the application of the name F. verticillioides to what is presently known as the mating population A and the main fumonisin producing species. Other mating populations known within the collective ‘F. moniliforme’ group have now been resolved to species level, e.g., F. thapsinum from sorghum, F. sacchari from sugar cane, F. mangiferae from mango and F. fujikuroi from rice (Leslie & Summerell 2006). No type material could be located for the true F. verticillioides as reported by Nirenberg (1976), but the original plate published in Saccardo (1881) is selected as lectotype here. Gerlach & Nirenberg (1982) considered CBS 218.76 an authentic strain of F. verticillioides. Therefore, this metabolically inactive culture is designated as an epitype for F. verticillioides.

DISCUSSION

Fusarium was first described by Link (1809) based on the presence of its distinctive banana- or canoe-shaped conidia as its primary character. From recent taxonomic revisions based on molecular work, we now know that this character does not only apply to Fusarium s.lat., but several other genera (Gräfenhan et al. 2011, Schroers et al. 2011, Lombard et al. 2015, Sandoval-Denis et al. 2019). Throughout history, Fusarium species delineation was based on three main species concepts, namely morphological, biological, and phylogenetic species concepts (Leslie et al. 2001). Today, however, the general consensus is to apply a polyphasic or consilient approach which takes into account as many characters as possible, noting a bias towards phylogenetic data. The biological species concept was widely employed within the FFSC, with at least 11 mating populations identified (Martin et al. 2011). However, several of these mating populations have now been described as new species (Britz et al. 2002, Leslie et al. 2005). A major drawback of this approach is the fact that many Fusarium species have no known sexual morph/cycle and the limited number of isolates that do have a sexual morph/cycle, make crosses cumbersome. Although mycologists try to collect as many strains as possible of a proposed new species, in many cases it is not possible. Indeed, several recently described Fusarium species have been based on one or a few isolates, especially when strains are sequenced for re-identification purposes from culture collections (Nirenberg & O’Donnell 1998, Sandoval-Denis et al. 2018a, b, Al-Hatmi et al. 2019, Lombard et al. 2019a, b). Notably, in a number of cases where descriptions were based on too few strains, or the species were presumed unimportant due to their original ecological niches, these taxa have turned out to be more widely distributed and more economically important than earlier perceived. An example is F. pseudonygamai which was described based on two strains found from Pennisetum typhoides in Africa (Nirenberg & O’Donnell 1998). Since its formal description, this species has been recovered from a much wider range of substrates and locations. These include rice affected by bakanae disease in India, and sugarcane affected by pokkah boeng disease and stalk borer (Eldana saccharina) (McFarlane et al. 2009, Bashyal et al. 2016, Summerell 2019). This shows the importance of introducing names for unique phylogenetic lineages when supported by conclusive genetic and phenotypic evidence. Therefore, in this study, Latin binomials are provided for three phylospecies that have been resolved in previous studies, but remained unnamed (Herron et al. 2015, Laurence et al. 2016, Pfenning et al. 2019). The FFSC contains 65 accepted species, which include a large number of cryptic species only identifiable based on phylogenetic inference. The purpose of this study was to characterise and describe a large collection of FFSC strains accessioned in the CBS, CMW and NRRL culture collections using a polyphasic approach. Phylogenetic analyses of a five-gene dataset strongly supported the novelty of the three Fusarium phylospecies previously identified, with strong monophyletic statistical support values (Fig. 1). O’Donnell et al. (1998) concluded that the FFSC includes three main clades classified as the Asian, American and African clades at that time. In this study, we found that the African clade is not monophyletic, and that F. dlaminii and F. fredkrugeri form a separate group (the African clade B), making the use of this informal classification system for the FFSC redundant and confusing. Similar results were also observed in previous studies (Herron et al. 2015, O’Donnell et al. 2000, Sandoval-Denis et al. 2018b). Furthermore, for several species, the relationship between the geographical origin and the proposed informal clade classification is not compatible. Two of the newly named species in this study, F. chinhoyiense sp. nov. and F. pilosicola sp. nov., were resolved in the core African clade. Two strains of F. chinhoyiense used in this study (NRRL 25221T and NY 001B5) were isolated from Zea mays in Zimbabwe and soil from Limpopo, South Africa, respectively. The closest relative to F. chinhoyiense is F. mundagurra and the recently described species F. caapi (Laurence et al. 2016, Costa et al. 2021). Fusarium chinhoyiense is distinguished from the latter species by the lack of chlamydospores. Additionally, microconidia are produced in sliding chains by F. mundagurra, whereas those of F. chinhoyiense are borne in false heads. Although F. subglutinans also produces microconidia from false heads, its ability to produce distinctive sterile coiled hyphae can easily distinguish it from F. chinhoyiense. Two strains of F. pilosicola were obtained from the NRRL collection (NRRL 29123 and NRRL 29124T) and isolated from Bidens pilosa collected in the USA. Based on phylogenetic inference, F. pilosicola is closely related to F. circinatum, the causal agent of the devastating Pitch canker disease of several Pinus species. This species readily produces orange sporodochia with abundant sporodochial conidia, whereas F. circinatum does not readily produce sporodochia and produces sterile hyphal coils which were not observed in this study for F. pilosicola (Leslie & Summerell 2006). Additionally, the basal cells of sporodochial conidia in F. pilosicola are well-developed in contrast to those of F. circinatum. There are a number of species that are morphologically similar to F. pilosicola due to the production of microconidia in false heads, including F. bulbicola, F. circinatum, F. guttiforme, F. mangiferae, F. pseudocircinatum, F. sacchari, F. subglutinans and F. sterilihyphosum (Leslie & Summerell 2006). Many of these species are quite difficult to differentiate from one another unless molecular markers are used. Fusarium longicornicola sp. nov. was resolved in the African core clade in this study (Fig. 1). The species was isolated from the tef grasshopper (Aiolopus longicornis) from Ethiopia. The isolates were originally identified as F. udum by O’Donnell et al. (2012). However, Pfenning et al. (2019) illustrated that they do not cluster with other F. udum s.str. strains and suggested that they may represent a distinct species. Unfortunately, no morphological data are available for these isolates at present, and therefore in this study we described the species as F. longicornicola. Fusarium is regarded as one of the most important fungal genera known and therefore in much need of a stable and concise taxonomy. Especially as it is now recognised that species of this genus can adjust rapidly to climate change, have the ability to move into new ecosystems and cause diseases on new crops, highlighting the importance of accurate species identification (Maryani et al. 2019a). The newly described Fusarium species in this study have not been linked to any pathogenicity on their hosts. However, they should not be ignored as the host range of several species in the FFSC have not yet been determined. For some researchers it may be irrelevant to describe species without information pertaining to its pathogenic and/or mycotoxigenic potential. Regardless, it is still of utmost importance to better understanding the biodiversity and phylogeographical range of a specific Fusarium species. Even though some of the newly proposed species constitute a single lineage in this study, providing Latin binomials for these will allow the opportunity to more easily find additional isolates of these species in future studies. One of the most important concepts and cornerstone of a stable fungal taxonomy system is the correct application of types. These specimens and living ex-type strains play a fundamental role to provide anchorage for species names in especially taxonomic phylogenetic studies of a particular fungal group that suffers from an inconsistent taxonomic system. In practical terms, it also serves as the foundation to make informed morphological or phylogenetic comparisons. Ideally, having a living ex-type strain with all associated metadata including high quality DNA sequences along with multiple strains of the same species would provide essential information on the infra-species variation found in a certain species. A perturbing issue for several older Fusarium species/names is the lack of nomenclatural types that are either not available or have been lost. The International Code of Nomenclature for algae, fungi, and plants allows for re-typification in these cases, when material from the original protologue (like a drawing or exsiccate) can be applied as lectotype (Art. 9.3) and a new specimen/strain can then be designated as epitype/ex-epitype. Therefore, in this study, lectotypes could be designated for F. anthophilum, F. lactis, F. proliferatum, F. sacchari, F. succisae and F. verticillioides to provide taxonomic stability for these established species. Furthermore, a neotype is designated for F. subglutinans, as no authentic material linked to the original protologue, could be located. Fusarium anthophilum is a cosmopolitan fungus and found on various plant species in temperate regions (Leslie & Summerell 2006). It is known to produce beauvericin, fumonisins, fusaproliferin and moniliformin (Munkvold 2017). The type specimen from the original description by Braun (1875) was not available. Therefore, the original protologue’s illustration is designated as the lectotype and CBS 222.76 isolated from a stem of Euphorbia pulcherrima collected in Germany designated as an epitype. Fusarium lactis was described by two Italian mycologists, Pirotta and Riboni, on clotted milk from Pavia, Italy (Pirotta & Riboni 1879). It produces beauvericin, and some of the isolates produce moniliformin and fumonisin B1 (Yang et al. 2011, Munkvold 2017). This species is also a known pathogen of fig (Ficus carica; Nirenberg & O’Donnell 1998) and sweet pepper (Capsicum annuum; Yang et al. 2009). As no living type material for F. lactis was available, Nirenberg & O’Donnell (1998) neotypified the species. However, a drawing as part of the original protologue (Fig. 4) is available, and therefore is designated as the lectotype here, and the neotype of Nirenberg & O‘Donnell (1998) is designated as an epitype. Fusarium sacchari is the causal agent for pokkah boeng of sugarcane and also causes mycotic keratitis among the sugarcane farmers in North India (Bansal et al. 2016, Costa et al. 2019, Viswanathan 2020). Fusarium sacchari was first described as Cephalosporium sacchari from sugarcane in India (Butler & Khan 1913). The protologue of the species did not include any mention of sporodochial conidia. Later, Wollenweber & Reinking (1925) described several cultures that produced sporodochial conidia as Fusarium neoceras (CBS 147.25, the ex-holotype of F. neoceras). However, Gams (1971) synonymised the two names, which is further supported by the molecular data in O’Donnell et al. (1998) and this study. Since the original type specimen is not available, Leslie et al. (2005) neotypified F. sacchari. However, the original illustration by Butler & Khan (1913; Fig. 10) designated here as lectotype, invalidates the neotype of Leslie et al. (2005). Therefore, in this study, CBS 223.76 isolated from Saccharum officinarum in India is designated as epitype for this species. In addition, the multigene phylogeny resolved the recently described F. desaboruense (Maryani et al. 2019b) within the F. sacchari clade and therefore, the later species is synonymised under F. sacchari. Fusarium succisae was first described as a species of Fusisporium by Schröter in 1874 and subsequently transferred to the genus Fusarium in 1892 by Saccardo. It was originally isolated from Succisa pratensis in Germany. It is not known to produce mycotoxins and limited information is available on the ecology and biology of this species (Leslie & Summerell 2006). No living ex-type strain exists for this species although an illustration accompanying the original protologue is available, which is designated as the lectotype. This, in turn, allows for CBS 219.76 to be designated as epitype here, which shares the same substrate and the locality as indicated in the original protologue. Fusarium verticillioides is the most common pathogen on maize and found throughout the world wherever maize is cultivated (Leslie & Summerell 2006). It causes Fusarium ear rot on maize and results in significant yield losses and reduction of grain quality (Leslie & Summerell 2006). It is also known to be isolated from different grains including millet, sorghum and sunflower (Leslie & Summerell 2006). Fusarium verticillioides is known to produce fumonisins which cause fatal livestock diseases and are considered potentially carcinogenic mycotoxins for humans, especially in China and Southern Africa. It is also known to produce beauvericin, fusaric acid and fusarisins (Munkvold 2017). Fusarium verticillioides was traditionally known as the A-mating population of F. moniliforme s.lat. Even though the key characters of F. verticillioides were illustrated by Leslie & Summerell (2006), we provided a photographic plate illustrating F. verticillioides based on the epitype (CBS 218.76; Fig. 13). Fusarium subglutinans is an important cosmopolitan maize pathogen which causes seedling disease, stalk and ear rot (Moretti et al. 1995, Steenkamp et al. 2002). The production of mycotoxins might differ from strain to strain but little to no fumonisins are generally produced by this species (Desjardins et al. 2000, Proctor et al. 2004, Fumero et al. 2015, 2020). However, F. subglutinans is known to produce beauvericin, fusaric acid, moniliformin, and high levels of fusaproliferin which are known to be emerging mycotoxins (Fumero et al. 2015, 2020). Even though it is a very well-known and used species name, no living type material or holotype specimen are available for this important cereal pathogen and mycotoxin producer. Therefore, CBS 747.97 is designated as neotype to facilitate a stable taxonomy for this species. Both F. acutatum and F. ophioides were invalidly published, and are therefore validated in this study. Fusarium marasasianum, F. parvisorum, F. pininemorale and F. sororula were originally described by Herron et al. (2015) from diseased Pinus species collected in Colombian plantations and nurseries. Ex-type cultures for these taxa were subsequently deposited in the CBS culture collection. DNA sequences generated from the ex-type cultures of F. marasasianum, F. parvisorum and F. sororula resolved these taxa within the F. circinatum clade. While some isolates for F. marasasianum, F. pininemorale and F. sororula correspond with the placement obtained by Herron et al. (2015), all F. parvisorum isolates deposited at the CMW and CBS collection resolved as F. circinatum. Therefore, in our study we used the tef1 and tub2 sequences that were submitted to GenBank by Herron et al. (2015) (Fig. 1). Wingfield et al. (2017) released the full genome sequence for F. pininemorale (CMW 25243), while unpublished whole genome sequences for F. marasasianum (CMW 25512) and F. sororula (CMW 25513) were recently generated (De Vos et al. pers. comm.). Gene regions of phylogenetic interest were extracted from these genomes and the resulting multigene phylogeny suggest that F. pininemorale and F. marasasianum are conspecific, with F. pininemorale resolving as close relative to F. sororula (Fig. 1). Considering the significant uncertainty and confusion related to the ex-type cultures available for these taxa, a future study will be required to generate sequence data from the dried holotype specimens deposited at PREM (fungarium of the National Collections of Fungi hosted at the Agricultural Research Council, Roodeplaat, South Africa) in order to resolve their phylogeny. Fusarium proliferatum isolates are known to cause diseases in maize, sorghum, mango and asparagus (Leslie & Summerell 2006). They are also known to produce beauvericin, enniatins, fumonisins, fusaproliferin, fusaric acid, fusarins and moniliformin (Munkvold 2017). Even though F. proliferatum is a well-studied species, from the taxonomic point of view the name remains phylogenetically unresolved. Fusarium proliferatum was first described as Cephalosporium proliferatum by Matsushima (1971) and renamed as a Fusarium species by Nirenberg (1976). Unfortunately, the ex-type culture of F. proliferatum has not been preserved. Therefore, the identification of F. proliferatum isolates has mostly been based on the morphological concept derived by Nirenberg (1976). During our survey, we included a representative reference strain in the WI collection (CBS 480.96), which was isolated from the same substrate (forest soil) and location (Papua New Guinea) as the original Cephalosporium proliferatum. Morphological characters of this strain also match both the original description of Matsushima (1971) and Nirenberg (1976), with the addition of sporodochial formation. In the multi-gene phylogenies, however, CBS 480.96 resolved on a distinct branch to isolates which were traditionally identified as F. annulatum/proliferatum (Fig. 1). To bring taxonomic stability to F. proliferatum, the original line drawing in Matsushima (1971) is designated as lectotype, and CBS 480.96 as epitype of F. proliferatum. O’Donnell et al. (1998) demonstrated that the ex-type of F. annulatum (CBS 258.54) groups together with other isolates previously identified as ‘F. proliferatum’, which is confirmed here in our phylogenetic analysis. Fusarium annulatum is a species described by Bugnicourt (1952), based on a single isolate from Oryza sativa, New Caledonia. According to the original description by Bugnicourt (1952), F. annulatum produces microconidia in chains from false heads on abundant mono- and polyphialides. Sporodochial conidia are thin-walled, strongly curved and almost ring-shaped, with the basal cell distinctly foot-shaped, and chlamydospores are absent. Nelson et al. (1983) mentioned that F. annulatum is essentially a F. proliferatum with strongly curved sporodochial conidia. The resulting confusion in literature is largely based on the fact that the ex-type strain of F. annulatum is atypical for the species, as most isolates of F. annulatum actually only produce straight macroconidia (see Fig. 2). To further understand variation within this complex, whole-genome sequences of the ex-epitype of F. proliferatum and ex-type of F. annulatum will be generated as a follow-up study. A stable and robust taxonomy is anchored by the availability of ex-type material which acts as the reference point and anchor for phylogenetic analyses. Therefore epi- and/or neotypification plays a very important and crucial role in the classification of Fusarium species, especially those that produce mycotoxins and cause diseases of animals, humans and plants.
  60 in total

1.  An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella.

Authors:  T Gräfenhan; H-J Schroers; H I Nirenberg; K A Seifert
Journal:  Stud Mycol       Date:  2011       Impact factor: 16.097

2.  Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous.

Authors:  K O'Donnell; E Cigelnik
Journal:  Mol Phylogenet Evol       Date:  1997-02       Impact factor: 4.286

3.  A Novel Disease of Big-Leaf Mahogany Caused by Two Fusarium Species in Mexico.

Authors:  R Santillán-Mendoza; S P Fernández-Pavía; K O'Donnell; R C Ploetz; R Ortega-Arreola; G Vázquez-Marrufo; J Benítez-Malvido; J C Montero-Castro; A Soto-Plancarte; G Rodríguez-Alvarado
Journal:  Plant Dis       Date:  2018-07-30       Impact factor: 4.438

4.  MAFFT multiple sequence alignment software version 7: improvements in performance and usability.

Authors:  Kazutaka Katoh; Daron M Standley
Journal:  Mol Biol Evol       Date:  2013-01-16       Impact factor: 16.240

5.  Fungal Planet description sheets: 951-1041.

Authors:  P W Crous; M J Wingfield; L Lombard; F Roets; W J Swart; P Alvarado; A J Carnegie; G Moreno; J Luangsaard; R Thangavel; A V Alexandrova; I G Baseia; J-M Bellanger; A E Bessette; A R Bessette; S De la Peña-Lastra; D García; J Gené; T H G Pham; M Heykoop; E Malysheva; V Malysheva; M P Martín; O V Morozova; W Noisripoom; B E Overton; A E Rea; B J Sewall; M E Smith; C W Smyth; K Tasanathai; C M Visagie; S Adamčík; A Alves; J P Andrade; M J Aninat; R V B Araújo; J J Bordallo; T Boufleur; R Baroncelli; R W Barreto; J Bolin; J Cabero; M Caboň; G Cafà; M L H Caffot; L Cai; J R Carlavilla; R Chávez; R R L de Castro; L Delgat; D Deschuyteneer; M M Dios; L S Domínguez; H C Evans; G Eyssartier; B W Ferreira; C N Figueiredo; F Liu; J Fournier; L V Galli-Terasawa; C Gil-Durán; C Glienke; M F M Gonçalves; H Gryta; J Guarro; W Himaman; N Hywel-Jones; I Iturrieta-González; N E Ivanushkina; P Jargeat; A N Khalid; J Khan; M Kiran; L Kiss; G A Kochkina; M Kolařík; A Kubátová; D J Lodge; M Loizides; D Luque; J L Manjón; P A S Marbach; N S Massola; M Mata; A N Miller; S Mongkolsamrit; P-A Moreau; A Morte; A Mujic; A Navarro-Ródenas; M Z Németh; T F Nóbrega; A Nováková; I Olariaga; S M Ozerskaya; M A Palma; D A L Petters-Vandresen; E Piontelli; E S Popov; A Rodríguez; Ó Requejo; A C M Rodrigues; I H Rong; J Roux; K A Seifert; B D B Silva; F Sklenář; J A Smith; J O Sousa; H G Souza; J T De Souza; K Švec; P Tanchaud; J B Tanney; F Terasawa; D Thanakitpipattana; D Torres-Garcia; I Vaca; N Vaghefi; A L van Iperen; O V Vasilenko; A Verbeken; N Yilmaz; J C Zamora; M Zapata; Ž Jurjević; J Z Groenewald
Journal:  Persoonia       Date:  2019-12-18       Impact factor: 11.051

6.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

7.  Symptomatic Citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species.

Authors:  M Sandoval-Denis; V Guarnaccia; G Polizzi; P W Crous
Journal:  Persoonia       Date:  2017-07-01       Impact factor: 11.051

8.  Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin.

Authors:  N Maryani; L Lombard; Y S Poerba; S Subandiyah; P W Crous; G H J Kema
Journal:  Stud Mycol       Date:  2018-07-05       Impact factor: 16.097

9.  IMA Genome-F 8: Draft genome of Cercospora zeina, Fusarium pininemorale, Hawksworthiomyces lignivorus, Huntiella decipiens and Ophiostoma ips.

Authors:  Brenda D Wingfield; Dave K Berger; Emma T Steenkamp; Hye-Jin Lim; Tuan A Duong; Burton H Bluhm; Z Wilhelm de Beer; Lieschen De Vos; G Fourie; Kershney Naidoo; Nicky Olivier; Yao-Cheng Lin; Yves Van de Peer; Fourie Joubert; Bridget G Crampton; Velushka Swart; Nicole Soal; Catherine Tatham; Magriet A van der Nest; Nicolaas A van der Merwe; Stephanie van Wyk; P Markus Wilken; Michael J Wingfield
Journal:  IMA Fungus       Date:  2017-11-21       Impact factor: 3.515

10.  New Fusarium species from the Kruger National Park, South Africa.

Authors:  Marcelo Sandoval-Denis; Wijnand J Swart; Pedro W Crous
Journal:  MycoKeys       Date:  2018-06-01       Impact factor: 2.984

View more
  1 in total

1.  Fusarium spp. Associated with Dendrobium officinale Dieback Disease in China.

Authors:  Seyed Ali Mirghasempour; Themis Michailides; Weiliang Chen; Bizeng Mao
Journal:  J Fungi (Basel)       Date:  2022-08-29
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.