Multi-locus phylogenetic analysis of lophiostomatoid fungi motivates a broad concept of Lophiostoma and reveals nine new species.

Recent studies on the fungal families Lophiostomataceae and Lophiotremataceae (Pleosporales) have provided varying phylogenetic and taxonomic results concerning constituent genera and species. By adding DNA sequences of 24 new strains of Lophiostomataceae and nine new strains of Lophiotremataceae to a sequence data matrix from international databases, we provide a new understanding of the relationships within these families. Multigene analysis of the four molecular markers ITS, LSU, TEF1-α, and RPB2 reveals that the genera within Lophio-tremataceae are phylogenetically well supported. Lophiostoma myriocarpum is recognised as a species of Lophiotrema in contrast to earlier concepts. In Lophiostomataceae, we resurrect a broad generic concept of the genus Lophiostoma and reduce 14 genera to synonymy: Alpestrisphaeria, Biappendiculispora, Capulatispora, Coelodictyosporium, Guttulispora, Lophiohelichrysum, Lophiopoacea, Neopaucispora, Neotrematosphaeria, Platystomum, Pseudocapulatispora, Pseudolophiostoma, Pseudoplatystomum, and Sigarispora. Nine new species are described based on molecular data and in most cases supported by morphological characters: Antealophiotrema populicola, Atrocalyx nordicus, Lophiostoma carpini, Lophiostoma dictyosporium, Lophiostoma erumpens, Lophiostoma fusisporum, Lophiostoma jotunheimenense, Lophiostoma plantaginis, and Lophiostoma submuriforme. Lophiostoma caespitosum and Lophiotrema myriocarpum are lecto- and epitypified to stabilise their species concepts. High intraspecific variability of several morphological traits is common within Lophiostomataceae. Citation: Andreasen M, Skrede I, Jaklitsch WM, et al. 2021. Multi-locus phylogenetic analysis of lophiostomatoid fungi motivates a broad concept of Lophiostoma and reveals nine new species. Persoonia 46: 240-271. https://doi.org/10.3767/persoonia.2021.46.09.

INTRODUCTION

Species of Lophiostomataceae and Lophiotremataceae (Pleosporales, Dothideomycetes, Ascomycota) are saprobic and occur on twigs, stems and bark of woody plants and herbs in terrestrial and aquatic environments (Holm & Holm 1988, Ellis & Ellis 1997, Mugambi & Huhndorf 2009). They form attractive study organisms since they are in many cases well defined by crest-like ostioles and are therefore easily recognisable in the field. The two families also share immersed to erumpent ascomata, a carbonaceous peridium, cylindrical or clavate fissitunicate asci and hyaline to dark brown, one- to multiseptate ascospores.

Nitschke (1869) first recognised Lophiostomataceae, and Saccardo (1883) formally established the family, based on Lophiostoma macrostomum as type species. The genus Lophiotrema was traditionally considered in the family Lophiostomataceae (Barr 1992, Kirk et al. 2008, Lumbsch & Huhndorf 2009, Hirayama & Tanaka 2011) and was only recently established within the segregate family Lophiotremataceae, typified by Lophiotrema nucula (Hirayama & Tanaka 2011). Proposed distinguishing morphological characters between Lophiostoma and Lophiotrema include ascospore colouration, peridium thickness and textura, ascus shape and stipe length, and mucilaginous layer and terminal appendages of ascospores (Saccardo 1878, Holm & Holm 1988, Barr 1992, Mathiassen 1993, Yuan & Zhao 1994, Tanaka & Harada 2003a, b, Tanaka & Hosoya 2008, Eriksson 2009, Hirayama & Tanaka 2011, Hashimoto et al. 2018). The entangled taxonomic history and superficial morphological resemblance of the two families motivated us to treat them in a common study.

Recent phylogenetic studies using molecular methods have enabled a more natural placement of many families, genera and species within Pleosporales (Schoch et al. 2009, Wijayawardene et al. 2020). However, phylogenetic analyses have in several cases used small monophyletic groups or single genera as the basis for new genera without due concern for the remainder of the original genus, thus generating paraphyletic and polyphyletic sister genera (Padamsee et al. 2008, Nuhn et al. 2013, Wu et al. 2014). Tanaka and co-workers (Hirayama & Tanaka 2011, Thambugala et al. 2015, Hashimoto et al. 2017, 2018) have provided a substantial amount of DNA data for numerous representatives of both families, but for other taxa, if at all, often only LSU or ITS is available. By sampling fresh material of mostly European specimens representing the two families, pure culture isolation, DNA sequencing and analyses, we aim to resolve the phylogenetic relationships within the families of Lophiostomataceae and Lophiotremataceae. Further, we aim to revisit the numerous newly proposed genera of Lophiostomataceae based on an extended dataset and to re-evaluate and discuss the suitability of morphological characters used for delimitation of species and genera.

MATERIALS AND METHODS

Taxon selection and sampling

Between September 2018 and September 2019, we collected specimens of Lophiostomataceae and Lophiotremataceae in the relatively continental to suboceanic eastern parts, the western oceanic lowlands, and alpine areas of southern Norway. Additional collections including type material were loaned from the fungaria in Oslo (O), Tromsø (TROM), and Geneva (G). A sub-set of unpublished data of strains from countries other than Scandinavia was also included.

Morphological investigation

Ascomata were rehydrated with autoclaved water and investigated using a Nikon SMZ 745T / Zeiss SteREO Discovery V8 dissecting microscope and a Nikon Eclipse Ci-L or a Zeiss Axio Imager A2 compound microscope. Images of ascomata were captured with a NIKON DS-Fi2 or Tucsen DigiRetina 16 camera, using stacking software Lite Helicon Focus 7 v. 7.5.6. The ascomata were dissected with a sterile razor blade or a Leitz 1320 Microtome cutter with a Leitz 1703 Kryomat as freezing element. Micro slides were created with contents of the ascomata mounted in sterile water or 5 % KOH. Indian Ink was used to detect mucilaginous sheaths, and in some cases, cotton blue reagent was added for improved visualization of spores and hymenial structures. Photomicrographs were produced using a Zeiss Axiocam 503 camera and measurements were made with Zeiss AxioVision v. 4.9.1 software (Carl Zeiss AG), and images were processed in GIMP v. 2.8.22 (Kimball & Mattis 1996).

Cultivation techniques

A selection of the collections was used for pure culture isolation from ascospores. Hymenial material was transferred into a sterile water droplet on a micro slide and transferred with a sterile pipette onto Petri dishes containing malt agar (MEA: 3 % malt extract, 1.5 % agar in water) and antibiotics (0.25 % Streptomycin, 0.1 % Tetramycin, 0.5 % Ampicillin). Petri dishes were incubated at 20 °C for spore germination and checked daily for growth under a dissecting microscope. Germinated spores were transferred individually onto MEA plates (without antibiotics), their growth monitored, contaminants removed, and pictures taken. Development of asexual morphs was documented for up to 1.5 yr.

For long time storage, smaller pieces of the cultures were isolated and transferred into Cryovial tubes holding harvesting medium (10 g sucrose, 1 g peptone, 100 mL water, autoclaved) for conservation at −80 °C at Oslo University. Representative isolates have been deposited at the Westerdijk Fungal Biodiversity Centre (CBS-KNAW), Utrecht, The Netherlands. Freshly collected specimens have been deposited in the Fungarium of Oslo, University of Oslo (O) or the Fungarium of the University of Vienna (WU).

DNA extraction and sequencing

DNA was extracted from cultured mycelia using the Phire Plant Direct PCR Kit (Thermo Scientific, Waltham, USA) following the manufacturer’s manuals for both DNA isolation and Polymerase Chain Reaction (PCR). Efforts were made to amplify the ribosomal DNA regions of internal transcribed spacer (ITS) containing ITS1, 5.8S and ITS2 and a fragment of the 28S large subunit ribosomal (LSU) for all sampled specimens. Subsequent regions of translation elongation factor 1-alpha (TEF1-α) and DNA-directed RNA polymerase II subunit (RPB2) were also amplified where possible. The primers used for PCR reactions are shown in Table 1.

Table 1

Overview of PCR and sequencing primers that were used to obtain DNA sequences for specimens from the families Lophiostomataceae and Lophiotremataceae.

Region1	Primer sequence (5′–3′)	Direction	Reference
ITS	ITS1: TCCGTAGGTGAACCTGCGG	forward	White et al. (1990)
	ITS4: TCCTCCGCTTATTGATATGC	reverse	White et al. (1990)
LSU	V9G: TTACGTCCCTGCCCTTTGTA	forward	De Hoog & Gerrits van den Ende (1998)
	LR2R: AAGAACTTTGAAAAGAG	forward	Vilgalys & Hester (1990)
	LR5: TCCTGAGGGAAACTTCG	reverse	Vilgalys & Hester (1990)
	LR3: GGTCCGTGTTTCAAG	reverse	Vilgalys & Hester (1990)
TEF1-α	EF1-728F: CATCGAGAAGTTCGAGAAG	forward	Carbone & Kohn (1999)
	TEF1-LLErev: AACTTGCAGGCAATGTGG	reverse	Jaklitsch et al. (2005)
RPB2	fRPB2-5: GAYGAYMGWGATCAYTTYGG	forward	Novakova et al. (2012)
	fRPB2-7C: CCCATRGCTTGYTTRCCCAT	reverse	Novakova et al. (2012)

1 ITS: Internal transcribed spacer region (ITS1, 5.8S and ITS2); LSU: 28S large subunit ribosomal RNA; TEF1-α: translation elongation factor 1-alpha; RPB2: RNA polymerase II, second largest subunit.

The following PCR protocols were used to amplify the molecular regions: 2 min at 95 °C, 40 cycles of 15 s (20 s for TEF1-α) at 95 °C, denaturation for 15 s at 95 °C (20 s for TEF1-α), annealing at 20 s at 53 °C (30 s at 55 °C for TEF1-α and RPB2) and followed by an elongation for 1 min and 10 s at 70 °C (90 s for TEF1-α and 60 s for RPB2), with a terminal extension of 3 min at 70 °C. PCR products were checked with electrophoresis on 1.5 % agarose gels. Five μL PCR product was purified with 0.2 μL ExoSAP-IT (GE Healthcare, Waukesha, WI) and 1.8 μL water. Samples were then run on a thermocycler at 37 °C for 15 min, followed by 80 °C for 15 min. Cleaned PCR product was diluted with 45 μL water per sample. Five μL PCR product and 5 μL sequencing primer was added to clean tubes and labelled before sequencing. Sanger sequencing was performed by Eurofins, Luxemburg.

Sequence alignment and phylogenetic analyses

Sequence editing, assembly and concatenations were done using Geneious Prime v. 2020.0.5 (Kearse et al. 2012). Sequence data from Thambugala et al. (2015), Jaklitsch et al. (2016), Hashimoto et al. (2017), Wanasinghe et al. (2018), Bao et al. (2019), Hyde et al. (2019), and Phukhamsakda et al. (2020) were downloaded from GenBank (Table 2, 3). Preliminary alignments were made using Muscle v. 3.8.425 (Edgar 2004), with standard settings as incorporated in Geneious Prime. All alignments were inspected and manually adjusted.

Table 2

Fungal taxa, strains and GenBank accessions of Lophiostomataceae used. The strains and sequences generated in this current study are indicated in bold.

Taxa	Family	Strain no.	GenBank accession no.
			ITS	LSU	TEF1-α	RPB2
Crassiclypeus aquaticus	Lophiostomataceae	KH 104	LC312499	LC312528	LC312557	LC312586
	Lophiostomataceae	KT 970	LC312501	LC312530	LC312559	LC312588
Dimorphiopsis brachystegiae	Lophiostomataceae	CPC 22679	KF777160	KF777213	–	–
Flabellascoma aquaticum	Lophiostomataceae	KUMCC 15-0258	MN304827	MN274564	MN328898	MN328895
Flabellascoma cycadicola	Lophiostomataceae	KT 2034	LC312502	LC312531	LC312560	LC312589
Flabellascoma fusiforme	Lophiostomataceae	MFLUCC 18-1584	MN304830	MN274567	MN328902	–
Flabellascoma minimum	Lophiostomataceae	KT 2013	LC312503	LC312532	LC312561	LC312590
	Lophiostomataceae	KT 2040	LC312504	LC312533	LC312562	LC312591
Lentistoma bipolare	Lophiostomataceae	KT 3056	LC312513	LC312542	LC312571	LC312600
	Lophiostomataceae	CBS 115375	LC312506	LC312535	LC312564	LC312593
Leptoparies palmarum	Lophiostomataceae	KT 1653	LC312514	LC312543	LC312572	LC312601
Lophiostoma arundinis	Lophiostomataceae	KT 606	JN942964	AB618998	LC001737	JN993482
	Lophiostomataceae	KT 651	JN942965	AB618999	LC001738	JN993486
Lophiostoma biappendiculatum	Lophiostomataceae	KT 975P	–	GU205228	–	–
	Lophiostomataceae	KT 1124	–	GU205227	–	–
Lophiostoma caespitosum	Lophiostomataceae	CBS 147391	MW759252	MW750387	MW752404	MW752383
	Lophiostomataceae	MFLUCC 13-0442	KP899134	KP888639	KR075161	–
	Lophiostomataceae	MFLUCC 14-0993	KP899135	KP888640	KR075162	–
Lophiostoma carpini	Lophiostomataceae	CBS 147279	MW759258	MW750386	MW752405	MW752384
Lophiostoma caryophyllacearum	Lophiostomataceae	MFLUCC 17-0749	MG828964	MG829076	MG829238	–
Lophiostoma caudatum	Lophiostomataceae	KT 530	LC001723	AB619000	LC001739	–
Lophiostoma caulium	Lophiostomataceae	MFLUCC 15-0036	MG828965	MG829077	MG829239	–
	Lophiostomataceae	KT 603	LC001724	AB619001	LC001740	–
	Lophiostomataceae	KT 633	LC001725	AB619002	LC001741	–
	Lophiostomataceae	MFLUCC 15-0176	–	KT328493	–	–
Lophiostoma cf. clavatum	Lophiostomataceae	CBS 147278	MW759259	MW750385	MW752406	MW752385
Lophiostoma clavatum	Lophiostomataceae	MFLUCC 18-1316	–	MN274566	MN328901	–
Lophiostoma clematidicola	Lophiostomataceae	MFLUCC 16-0446	MT310609	MT214563	MT394742	–
Lophiostoma clematidis	Lophiostomataceae	MFLUCC 17-2081	MN393004	MT214562	MT394741	MT394689
Lophiostoma clematidis-subumbellatae	Lophiostomataceae	MFLUCC 17-2063	MT310607	MT214560	MT394739	MT394687
Lophiostoma clematidis-vitalbae	Lophiostomataceae	MFLUCC 16-1368	MT310610	MT214564	MT394743	–
Lophiostoma compressum	Lophiostomataceae	CBS 147536	MW759267	MW750388	MW752402	–
	Lophiostomataceae	CBS 147538	MW759268	–	–	–
	Lophiostomataceae	CBS 147537	MW759269	–	MW752399	–
	Lophiostomataceae	CBS 147519	MW759264	MW750393	MW752393	–
	Lophiostomataceae	CBS 147520	MW759266	MW750395	MW752391	–
	Lophiostomataceae	CBS 147521	MW759265	MW750396	MW752390	–
	Lophiostomataceae	CBS 147615	MW759263	MW750397	MW752389	–
	Lophiostomataceae	CBS 147276	MW759272	MW750382	MW752408	MW752381
	Lophiostomataceae	CBS 147390	MW759271	MW750383	–	–
	Lophiostomataceae	TEQ	MW759270	MW750398	–	–
	Lophiostomataceae	IFRD 2014	–	FJ795437	–	FJ795457
	Lophiostomataceae	MFLUCC 13-0343	–	KP888643	KR075165	–
Lophiostoma cornisporum	Lophiostomataceae	KH 322	LC312515	LC312544	LC312573	LC312602
Lophiostoma coronillae	Lophiostomataceae	MFLUCC 14-0941	KT026120	KT026112	–	–
Lophiostoma crenatum	Lophiostomataceae	AFTOL-ID 1581	–	DQ678069	DQ677912	DQ677965
Lophiostoma dictyosporum	Lophiostomataceae	CBS 147389	MW759251	MW750379	MW752411	MW752388
Lophiostoma erumpens	Lophiostomataceae	CBS 147275	MW759262	MW750381	MW752409	MW752386
Lophiostoma fusisporum	Lophiostomataceae	CBS 147891	MW759253	–	MW752401	MW752382
Lophiostoma helichrysi	Lophiostomataceae	IT-1296	KT333435	KT333436	KT427535	–
Lophiostoma heterosporum	Lophiostomataceae	AFTOL-ID 1036	GQ203795	AY016369	DQ497609	DQ497615
Lophiostoma japonicum	Lophiostomataceae	KT 686-1	LC001729	AB619006	LC001745	–
	Lophiostomataceae	MFLUCC 17-2450	MN304829	–	MN328900	–
	Lophiostomataceae	KT 573	LC001728	AB619005	LC001744	–
	Lophiostomataceae	KT 794	LC001730	AB619007	LC001746	–
Lophiostoma jonesii	Lophiostomataceae	GAAZ 54-1	KX687757	KX687753	KX687759	–
	Lophiostomataceae	GAAZ 54-2	KX687758	KX687754	KX687760	–
Lophiostoma jotunheimenense	Lophiostomataceae	CBS 147522	MW759261	MW750394	MW752392	–
Lophiostoma junci	Lophiostomataceae	MFLUCC 14-0938	MG828966	MG829078	–	–
Lophiostoma longiappendiculatum	Lophiostomataceae	MFLUCC 17-1452	MT214368	MT214462	MT235783	–
	Lophiostomataceae	MFLUCC 17-1457	MT214369	MT214463	MT235784	MT235821
Lophiostoma macrostomoides	Lophiostomataceae	CBS 147523	MW759256	MW750389	–	–
	Lophiostomataceae	CBS 147277	MW759257	MW750384	MW752407	MW752380
	Lophiostomataceae	CBS 123097	–	FJ795439	GU456277	FJ795458
	Lophiostomataceae	GKM1159	–	GU385185	GU327778	–
	Lophiostomataceae	GKM1033	–	GU385190	GU327776	–
	Lophiostomataceae	GKM224N	–	GU385191	GU327777	–
	Lophiostomataceae	CBS121412	–	MH874664	–	–
	Lophiostomataceae	CBS113435	EU552157	EU552157	–	–
Lophiostoma macrostomum	Lophiostomataceae	KT 508	JN942961	AB619010	LC001751	JN993491
	Lophiostomataceae	KT 709/HHUF 27293	AB433276	AB433274	LC001753	JN993493
	Lophiostomataceae	KT 635/HHUF 27290	AB433275	AB433273	LC001752	JN993484
Lophiostoma medicaginicola	Lophiostomataceae	MFLUCC 17-0681	MG828967	MG829079	–	–
Lophiostoma montanae	Lophiostomataceae	MFLUCC16-0999	MT310611	MT214565	MT394744	–
Lophiostoma multiseptatum	Lophiostomataceae	CBS 623.86	–	GU301833	–	GU371791
	Lophiostomataceae	KT 604/JCM17668	LC001726	AB619003	LC001742	–
Lophiostoma neomuriforme	Lophiostomataceae	MFLUCC 13-0744	KY496740	KY496719	–	–
Lophiostoma obtusisporum	Lophiostomataceae	KT 3098	LC312519	LC312548	LC312577	LC312606
	Lophiostomataceae	KT 2838	LC312518	LC312547	LC312576	LC312605
Lophiostoma ononidis	Lophiostomataceae	MFLUCC 14-0613	KU243128	KU243125	KU243127	–
Lophiostoma paramacrostomum	Lophiostomataceae	MFLUCC 11-0463	–	KP888636	–	–
Lophiostoma plantaginis	Lophiostomataceae	CBS 147527	MW759250	MW750378	–	MW752375
Lophiostoma pseudodictyosporium	Lophiostomataceae	MFLUCC 13-0451	KR025858	KR025862	–	–
Lophiostoma pseudomacrostomum	Lophiostomataceae	CBS 147524	MW759249	MW750390	MW752396	–
	Lophiostomataceae	CBS 147525	MW759255	MW750391	MW752395	–
	Lophiostomataceae	CBS 147526	MW759254	MW750392	MW752394	–
Lophiostoma ravennicum	Lophiostomataceae	MFLUCC 14-0005	KP698413	KP698414	–	–
Lophiostoma rosae-ecae	Lophiostomataceae	MFLUCC 17-0807	MG828924	MG829033	MG829217	–
Lophiostoma rosicola	Lophiostomataceae	MFLU 15-1888	MG828968	MG829080	MG829240	–
Lophiostoma sagittiforme	Lophiostomataceae	KT 1934	AB369268	AB369267	LC001756	–
Lophiostoma scabridisporum	Lophiostomataceae	BCC 22835	–	GQ925844	GU479857	GU479830
	Lophiostomataceae	BCC 22836	–	GQ925845	GU479856	GU479829
Lophiostoma scrophulariicola	Lophiostomataceae	MFLUCC 17-0689	MG828969	MG829081	–	–
Lophiostoma semiliberum	Lophiostomataceae	KT 622	JN942966	AB619012	LC001757	JN993483
	Lophiostomataceae	KT 652	JN942967	AB619013	LC001758	JN993485
	Lophiostomataceae	KT 828	JN942970	AB619014	LC001759	JN993489
Lophiostoma spartii-juncei	Lophiostomataceae	MFLUCC 13-0351	KP899136	KP888641	KR075163	–
Lophiostoma submuriforme	Lophiostomataceae	CBS 147274	MW759260	MW750380	MW752410	MW752387
Lophiostoma terricola	Lophiostomataceae	SC-12	JN662930	JX985750	–	–
Lophiostoma thymi	Lophiostomataceae	MFLU 15-2131	MG828970	MG829082	MG829241	–
Lophiostoma tropicum	Lophiostomataceae	KH 352	LC312521	LC312550	LC312579	LC312608
	Lophiostomataceae	KT 3134	LC312522	LC312551	LC312580	LC312609
Lophiostoma vitigenum	Lophiostomataceae	HH 26930	LC001735	AB619015	LC001761	–
	Lophiostomataceae	HH 26931	LC001736	AB619016	LC001762	–
Lophiostoma winteri	Lophiostomataceae	KT 740	JN942969	AB619017	LC001763	JN993487
	Lophiostomataceae	KT 764	JN942968	AB619018	LC001764	JN993488
Neovaginatispora clematidis	Lophiostomataceae	MFLUCC 17–2156	MT310606	MT214559	MT394738	–
Neovaginatispora fuckelii	Lophiostomataceae	MFLUCC 17-1334	MN304828	MN274565	MN328899	MN328896
	Lophiostomataceae	CBS 101952	–	DQ399531	–	FJ795472
	Lophiostomataceae	KH 161	LC001731	AB619008	LC001749	–
	Lophiostomataceae	KT 634	LC001732	AB619009	LC001750	–
Parapaucispora pseudoarmatispora	Lophiostomataceae	KT 2237	LC100021	LC100026	LC100030	–
Paucispora quadrispora	Lophiostomataceae	KH 448	LC001733	LC001722	LC001754	–
	Lophiostomataceae	KT 843	LC001734	AB619011	LC001755	–
Paucispora versicolor	Lophiostomataceae	KH 110	AB918731	AB918732	LC001760	–
‘Platystomum’ actinidiae	Lophiostomataceae	KT 521	JN942963	JN941380	LC001747	JN993490
	Lophiostomataceae	KT 534	JN942962	JN941379	LC001748	JN993492
‘Platystomum’ crataegi	Lophiostomataceae	MFLUCC 14-0925	KT026117	KT026109	KT026121	–
‘Platystomum’ rosae	Lophiostomataceae	MFLUCC 15-0633	KT026119	KT026111	–	–
‘Platystomum’ salicicola	Lophiostomataceae	MFLUCC 15-0632	KT026118	KT026110	–	–
Pseudopaucispora brunneospora	Lophiostomataceae	KH 227	LC312523	LC312552	LC312581	LC312610
Vaginatispora amygdali	Lophiostomataceae	KT 2248	LC312524	LC312553	LC312582	LC312611
	Lophiostomataceae	MFLUCC 18-1526	MK085055	MK085059	MK087657	–
Vaginatispora appendiculata	Lophiostomataceae	MFLUCC 16-0314	KU743217	KU743218	KU743220	–
Vaginatispora aquatica	Lophiostomataceae	MFLUCC 11-0083	KJ591577	KJ591576	–	–
Vaginatispora armatispora	Lophiostomataceae	MFLUCC 18-0247	MK085056	MK085060	MK087658	MK087669
	Lophiostomataceae	MFLUCC 18-0213	MN304826	MN274563	MN328897	MN328894
Vaginatispora microarmatispora	Lophiostomataceae	MTCC 12733	MF142592	MF142593	MF142595	MF142596
Vaginatispora scabrispora	Lophiostomataceae	KT 2443	LC312525	LC312554	LC312583	LC312612
Teichospora rubriostiolata	Teichosporaceae	TR7	KU601590	KU601590	KU601609	KU601599
Teichospora trabicola	Teichosporaceae	C134	KU601591	KU601591	KU601601	KU601600

Table 3

Fungal taxa, strains and GenBank accessions of Lophiotremataceae used. The sequences generated in this current study are indicated in bold.

Taxa	Family	Strain no.	GenBank accession no.
			ITS	LSU	TEF1-α	RPB2
Antealophiotrema brunneosporum	Incertae sedis	CBS 123095	LC194474	LC194340	LC194382	LC194419
Antealophiotrema populicola	Incertae sedis	CBS 147528	MW759240	MW750371	–	–
	Incertae sedis	CBS 147529	MW759241	MW750372	MW752398	MW752378
Atrocalyx acutisporus	Lophiotremataceae	KT 2436	LC194475	LC194341	LC194386	LC194423
Atrocalyx asturiensis	Lophiotremataceae	OF	MG912912	MG912912	MG912916	MG912920
Atrocalyx bambusae	Lophiotremataceae	MFLUCC 10-0558	KX672149	KX672154	KX672162	KX672161
Atrocalyx lignicola	Lophiotremataceae	CBS 122364	LC194476	LC194342	LC194387	LC194424
Atrocalyx nordicus	Lophiotremataceae	CBS 147530	MW759244	MW750376	–	–
	Lophiotremataceae	CBS 147531	MW759246	MW750377	–	–
	Lophiotremataceae	CBS 147532	MW759243	MW750374	–	MW752379
	Lophiotremataceae	CBS 147533	MW759245	MW750375	–	MW752376
Crassimassarina macrospora	Lophiotremataceae	KH 152	LC194477	LC194343	LC194388	LC194425
	Lophiotremataceae	KT 1764	LC194478	LC194344	LC194389	LC194426
Cryptoclypeus oxysporus	Lophiotremataceae	KT 2772	LC194479	LC194345	LC194390	LC194427
Cryptoclypeus ryukyuensis	Lophiotremataceae	AH 342	LC194480	LC194346	LC194391	LC194428
	Lophiotremataceae	KT 3534	LC194481	LC194347	LC194392	LC194429
Galeaticarpa aomoriensis	Lophiotremataceae	MAFF 245618	LC194482	LC194366	LC194393	LC194448
‘Lophiotrema‘ boreale	Incertae sedis	CBS 114422	LC194491	LC194375	LC194402	LC194457
Lophiotrema ‘eburnoides‘	Lophiotremataceae	KT 1424_1	LC001709	LC001707	LC194403	LC194458
Lophiotrema fallopiae	Lophiotremataceae	KT 2748	LC149913	LC149915	LC194404	LC194459
Lophiotrema myriocarpum	Lophiotremataceae	CBS 147534	MW759247	–	MW752403	–
	Lophiotremataceae	CBS 147535	MW759248	–	MW752397	MW752377
Lophiotrema neoarundinariae	Lophiotremataceae	KT 1034	LC194492	AB524598	LC194405	LC194460
	Lophiotremataceae	KT 2200	AB524787	AB524597	AB539110	AB539097
	Lophiotremataceae	KT 856	AB524786	AB524596	AB539109	AB539096
Lophiotrema neohysterioides	Lophiotremataceae	KH 17	LC194493	LC194376	LC194406	LC194461
	Lophiotremataceae	KT 588	LC194494	LC194377	LC194407	LC194462
	Lophiotremataceae	KT 713	LC194495	AB619019	LC194408	LC194463
	Lophiotremataceae	KT 756	LC194496	AB619020	LC194409	LC194464
Lophiotrema nucula	Lophiotremataceae	MAL47	MW759242	MW750373	MW752400	–
	Lophiotremataceae	CBS 627.86	LC194497	AB619021	LC194410	LC194465
Lophiotrema vagabundum	Lophiotremataceae	KH 164	LC194498	AB619022	LC194411	LC194466
	Lophiotremataceae	KH 172	LC194499	AB619023	LC194412	LC194467
	Lophiotremataceae	KT 664	LC194500	AB619024	LC194413	LC194468
	Lophiotremataceae	KT 3310	LC194501	LC194378	LC194414	LC194469
	Lophiotremataceae	CBS 113975	LC194502	AB619025	LC194415	LC194470
Pseudocryptoclypeus yakushimensis	Lophiotremataceae	KT 2186	LC194504	LC194380	LC194417	LC194472

Phylogenetic analyses were conducted using maximum likelihood (ML) and Bayesian inference (BI). Substitution models for each locus were determined based on the AICc model selection criterion (small-sample-size corrected version of Akaike information criterion) as implemented in PartitionFinder v. 1.1.1 (Lanfear et al. 2016). The search was set to ‘greedy’ and branch lengths set to ‘linked’. ML analyses were performed on aligned sequences using RAxML v. 8.2.11 (Stamatakis 2014) as implemented in Geneious. Rapid Bootstrapping and search for best-scoring ML tree algorithms were used and Bootstrap analyses obtained by 1 000 bootstrap replications. To examine topological incongruence among datasets, ML bootstrapping analyses were carried out on each of the single-gene datasets. Topological incongruence was assumed if conflicting tree topologies were supported by ≥ 70 % ML support. Since topological incongruence could not be observed, maximum likelihood (ML) bootstrapping analyses were carried out on the concatenated four-locus dataset for both Lophiostomataceae and Lophiotremataceae using the same settings as for the single-gene analyses. BI analyses were performed with MrBayes v. 3.2.6 (Huelsenbeck & Ronquist 2001) with substitution models for different regions selected with the AICc parameter. Metropolis-coupled Markov chain Monte Carlo (MCMC) runs were performed for 4 M generations with trees sampled every 1 000 generations. Convergence of the MCMC procedure was assessed and effective sample (EES) size scores > 200 checked by using the MrBayes build in Tracer v. 1.6 (Rambaut et al. 2018). The first 10 % of trees were discarded as burn-in, and the remaining trees were used to calculate 50 % majority rule trees and to determine posterior probabilities (PP) for individual branches. Output trees were edited with Inkscape v. 0.92.1 (Harrington et al. 2003).

This study follows the guidelines for proposing new genera sensu Vellinga et al. (2015) and adapted by Tulloss et al. (2016). We also follow the concept of Genealogical Concordance Phylogenetic Species Recognition (Taylor et al. 2000, Dettman et al. 2003) and embrace the Consolidated Species Concept (Quaedvlieg et al. 2014).

The following sequences were omitted from our phylogenetic analyses of Lophiostomataceae: Three sequences were identified as wrongly labelled and thus not included: L. viridarium (IFRDCC 2090) and L. triseptatum (SMH 2591, SMH 5287). Also, two taxa from Mugambi & Huhndorf (2009) from Kenya labelled with names of European taxa were considered questionable and were omitted: L. alpigenum (GKM 1091b) and L. quadrinucleatum (GKM 1233).

RESULTS

Phylogenetic analyses

From 68 strains initially targeted for multi-locus sequencing, a total of 33 ITS, 28 LSU, 23 TEF1-α, 14 RPB2 consensus sequences were produced (Table 2, 3). The protein coding locus RPB2 proved especially challenging to amplify.

The concatenated alignment for Lophiostomataceae comprised 3 161 nucleotide characters, including gaps (5.8S and ITS2: 1–410; LSU: 411–1 251; TEF1-α: 1 252–2 148; RPB2: 2 149–3 161). The alignment included 24 new strains representing 12 taxa. In total, the alignment was composed of 124 strains of the Lophiostomataceae, and the two taxa Teichospora rubriostiolata (TR7) and Teichospora trabicola (C134) as the outgroup. ITS1 was excluded from the analyses because it contained too many ambiguously aligned regions.

The concatenated alignment for Lophiotremataceae comprised 3 657 nucleotide characters, including gaps (ITS: 1–463; LSU: 464–1 717; TEF1-α: 1 718–2 638; RPB2: 2 639–3 657). The alignment included nine new strains representing four taxa. In total the alignment was composed of 37 strains, including four strains of Antealophiotrema (Antealophiotrema brunneosporum CBS 123095, Antealophiotrema populicola CBS 147528 and CBS 147529, ‘Lophiotrema’ boreale CBS 114422) as the outgroup taxa.

The maximum likelihood (ML) analysis of the combined datasets yielded the best scoring trees for Lophiostomataceae (Fig. 1) and Lophiotremataceae (Fig. 2). Also, the Bayesian inference (BI) analysis showed congruence with the topology of the ML analyses, and for simplicity, only the ML trees are shown. Values for both MLB above 50 % and Bayesian posterior probabilities (BPP) higher than 0.90 are given at the nodes. The alignments had 33.31 % and 13.69 % undetermined nucleotide gaps for Lophiostomataceae and Lophiotremataceae, respectively.

Fig. 1

Maximum likelihood phylogeny of Lophiostomataceae based on ITS2, 5.8S, LSU, TEF1-α and RPB2 combined sequence data. Numbers above branches indicate Maximum likelihood RAxML bootstrap values above 50 % and Bayesian posterior probabilities higher than 0.90 are given at the nodes. Branches supported by ML bootstrap analyses (> 50) are thickened. Newly obtained strains are shown in bold. Shorted nodes are marked with crossing lines and indications (×2, ×4) of how many times the node has been shortened.

Fig. 2

Maximum likelihood phylogeny of Lophiotremataceae based on ITS2, 5.8S, LSU, TEF1-α and RPB2 combined sequence data. Numbers above branches indicate Maximum likelihood RAxML bootstrap values above 50 % and Bayesian posterior probabilities higher than 0.90 are given at the nodes. Branches supported by ML bootstrap analyses (> 50) are thickened. Newly obtained strains are shown in bold. Shorted nodes are marked with crossing lines and indications (×3) of how many times the node has been shortened.

Pseudopaucispora brunneospora formed a completely supported clade and sister group to all other Lophiostomataceae taxa (MLP 100 % and BPP 1). The genus Lophiostoma formed a highly supported sister group to the remaining genera of the Lophiostomataceae, viz. Crassiclypeus, Dimorphiopsis, Flabellascoma, Lentistoma, Leptoparies, Neovaginatispora, Parapaucispora, Paucispora, and Vaginatispora. These other genera were well supported. Within Lophiostoma, most clades containing several taxa were unsupported, and therefore there is no basis for a subdivision into several genera.

Our analyses showed support for seven new species within Lophiostomataceae, represented by the strains CBS 147522 (MAL88), CBS 147891 (MAL04), CBS 147527 (MAL92), CBS 147389 (C191), CBS 147274 (C217), CBS 147275 (C220), and CBS 147279 (LQ1), respectively (see Fig. 1). The phylogenetic analyses of the Lophiotremataceae revealed a tree, which comprises a well-supported clade of the genus Lophiotrema as a sister group of the remaining genera of Lophiotremataceae. As a result, Lophiotrema myriocarpum is now recognised in Lophiotrema after it was considered for a long time to be a species of Lophiostoma (Holm & Holm 1988). In the genus Atrocalyx, the strains CBS 147530 (MAL20), CBS 147531 (MAL21), CBS 147532 (MAL27), and CBS 147533 (MAL76) formed a strongly supported clade. The morphology of this group is consistent and distinct from the other Atrocalyx species, and we therefore described this clade as a new species. Also, within the outgroup, Antealophiotrema, a new species represented by the strains CBS 147528 (MAL63) and CBS 147529 (MAL64) is supported by phylogeny and morphology.

Taxonomy

The genera Alpestrisphaeria, Biappendiculispora, Capulatispora, Coelodictyosporium, Guttulispora, Lophiohelichrysum, Lophiopoacea, Neopaucispora, Neotrematosphaeria, Platystomum, Pseudocapulatispora, Pseudolophiostoma, Pseudoplatystomum, and Sigarispora are synonymised with Lophiostoma based on molecular phylogeny and morphology.

Sacc., Syll. Fung. (Abellini) 2: 672. 1883 — MycoBank MB 561063

Type genus. Lophiostoma Ces. & De Not., Comment. Soc. Crittog. Ital. 1 (4): 219. 1863. MycoBank MB 2933.

Ces. & De Not., Comment. Soc. Crittog. Ital. 1 (4): 219. 1863 — MycoBank MB 2933

Synonyms. Alpestrisphaeria Thambug. & K.D. Hyde, Fungal Diversity 74: 214. 2015. — Index Fungorum IF 551232.

Biappendiculispora Thambug. et al., Fungal Diversity 74: 214. 2015. — MycoBank MB 551528.

Capulatispora Thambug. & K.D. Hyde, Fungal Diversity 74: 216. 2015. — MycoBank MB 551234.

Coelodictyosporium Thambug. & K.D. Hyde, Fungal Diversity 74: 218. 2015. — MycoBank MB 551286.

Guttulispora Thambug. et al., Fungal Diversity 74: 220. 2015. — MycoBank MB 551238.

Lophiohelichrysum Dayar. et al., Fungal Diversity 75: 85. 2015. — MycoBank MB 551400.

Lophiopoacea Ariyaw. et al., Fungal Diversity 74: 220. 2015. — MycoBank MB 551240.

Neopaucispora Wanas. et al., Fungal Diversity 89: 65. 2018. — MycoBank MB 554146.

Neotrematosphaeria Thambug. et al., Fungal Diversity 74: 223. 2015. — MycoBank MB 551242.

Platystomum Trevis., Bull. Soc. Roy. Bot. Belgique 16: 16. 1877. — MycoBank MB 4185.

Pseudocapulatispora Mapook & K.D. Hyde, Fungal Diversity 101: 47. 2020. — MycoBank MB 557285.

Pseudolophiostoma Thambug. et al., Fungal Diversity 74: 235. 2015. — MycoBank MB 551250.

Pseudoplatystomum Thambug. & K.D. Hyde, Fungal Diversity 74: 237. 2015. — MycoBank MB 551253.

Sigarispora Thambug. & K.D. Hyde, Fungal Diversity 74: 238. 2015. — MycoBank MB 551255.

Type species. Lophiostoma macrostomum (Tode) Ces. & De Not., Comment. Soc. Crittog. Ital. 1 (fasc. 4): 219. 1863. — MycoBank MB 422081.

(based on Sphaeria macrostoma Tode, Fung. Mecklenb. Sel. (Lüneburg) 2: 12. 1791. — MycoBank MB 149287.

Ascomata scattered to crowded, immersed to semi-immersed, coriaceous to carbonaceous, dark brown to black, globose to subglobose, ostiolate. Ascoma apex crest-like, variable in shape, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium thicker at the apex and thinner at the base, composed of several layers of lightly pigmented to dark brown, thin-walled cells of textura angularis to textura prismatica, cells towards the inside lighter, sometimes fusing with and becoming indistinguishable from the host tissues. Hamathecium comprising septate, branched, cellular pseudoparaphyses, embedded in a gelatinous matrix. Asci 6–8-spored, bitunicate, fissitunicate, clavate to almost cylindrical, short to long pedicellate, rounded at the apex, with an ocular chamber. Ascospores partially biseriate, sometimes uniseriate, hyaline to brown, fusiform to ellipsoid, with narrow acute to rounded ends, 1- to multi-septate or muriform, constricted at the central septum, with or without terminal appendages.

Ecology — Saprobic on woody and herbaceous substrates in terrestrial and aquatic habitats.

(Kaz. Tanaka et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838972

Basionym. Trematosphaeria biappendiculata Kaz. Tanaka et al., Fungal Diversity 19: 149. 2005. — MycoBank MB 343643.

Synonym. Neotrematosphaeria biappendiculata (Kaz. Tanaka et al.) Thambug. et al., Fungal Diversity 74: 225. 2015. — MycoBank MB 551243.

Notes — The overall placement of the strains KTC 975 and KTC 1124 is uncertain due to the absence of the molecular markers of ITS, TEF1-α, and RPB2. Still, the species clearly nests within the genus Lophiostoma. When LSU is included in the phylogenetic analyses, L. biappendiculatum has been revealed as sister species to L. pseudodictyosporium with low support (Thambugala et al. 2015, Bao et al. 2019).

Fuckel, Jahrb. Nassauischen Vereins Naturk. 27–28: 29. 1874 — MycoBank MB 189009; Fig. 3

Fig. 3

Lophiostoma caespitosum. a–r. O-F-256902 - epitype. s–t. G00266553 - holotype. a–b. Cespitose ascomatal necks; c–d. section of ascomata; e–g. peridium; h–i. hymenium and pseudoparaphyses; j–l. asci; m–t. ascospores. — Scale bars: a–b = 1000 μm; c = 150 μm; d–e, h–i = 40 μm; f–g = 30 μm; j–t = 20 μm.

Synonym. Guttulispora crataegi Qing Tian et al., Fungal Diversity 74: 220. 2015. — MycoBank MB 551239.

Typus. SWITZERLAND, Suisse, at Neuchatel, on cortex of Crataegus, Feb. 1872, Morthier (G00266553-lectotype designated here; MBT 10000314). – AUSTRIA, Vienna, 22nd district, Lobau, Panozzalacke, on attached branches of Crataegus monogyna, 20 Nov. 2016, W. Jaklitsch & H. Voglmayr (O-F-256902, epitype designated here, MBT 10000315; ex-epitype culture CBS 147391 = LQ2; WU 37933, isoepitype designated here).

Sexual morph: Ascomata 166–323 μm diam, 150–300 μm high, solitary to most frequently cespitose, immersed, coriaceous to carbonaceous, dark brown to black, globose to subglobose, ostiolate. Ascoma apex central, papillate, crest-like, carbonaceous, rather small, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 30–100 μm thick, composed of several layers, with dark to reddish brown, thick-walled cells of textura angularis, becoming lighter towards the inside, somewhat compressed. Hamathecium comprising septate, branched, cellular pseudoparaphyses, longer than the asci, embedded in a gelatinous matrix. Asci (92–)96–122(–134) × (8–)9–12(–14) μm (n = 20), bitunicate, fissitunicate, narrowly clavate, short-pedicellate, apex rounded, with an ocular chamber, with 8 partially overlapping uniseriate to obliquely biseriate ascospores. Ascospores (16–)17–20(–22) × (5–)6–8 μm (n = 62), hyaline when immature and becoming dark brown when mature, ellipsoid to fusiform, 3-septate, constricted at each septum, upper part and particularly the second cell slightly wider, guttulate, smooth-walled, lacking a mucilaginous sheath.

Ecology — Saprobic on dead attached branches of Crataegus monogyna.

Additional materials examined. AUSTRIA, Vienna, 19th district, Himmelstraße, on attached branches of Crataegus monogyna, 18 Mar. 2020, W. Jaklitsch (WU 37935); 22nd district, Lobau, between Panozzalacke and the OMV fuel depot, on attached branches of Crataegus monogyna, 14 Mar. 2020, W. Jaklitsch (WU 37934).

Notes — There are several syntypes of Lophiostoma caespitosum (e.g., G00266553, S-F-7223), of which we here select collection G00266553 as lectotype. Morphologically, the lectotype material of L. caespitosum (G00266553) fully agrees with our material, and we epitypify the species with collection O-F-256902 to stabilise the species concept. Ascospores of L. caespitosum are similar to those of L. quadrinucleatum, but are significantly smaller, as already mentioned by Holm & Holm (1988). This species is specific for Crataegus monogyna and occurs on dead attached branches and twigs of this host very commonly in the east of Vienna along the river Danube. The host, spore size, shape and colour make this species characteristic within Lophiostoma. The name Guttulispora crataegi (Thambugala et al. 2015), which was based on two Italian specimens (isolates MFLUCC 13-0442 and MFLUCC 14-0993), is a synonym of L. caespitosum, as based on phylogenetic and morphological evidence. Guttulispora crataegi is the generic type of Guttulispora, which we synonymise with Lophiostoma, based on molecular phylogeny and morphology.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838971

Basionym. Sigarispora caryophyllacearum Wanas. et al., Fungal Diversity 89: 67. 2018. — MycoBank MB 554148.

Andreasen, Jaklitsch & Voglmayr, sp. nov. — MycoBank MB 838973; Fig. 4

Fig. 4

Lophiostoma carpini (O-F-256904 - holotype). a–b. Ascomata; c. section of ascoma; d–e. asci; f–k. ascospores. — Scale bars: a–b = 400 μm; c = 100 μm; d–e = 50 μm; f–k = 20 μm.

Etymology. With reference to its host Carpinus betulus.

Typus. AUSTRIA, Niederösterreich, Mannersdorf, at a wood pile, on Carpinus betulus, 17 Sept. 2015, W. Jaklitsch & H. Voglmayr (O-F-256904; ex-holotype culture CBS 147279 = LQ1).

Sexual morph: Ascomata 295–460 μm diam, semi-immersed to immersed, apex erumpent through host surface, subglobose, coriaceous, black, ostiolate, usually staining the substrate around the ascomata black. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 30–65 μm thick, composed of several layers, with dark to reddish brown, thick-walled cells of textura angularis, becoming lighter towards the inside, somewhat compressed. Hamathecium comprising filiform, hyaline, septate, guttulate, smooth cellular pseudoparaphyses. Asci (95–)99–128(–145) × (10–)11–14(–15) μm (n = 18), bitunicate, fissitunicate, clavate, apically rounded, with an ocular chamber, with 4–8 uniseriate to obliquely biseriate ascospores. Ascospores (18–)20–24(–27) × (6–)7–9(–10) μm (n = 67), brown to dark brown, fusiform with acute ends, narrower basal cell (4.6–)5–8(–8.8) μm (n = 34) long, usually 3–4-septate, constricted at the central septum, guttulate, smooth-walled, lacking a mucilaginous sheath.

Ecology — On decorticated wood of Carpinus betulus.

Notes — Strain CBS 147279 is nesting with low support in a clade with strain KT 530 named Lophiostoma caudatum and as a sister to the strain of Lophiostoma clematidis-vitalbae (MFLUCC 16-1368) without significant support. In the phylogenetic tree, there is generally a poor resolution in the upper part of the genus Lophiostoma (Fig. 1) due to lack of data for TEF1-α and RPB2, which is also true for RPB2 for Lophiostoma (cf.) caudatum (KT 530) (Thambugala et al. 2015) and Lophiostoma clematidis-vitalbae (MFLU 20-0417-holotype; ex-type culture MFLUCC 16-1368) (Phukhamsakda et al. 2020). There are differences in spore size and septation between L. carpini O-F-256904 with shorter and wider ascospores of fusiform shape (18–)20–24(–27) × (6–)7–9(–10) μm compared to KT 530 with more narrowly fusiform ascospores (23.5–34.5 × 5.5–7 μm). Ascospore septation differs with 3–4-septate for L. carpini O-F-256904 from (4–)5(–6)-septate for KT 530. As compared to L. caudatum KT 530, L. carpini O-F-256904 has larger ascomata 295–460 μm diam vs 145–210 μm diam for KT 530, and a thicker peridium. Moreover, the host of our specimen, Carpinus betulus, differs from that of L. caudatum KT 530, Dactylis glomerata. Hence, our material represents a taxon of its own, which we describe as the new species L. carpini. It is, however, even unclear whether the material from the monocot Dactylis glomerata collected in Japan is truly L. caudatum, because this species was originally described from decorticated branches of Paliurus spina-christi in France and was compared by Fabre (1879) to Rebentischia because of yellowish to pale brownish ascospores having a long, curved and pointed basal appendage cell (Fabre 1879: f. 47).

(D.F. Bao et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838974; Fig. 5

Fig. 5

Lophiostoma cf. clavatum (O-F-256905). a. Ascoma; b. section of ascomata; c–d. peridium; e–f. asci; g–n. ascospores. — Scale bars: a–b = 150 μm; d = 40 μm; e–f = 50 μm; c, g–n = 20 μm.

Basionym. Sigarispora clavata D.F. Bao et al., Mycosphere 10: 1090. 2019. — MycoBank MB 556722.

Sexual morph: Ascomata 320–590 μm diam, semi-immersed to immersed, subglobose, coriaceous, black, ostiolate. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 46–102 μm thick, comprising several layers consisting of brown to dark brown cells of textura globulosa to textura angularis, becoming lighter towards the inside. Hamathecium comprising filiform, hyaline, septate, guttulate, smooth cellular pseudoparaphyses. Asci (103–)117–139(–142) × (11–)12–16(–18) μm (n = 20), bitunicate, fissitunicate, clavate, apically rounded, with an ocular chamber, with 8 uniseriate to obliquely biseriate ascospores. Ascospores (15–)20–24(–25) × (5.5–)7–8(–8.5) μm (n = 78), ellipsoid to clavate, obtuse with basal cell (3–)4–7(–8) μm long (n = 32), straight or slightly curved, wider at one end, hyaline when young, yellowish brown to dark brown at maturity, 3–4(–5)-septate, slightly constricted at the septa, guttulate, smooth-walled.

Ecology — Saprobic on wood including Rosa canina.

Material examined. AUSTRIA, Niederösterreich, Gumpoldskirchen, vineyards above Melkerhof, on branches of Rosa canina, 9 Nov. 2014, W. Jaklitsch, H. Voglmayr & I. Krisai-Greilhuber (O-F-256905; culture CBS 147278 = LQ).

Notes — The strain CBS 147278 clusters with the ex-type strain of Lophiostoma clavatum (MFLUCC 18-1316) with strong support (Fig. 1). Further phylogenetic investigations should be implemented including additional molecular markers such as RPB2, to resolve the position of these strains within the genus Lophiostoma. There is a similarity in morphology, which supports that both strains may represent Lophiostoma clavatum. Still, there are also differences when comparing our specimen (O-F-256905) to that of Bao et al. (2019) (MFLU 19-0994 - holotype; ex type culture MFLUCC 18-1316), i.e., in larger ascospores (15–)20–24(–25) × (5.5–)7–8(–8.5) μm for our specimen compared to 13–17 × 4–6 μm. We also describe ascospores with up to five-septa and a basal cell of (3–)4–7(–8) μm length, which seems to differ from MFLU 19-0994. Asci are also longer and wider with (103–)117–139(–142) × (11–)12–16(–18) μm for our specimen compared to 91–117 × 9–12 μm in the latter. Lastly, our material is collected on branches of Rosa canina in Austria, while MFLU 19-0994 was collected on submerged decaying wood in Tibet. There is still a need for a continued sampling of both European and Asian material. Especially the amplification of the molecular markers ITS and RPB2 for the Asian material is needed to resolve whether these strains represent one or two species.

(Phukhams. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838975

Basionym. Sigarispora clematidicola Phukhams. et al., Fungal Diversity 102: 53. 2020 — MycoBank MB 557121.

(Phukhams. & K.D. Hyde) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838976

Basionym. Pseudolophiostoma clematidis Phukhams. & K.D. Hyde, Fungal Diversity 102: 51. 2020. — MycoBank MB 557120.

Andreasen, Jaklitsch & Voglmayr, nom. nov. — MycoBank MB 838977

Replaced synonym. Pseudocapulatispora clematidis Phukhams. & K.D. Hyde, Fungal Diversity 102: 47. 2020. — MycoBank MB 557118, non Lophiostoma clematidis (Phukhams. & K.D. Hyde) Andreasen et al., this study.

Etymology. With reference to its host Clematis subumbellata.

Notes — As the epithet clematidis is already occupied in Lophiostoma, a replacement name was necessary.

Andreasen, Jaklitsch & Voglmayr, nom. nov. — MycoBank MB 838978

Replaced synonym. Sigarispora clematidis Phukhams. & K.D. Hyde, Fungal Diversity 102: 53. 2020. — MycoBank MB 557122, non Lophiostoma clematidis (Phukhams. & K.D. Hyde) Andreasen et al., this study.

Etymology. With reference to its host Clematis vitalba.

Notes — As the epithet clematidis is already occupied in Lophiostoma, a replacement name was necessary.

(Pers.) Ces. & De Not., Comment. Soc. Crittog. Ital.: 19. 1861 — MycoBank MB 238397; Fig. 6

Fig. 6

Lophiostoma compressum. (a, m–n, p, r (O-F-256906). b–j, o, q, s–t (O-F-256909) k–l (O-F-192126). a–b. Ascomata; d–e, h. section of ascomata; f. section of ostiole; c, g. peridium (c. textura angularis at the side, g. textura prismatica at the base); i–l. asci; m–t. ascospores under Zeiss Axio Imager A2 compound microscope. — Scale bars: a–b = 300 μm; c, g = 40 μm; d–f, h = 50 μm; i–l = 30 μm; m–t = 20 μm.

Synonyms. Platystomum compressum (Pers.) Trevis., Bull. Soc. Roy. Bot. Belgique 16: 16. 1877. — MycoBank MB 144522.

Lophiostoma lojkanum (Sacc.) Mussat, in Saccardo, Syll. Fung. (Abellini) 15: 198. 1900. — MycoBank MB 241560.

Sexual morph: Ascomata 400–1000 μm diam, scattered to gregarious, immersed to erumpent, often giving the substrate an intense black colour, globose to subglobose, uniloculate, black, glabrous, ostiolate. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 50–120 μm (av. 82 μm, n = 80) thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells, pale inside, more or less fusing with host tissue at the outside. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing between the asci, embedded in a gelatinous matrix. Asci 90–230 × (10–)12–20 μm (n = 150), bitunicate, fissitunicate, narrowly clavate, pedicellate, apically rounded, with a minute ocular chamber, with 8 overlapping uni- to partly biseriate ascospores. Ascospores (15–)16–33(–35) × (6–)7–10(–12) μm (n = 300), hyaline when immature, becoming yellow-brown to dark brown at maturity, ellipsoid to oblong, muriform with (3–)4–7-transverse and 1–3-longitudinal septa, constricted at the middle septum, guttulate, smooth-walled.

Culture characteristics — Ascospores germinated on MEA within 24 h. Germ tubes produced from several cells. Colonies reaching 2.1–2.3 cm diam after 4 wk at 20 °C, subcircular, with irregular margins, white, turning (irregularly) grey, reverse brown.

Ecology — Saprobic on wood of deciduous trees.

Materials examined. AUSTRIA, Kärnten, St. Margareten im Rosental, Trieblach, village area, roadside, at the Bauhof, on Salix caprea, 13 Aug. 2016, W. Jaklitsch (O-F-256914; culture CBS 147390 = LC1); Niederösterreich, Pfaffstätten, nature reserve Heferlberg, on Quercus pubescens, 1 Nov. 2017, H. Voglmayr (O-F-256915; culture TEQ); Vienna, 21st district, Marchfeldkanalweg, on Cornus sanguinea, 22 Aug. 2015, W. Jaklitsch (O-F-256913; culture CBS 147276= LC). – NORWAY, Møre og Romsdal county, Ålesund municipality, on the bark of living Populus tremula, 31 Jan. 2018, O. Olsen (O-F-256906; culture CBS 147536 = MAL02); Viken county, Asker municipality, on bark of living Populus tremula, 29 Jan. 2019, M. Andreasen (O-F-256907; culture CBS 147538 = MAL49); Viken county, Asker municipality, on bark of living Populus tremula, 29 Jan. 2019, M. Andreasen (O-F-256908; culture CBS 147537 = MAL54); Vestfold county, Tjøme municipality, on dying branch of Salix sp., 18 July 2019, M. Andreasen (O-F-256909; culture CBS 147519 = MAL86); Vestfold county, Tjøme municipality, on Salix sp., 18 July 2019, M. Andreasen (O-F-256910; culture CBS 147520 = MAL90); Viken county, Asker municipality, on Salix sp., 15 Aug. 2019, M. Andreasen (O-F-256911; culture CBS 147521 = MAL93); Viken county, Asker municipality, on Phragmites australis, 15 Aug. 2019, M. Andreasen (O-F-256912; culture CBS 147615 = MAL94); unknown location, on Tilia cordata, 18th century, N. Green Moe & I. Jørstad (O-F-192124); Oslo county and municipality, on Quercus robur, 18th hundred, E. Rostrup (O-F-192125); Viken county, Bærum municipality, on Corylus, Jan. 1826, S.C. Sommerfelt & I. Jørstad (O-F-192126); Nordland county, Saltdal municipality, on Salix phylicifolia, Jan. 1824, S.C. Sommerfelt & G. Mathiassen (O-F-192128); Oslo county and municipality, on Pyrus malus, date unknown, M. Blytt & E. Rostrup (O-F-192129); Oslo county and municipality, on Salix sp., 5 Apr. 1912, J. Egeland (O-F-192130); location, host and date unknown, unknown collector (O-F-192131); location unknown, on Betula sp., date unknown, N. Green Moe & E. Rostrup (O-F-192133); Nordland county, Saltdal municipality, on Salix phylicifolia, date unknown, S.C. Sommerfelt & G. Mathiassen (O-F-192134); Oslo county and municipality, on Salix sp., date unknown, L. Holm (O-F-192136); Trøndelag county, Inderøy municipality, on Fraxinus excelsior, 8 May 2014, J.B. Jordal & B. Nordén (O-F-247841); Viken county, Lillestrøm municipality, on Salix sp., 29 Sept. 2015, B. Nordén (O-F-305118); Finnmark county, host unknown, Alta municipality, N. Green Moe & G. Mathiassen (O-F-186801); Vestland county, Luster municipality, on branch of living Ulmus glabra, 14 June 2012, B. Nordén & J.B. Jordal (O-F-247799); Vestland county, Ullensvang municipality, on Ulmus glabra, 3 Oct. 2013, B. Nordén, J.B. Jordal & T. Læssøe (O-F-255564). – SWEDEN, Västergötland county, Vänersborg municipality, on Viburnum opulus, 19 June 1898, A.G. Eliasson (O-F-192135).

Notes — Lophiostoma compressum is by far the most common species of Lophiostoma. It is widespread and occurs on a wide range of host species, and there is a high variability in ascospore size and septation. In our phylogeny, the strains of this species are clustering as a clade within Lophiostoma with low support for its overall placement as well as for the clade itself. Possibly, L. compressum is a species complex, but currently many strains of L. compressum lack specific markers, thus there is need for further phylogenetic investigations including additional molecular markers such as RPB2 and more fresh material collected in a larger area.

(A. Hashim. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838979

Basionym. Pseudolophiostoma cornisporum A. Hashim. et al., Stud. Mycol. 90: 173. 2018. — MycoBank MB 823140.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838980

Basionym. Sigarispora coronillae Wanas. et al., Fungal Diversity 74: 241. 2015. — MycoBank MB 551257.

Andreasen, Jaklitsch & Voglmayr, sp. nov. — MycoBank MB 839061; Fig. 7

Fig. 7

Lophiostoma dictyosporum (O-F-256916 - holotype). a. Ascomata; b–c. section of ascomata; d. hymenium; e, g–i. asci; j–r. ascospores. — Scale bars: a–c = 400 μm; d = 40 μm; e–f = 100 μm; g–i = 50 μm; j–r = 20 μm.

Etymology. With reference to the ascospores having both transverse and longitudinal septa.

Typus. MOROCCO, Agadir, Ait Melloul, behind the Agronomy and Veterinary Institute Hassan II, on a branch of Argania spinosa, 6 May 2015, W. Jaklitsch, M. Mokhtari & M. Louay (O-F-256916 - holotype; ex-holotype culture CBS 147389 = C191).

Sexual morph: Ascomata 504–985 μm diam, solitary or gregarious, immersed, coriaceous, black, globose to subglobose, ostiolate, apex well-developed. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 54–83 μm thick, firm, composed of brown to lightly pigmented cells of textura prismatica. Hamathecium comprising septate, unbranched, cellular pseudoparaphyses, anastomosing above the asci, embedded in a gelatinous matrix. Asci (185–)189–209(–221) × 12–16(–18) μm (n = 10), bitunicate, fissitunicate, cylindrical to subclavate, with a long pedicel, apically rounded, with an ocular chamber, containing 8 uniseriate, sometimes slightly overlapping ascospores. Ascospores (18–)20–25(–28) × (9–)10–12(–14) μm (n = 30), hyaline when immature, turning yellowish to brown, finally dark brown when mature, ellipsoid with slightly wider upper part, muriform with 3–7-transverse and 1–3-longitudinal septa, deeply constricted at the middle septum.

Ecology — Saprobic in wood of Argania spinosa.

Notes — Strain CBS 147389 belongs to a clade that also contains strains of Lophiostoma caespitosum and Lophiostoma fusisporum. The characteristic morphology of muriform ascospores in cylindrical to subclavate asci along with the host and phylogenetic placement of the strain within the genus Lophiostoma indicates that this is a species new to science.

Andreasen, Jaklitsch & Voglmayr, sp. nov. — MycoBank MB 838981; Fig. 8

Fig. 8

Lophiostoma erumpens (O-F-256921 - holotype). a–b. Ascomata; c–d. section of ascomata; e–h. asci; i–m. ascospores. — Scale bars: a = 350 μm; b–d = 200 μm; e–h = 50 μm; i–m = 20 μm (d in Cotton blue).

Etymology. With reference to the erumpent ascomata.

Typus. MOROCCO, N Agadir, Aourir, above Alma, N30°29′52,4 W09°33′43,3, elev. 535 m, on branchlets of Genista cf. ferox, 12 May 2015, W. Jaklitsch (O-F-256921; ex-holotype culture CBS 147275 = C220).

Sexual morph: Ascomata 200–400 μm diam, solitary or gregarious, immersed to erumpent, coriaceous, black, globose to subglobose, ostiolate, with well-developed apex. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 50–82 μm thick, thicker at the apex and thinner at the base, composed of a single layer of dark brown to black, thick-walled cells of textura angularis, cells towards the inside lighter, somewhat compressed, laterally fusing with the host tissues, thin at the base. Hamathecium comprising septate, unbranched, cellular pseudoparaphyses, anastomosing above the asci, embedded in a gelatinous matrix. Asci (95–)98–109(–116) × (15–)16–19(–20) μm (n = 20), bitunicate, fissitunicate, clavate, with short stipe < 10 μm, apically rounded, with an ocular chamber, containing 8 obliquely uni- to biseriate ascospores. Ascospores (19–)21–24(–26) × (7–)8–10(–12) μm (n = 70), yellowish brown to dark brown, ellipsoid to fusiform, muriform with 5–7 transverse and 1–2 vertical septa, constricted at the middle septum, upper part slightly wider, with pointed, (5–)6–10(–15) μm (n = 72) long appendages at both ends.

Ecology — Saprobic on twigs of leguminous shrubs; collected on Genista cf. ferox.

Notes — We name this species according to its erumpent habit rather than for its more characteristic ascospore appendages, because the epithet appendiculatum is occupied in Lophiostoma. Phylogenetically and morphologically L. erumpens is closely related to L. pseudodictyosporium (see Fig. 1), but distinct from that species. This is supported by the genetic distance, which is greater than given for several other species in the tree. Morphologically both species are similar in several respects, but on one hand ascomata of L. erumpens (O-F-256921) are smaller, 200–400 μm vs 400–700 μm in L. pseudodictyosporium. However, the most striking difference from L. pseudodictyosporium are the ascospore appendages, which are very conspicuous and (5–)6–10(–15) μm long in L. erumpens, but inconspicuous and small in L. pseudodictyosporium (cf. f. 8j–m in Thambugala et al. 2015). In that publication appendage length is not stated in the species description, but the appendages of MFLU 14-0586 are apparently not longer than 5 μm. We also note that both species have fabacaceous hosts, which belong to different genera, Genista vs Spartium.

Andreasen & Nordén, sp. nov. — MycoBank MB 829060; Fig. 9

Fig. 9

Lophiostoma fusisporum (O-F-256920 - holotype). a–c. Ascomata; d–e. section of ascomata; f–g. peridium; h–i. hymenium; j–o. asci and pseudoparaphyses; p–q. immature ascospores; r–y. ascospores. — Scale bars: a–c = 200 μm; d–e = 100 μm; f–g = 40 μm; h–o = 20 μm; p–y = 10 μm.

Etymology. With reference to the fusiform ascospores.

Typus. NORWAY, Oslo county and municipality, on the bark of living Acer platanoides, 28 Sept. 2018, M. Andreasen (O-F-256920 - holotype; ex-holotype culture MAL04).

Sexual morph: Ascomata 300–700 μm diam, solitary to scattered, subimmersed, coriaceous to carbonaceous, dark brown to black, globose to subglobose, ostiolate. Ascoma apex papillate, crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 75–100 μm thick, composed of a single layer of dark to reddish brown, thick-walled cells of textura angularis, cells towards the inside lighter, somewhat compressed, laterally fusing with the host tissues, thin at the base. Hamathecium comprising septate, branched, cellular pseudoparaphyses, embedded in a gelatinous matrix. Asci (110–)116–146(–155) × (11–)12–17(–20) μm (n = 30), bitunicate, fissitunicate, clavate, short-pedicellate, apically rounded, with an ocular chamber, with 6–8 uniseriate to obliquely biseriate ascospores. Ascospores (19.5–)22–26(–28) × (8–)9–10(–11) μm (n = 31), hyaline when immature, brown when mature, end cells remaining lighter to hyaline, fusiform to oblong-ellipsoid, 3-septate, constricted at all septa but more at the middle, upper part slightly wider, guttulate in each cell, two middle cells with a lenticular lumen when overmature, with inconspicuous verruculose ornamentation.

Culture characteristics — Ascospores germinated on MEA within 24 h at 20 °C. Germ tubes produced from end and central cells. Colonies 0.5–1 cm diam after 4 wk, subcircular with somewhat irregular margins; initially pale grey, slightly darkening with time; reverse black.

Ecology — Saprobic on dead bark of living Acer platanoides.

Notes — Lophiostoma fusisporum clusters with Lophiostoma caespitosum with high BPP (0.99) and medium MLB (66 %) support. Interestingly, despite several efforts, it was impossible to produce LSU sequences for this species. Morphologically, L. fusisporum differs from L. caespitosum in several characters having an overall bigger size of ascomata, peridium wall, asci and having much larger fusiform ascospores with narrowly rounded hyaline end cells. Asci have a more clavate form and are wider (up to 20 μm). We also note that it has a different host, Acer platanoides, than L. caespitosum (Crataegus). This species has very characteristic fusiform 3-septate spores with paler end cells and one big oil droplet in each cell.

(Dayar. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838982

Basionym. Lophiohelichrysum helichrysi Dayar. et al., Fungal Diversity 75: 85. 2015. — MycoBank MB 551401.

(Thambug. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838983

Basionym. Biappendiculispora japonica Thambug. et al., Fungal Diversity 74: 214. 2015. — MycoBank MB 551529.

Notes — The species was earlier named Lophiostoma caulium var. f (Tanaka & Harada 2003b).

(Ariyaw. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838984

Basionym. Alpestrisphaeria jonesii Ariyaw. et al., Phytotaxa 277: 261. 2016. — MycoBank MB 552363

Andreasen & Nordén, sp. nov. — MycoBank MB 838985; Fig. 10

Fig. 10

Lophiostoma jotunheimenense (O-F-256917 - holotype). a–b. Ascomata; c–d. section of ascomata; e–f. peridium; g, j. hymenium; h–i. asci; k–l. immature ascospores; m–s. ascospores. — Scale bars: a, b, d = 300 μm; c = 100 μm; e–g, i–j = 25 μm; h = 50 μm; k–s = 15 μm.

Etymology. Referring to the collection site Jotunheimen National Park.

Typus. NORWAY, Oppland county, Lom municipality, on Salix glauca, 29 June 2019, M. Andreasen (O-F-256917 - holotype; ex-holotype culture CBS 147522 = MAL88).

Sexual morph: Ascomata large and coarse, 425–1250 μm diam, scattered to gregarious, immersed to erumpent, globose to subglobose, uniloculate, black, glabrous, ostiolate, arranged in a closely aligned layer, giving the substrate an intense black colour. Ascoma apex crest-like, central or lateral, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 50–100 μm thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells, outside fusing with host tissue, paler inward. Hamathecium comprising branched, cellular paraphyses, anastomosing among asci, embedded in a gelatinous matrix. Asci (125–)135–160(–167) × (11–)12–14(–15) μm (n = 21), bitunicate, fissitunicate, narrowly clavate, with short stipe < 10 μm, apically rounded, with a minute ocular chamber, with 8 uniseriate to obliquely over-lapping ascospores. Ascospores (18–)20–25(–29) × (7–)8–10(–11) μm (n = 62), first hyaline becoming brown with paler to hyaline end cells, when immature fusiform with acute end cells, becoming oblong-ellipsoid with more or less rounded ends at maturity, upper part wider, 1-septate when immature, becoming muriform with 3–6(–7)-transverse and 1–2-longitudinal septa when mature, distinctly constricted at the middle septum and slightly at other septa, guttulate only when immature, smooth-walled.

Culture characteristics — Ascospores germinated on MEA within 24 h at 20 °C. Germ tubes produced from end and central cells. Colonies 2.4–5.6 cm diam after 4 wk, subcircular with irregular margins. Colour pale grey, turning dark grey at lower levels; reverse black.

Ecology — Saprobic on dead branches still attached on living Salix glauca in an alpine environment.

Notes — We present phylogenetic support for this new species as being a sister species to Lophiostoma rosae-ecae (MLP 80 % and BPP 0.90) and nesting in a larger clade composed of L. crenatum, L. macrostomum, L. multiseptatum, and L. pseudodictyosporium. The morphology of this species resembles that of Lophiostoma compressum in some aspects. Still, it has more oblong ellipsoid muriform spores with pale to hyaline end cells and often with longitudinal septa running parallel to the spore axis. This specimen was found in alpine environments at approximately 1 200 m altitude. It differs from L. rosae-ecae by oblong-ellipsoid spores vs fusiform spores in L. rosae-ecae, overall shorter in size with less acute hyaline end-cells. Spore septation also differs with 3–6(–7)-transverse and 1–2-longitudinal septa, compared to the 3-transversely-septate ascospores of L. rosae-ecae. Asci are narrower, up to 14(–15) μm wide compared to up to 25 μm wide in L. rosae-ecae, and longer, up to 160(–167) μm. Lastly, we note different hosts, Salix glauca vs Rosa ecae in the latter.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838987

Basionym. Sigarispora junci Wanas. et al., Fungal Diversity 89: 69. 2018. — MycoBank MB 554149.

(Mapook & K.D. Hyde) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838988

Basionym. Pseudocapulatispora longiappendiculata Mapook & K.D. Hyde, Fungal Diversity 101: 48. 2020. — MycoBank MB 557286

De Not., Comment. Soc. Crittog. Ital. 1 (fasc. 4): 219. 1863 — MycoBank MB 241835; Fig. 11

Fig. 11

Lophiostoma macrostomoides (O-F-256918). a–b. Ascomata; c–d. section of ascomata; e–f. peridium (textura angularis at the base); g–h. asci; i–k. immature ascospores; l–q. ascospores under Zeiss Axio Imager A2 compound microscope. — Scale bars: a–c = 150 μm; d = 300 μm; e, g = 50 μm; f, i–q = 20 μm; h = 60 μm.

Sexual morph: Ascomata large and coarse, 400–1200 μm diam, scattered, gregarious, immersed to erumpent, globose to subglobose, black, glabrous, ostiolate. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium (50–)75–125 μm thick, composed of several layers of dark brown to black, thick-walled cells, forming textura angularis, tending to be paler inward, fusing with host tissue at the outermost layer. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci (120–)130–170(–200) × (6–)8–15(–17) μm (n = 50), bitunicate, fissitunicate, clavate, with a stipe > 10 μm, apically rounded, with a minute ocular chamber, with 8 biseriately arranged ascospores. Ascospores (30–)32–40(–42) × (8–)9–10(–12) μm (n = 100), brown, with sometimes lighter end cells, oblong-ellipsoid to broadly cylindrical, with (3–)5–7-transverse septa, constricted at the middle septum, at maturity cell above middle septum slightly wider than others, guttulate, smooth-walled.

Culture characteristics — Ascospores germinated on MEA within 24 h at 20 °C. Germ tubes produced from end and central cells. Colonies 1.9–2.4 cm diam after 4 wk, more or less circular with somewhat irregular margins; initially whitish becoming light greyish to dark grey from below, margin dark grey to black; reverse black.

Ecology — Saprobic in wood of deciduous trees and shrubs such as Quercus, Ulmus, Salix, but also found on the coniferous Juniperus communis.

Materials examined. AUSTRIA, Kärnten, St. Margareten im Rosental, on Salix cinerea, 21 July 2016, W. Jaklitsch (O-F-256919; culture CBS 147277 = LMS). – NORWAY, Viken county, Asker municipality, on Juniperus communis, 15 Dec. 2018, M. Andreasen (O-F-256918; culture CBS 147523 = MAL32).

Notes — The strains CBS 147523 and CBS 147277 cluster with high support with strain CBS 123097, representing L. macrostomoides, all clustering as a clade with high support. Our specimens are morphologically clearly L. macrostomoides. Still, high intraspecific variability in spore shape and septation within each specimen was observed. This variation was observed both between the examined specimens, but also within each specimen. One clear difference in morphology, compared to the closely resembling L. pseudomacrostomum, was the absence of longitudinal septa in any of the ascospores of the examined material.

DNA sequences of two species from Africa misidentified as Lophiostoma macrostomoides are present in GenBank. One is from Kenya, represented by the specimens GKM 1033, GKM 1159 and GKM 224N. Both ML and Bayesian analyses placed them outside the Lophiostomataceae, thus they were not further considered here. For the other species, represented by the strains CBS 113435 and CBS 121412, originating from South Africa, only ITS and LSU sequences are available. A preliminary LSU analysis placed them outside L. macrostomoides. As the correct position of this species could not be determined by multigene analyses, these accessions were not included.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838990

Basionym. Sigarispora medicaginicola Wanas. et al., Fungal Diversity 89: 69. 2018. — MycoBank MB 554150.

(Phukhams. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838991

Basionym. Sigarispora montanae Phukhams. et al., Fungal Diversity 102: 55. 2020. — MycoBank MB 557121.

Andreasen, Jaklitsch & Voglmayr, nom. nov. — MycoBank MB 838992

Replaced synonym. Sigarispora muriformis Tibpromma et al., Fungal Diversity 83: 37. 2017. — MycoBank MB 552696, non Lophiostoma muriforme Hazsl., Mathem. Természettud. Közlem. Magg. Tudom. Akad. 25 (2): 84. 1893 ‘1892’. — MycoBank MB 141107.

Notes — As the epithet muriforme is already occupied in Lophiostoma, a replacement name was necessary.

(A. Hashim. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838993

Basionym. Pseudolophiostoma obtusisporum A. Hashim. et al., Stud. Mycol. 90: 173. 2018. — MycoBank MB 823141.

(Qing Tian et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838994

Basionym. Sigarispora ononidis Qing Tian et al., Fungal Diversity 78: 37. 2016. — MycoBank MB 551729.

(Ariyaw. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838995

Basionym. Lophiopoacea paramacrostoma Ariyaw. et al., Fungal Diversity 74: 221. 2015. — MycoBank MB 551241.

Andreasen & Nordén, sp. nov. — MycoBank MB 838996; Fig. 12

Fig. 12

Lophiostoma plantaginis (O-F-256936 - holotype). a. Host; b, d ascomata; c. sectioned ascoma; e. peridium; f. hymenium; g. immature ascus; h–i. immature ascospores; j–n. ascospores. — Scale bars: a = 1 cm; b, d = 200 μm; c = 100 μm; e, g = 50 μm; f = 40 μm; h–n = 20 μm.

Etymology. With reference to its host Plantago maritima.

Typus. NORWAY, Viken county, Asker municipality, on the rhizome of Plantago maritima, 15 Aug. 2019, M. Andreasen (O-F-256936 - holotype; ex-holotype culture CBS 147527 = MAL92); Vestfold county, Porsgrunn municipality, on the rhizome of Plantago maritima, 21 Sept. 2020, M. Andreasen (O-F-256937 - paratype).

Sexual morph: Ascomata 100–293 μm diam, immersed-erumpent, subglobose, scattered to gregarious, carbonaceous, black. Ascoma apex central or lateral crest-like, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 31–51 μm thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells forming textura angularis, paler inwardly, laterally fusing with host tissue at the outermost layer. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci (80–)83–125 × 13–22(–24) μm (n = 20), bitunicate, fissitunicate, clavate, with a stipe < 10 μm long rounded at the apex, apical chamber present, short to long-stalked, with 8 biseriate or partially overlapping, obliquely uniseriate ascospores. Ascospores (28–)29–33(–36) × (8–)10–13 μm (n = 30), fusiform to ellipsoid-fusiform with narrowly rounded ends, at first hyaline, smooth and 1-septate, finally brown, verruculose and 1–3-septate, sharply constricted at the median septum.

Culture characteristics — Ascospores germinated on MEA within 24 h. Germ tubes produced from one or both ends of ascospores. Colonies 3.4–4.7 cm diam after 4 wk at 20 °C, subcircular with somewhat irregular margins; white with some pale-yellow areas; reverse black.

Ecology — Saprobic on rhizomes of Plantago maritima, growing in the marine tidal zone of the Oslo-fjord.

Notes — This species forms a strongly supported clade comprising strain CBS 147527 and SC-12 as a sister clade to Lophiostoma jonesii. It should be noted that the phylogenetic similarity of these strains is only based on the molecular markers of 5.8S, ITS2 and LSU, unfortunately lacking RPB2 and TEF1-α. Sequence similarities in the ITS region between the two species are relatively low (506/518 = 97.683 %; sequence data not added in the alignment of this study). Our specimens are saprobic on rhizomes of Plantago maritima growing in the tidal zone of saltwater in the Oslo fjord. Zhou et al. (2014) described ‘Trematosphaeria’ terricola = Lophiostoma terricola (strain SC-12) based on morphological similarities to Trematosphaeria. However, it was shown to cluster with strong support as a sister clade to the remaining taxa of Lophiostoma by Thambugala et al. (2015). The strain SC-12 was isolated from ascomata found on alpine soil in China at an altitude of 3 177 meters. Our specimens examined were very fragile, rather old and in poor condition, thus making it challenging to present photos of mature asci and mature spores, which were unstable or disintegrated before or during the investigation. Morphological investigations give support for a new species when compared to L. terricola (strain SC-12) (Zhou et al. 2014), with an overall smaller size of both ascomata, peridium and ascospores. Mature ascospores also tend to be shorter, are of more oval shape and some remain 1-septate as compared to the more narrowly fusiform, 3-septate mature ascospores of L. terricola. Ascospores are overall shorter and broader in L. plantaginis, (28–)29–33(–36) μm × (8–)10–13 μm vs 31–42 μm × 7.7–10.7 μm in L. terricola. Ascomata of L. plantaginis are without a cover of brown septate hyphae, and both ascomata and the peridium are of smaller dimensions, 100–293 μm diam and 31–51.5 μm thick vs 346–632 μm diam and 52–112 μm thick for L. terricola, respectively. Asci of our specimen are overlapping in size with a tendency to being slightly shorter with up to 125 μm compared to up to 140 μm for L. terricola. Lastly, the alteration in host and environment (marine tidal zone and plant host vs alpine soil), together with the morphological and sequence differences, support the establishment of a new species.

Qing Tian et al., Fungal Diversity 72: 114. 2015 — MycoBank MB 550887

Synonym. Coelodictyosporium pseudodictyosporium (Qing Tian et al.) Thambug. & K.D. Hyde, Fungal Diversity 74: 218. 2015. — MycoBank MB 551236.

Notes — Based on an asexual morph, L. pseudodictyosporium (MFLU 14–0737 - holotype, ex-type culture MFLUCC 13-0451) was first described by Liu et al. (2015). Shortly afterwards, it was combined in the new genus Coelodictyosporium by Thambugala et al. (2015), who simultaneously described the new species C. muriforme (MFLU 14-0586, culture MFLUCC 13-0351) based on a sexual morph. Both species were collected on the same host, Spartium junceum, in Italy. Lophiostoma pseudodictyosporium and C. muriforme may represent different morphs of the same fungus, but due to some sequence differences we currently keep them apart, and the new name Lophiostoma spartii-juncei is therefore proposed for C. muriforme.

Sacc., Michelia 1 (no. 3): 339. 1878 — MycoBank MB 156130; Fig. 13

Fig. 13

Lophiostoma pseudomacrostomum. a–m (O-F-256922). n–s (O-F-256925). t–z (O-F-256924). a–b. Ascomata; c. section of ascoma; d–e. peridium; f–g. asci; h–z. ascospores (immature in n, t–u; h–m under Zeiss Axio Imager A2 compound microscope). — Scale bars: a–b = 500 μm; c, f–g = 50 μm; d–e = 10 μm; h–z = 20 μm.

Synonyms. Navicella pseudomacrostoma (Sacc.) Kuntze, Revis. Gen. Pl. 3 (2): 500. 1898. — MycoBank MB 527378.

Platystomum compressum var. pseudomacrostomum (Sacc.) Chesters & A.E. Bell, Mycol. Pap. 120: 49. 1970. — MycoBank MB 348636.

Sexual morph: Ascomata large and coarse, (250–)400–1100 μm diam, scattered, gregarious, immersed to erumpent, globose to subglobose, uniloculate, black, glabrous, ostiolate. Ascoma apex central or lateral, crest-like, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium (50–)75–125 μm thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells forming a textura angularis, paler inward, outermost layer fusing with host tissue. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci (120–)130–170(–200) × 10–15(–17) μm (n = 75), bitunicate, fissitunicate, clavate, with a stipe > 10 μm long, apically rounded, with a minute ocular chamber, with 4 or 8 biseriate ascospores. Ascospores (20–)25–35(–36) × (7–)9–10(–12) μm (n = 120), uniseriate, brown, some-times with slightly paler end cells, oblong-ellipsoid to broadly cylindric, straight or curved, with (3–)5–8-transverse septa, in a small fraction also with 1 longitudinal septum in 1–2(–3) cells, constricted at the middle septum, upper part often wider than the lower, guttulate, smooth-walled.

Materials examined. NORWAY, Vestland county, Kvam municipality, on Tilia cordata, 15 May 2019, M. Andreasen (O-F-256922; culture CBS 147524 = MAL73); Viken county, Frogn municipality, on Tilia cordata, 4 June 2019, M. Andreasen (O-F-256923; culture CBS 147525 = MAL81); Viken county, Frogn municipality, on Tilia cordata, 5 June 2019, M. Andreasen (O-F-256924; culture CBS 147526 = MAL83); Viken county, Frogn municipality, on Tilia cordata, 5 June 2019, M. Andreasen (O-F-256925; culture MAL84); Troms county, Bardu municipality, on dead and decaying branches, 9 July 2002, G. Mathiassen (T-F-14733/2, T-F-14792/2, T-F-14911, T-F-14912, T-F-14913, T-F-14914, T-F-14915, T-F-14916); Kv‘nangen municipality, Vassnes, on a dead branch, 9 July 2002, G. Mathiassen (T-F-14917).

Notes — The strains CBS 147524, CBS 147525 and CBS 147526 form a clade with low support in the phylogenetic analyses (Fig. 1). When we combine phylogenetic and morphological evidence, there is an indication of an independent species. We are therefore able to support Holm & Holm′s (1988) suggestion that L. pseudomacrostomum is a distinct species within the genus Lophiostoma. There is a need of further sampling and amplification of the marker RPB2 to resolve the overall placement of the species within Lophiostoma. Holm & Holm (1988) and earlier Chesters & Bell (1970) mentioned that collections with morphological similarities to Lophiostoma macrostomoides but with the presence of dictyospores could represent the species L. pseudomacrostomum. Chesters & Bell (1970) assumed that the species is an intergrading form between L. compressum and L. macrostomoides, while Holm & Holm (1988) indicated a closer relationship to L. macrostomoides than to L. compressum. The material of O-F-256922, O-F-256923, O-F-256924 and O-F-256925, representing L. pseudomacrostomum, showed morphological similarities of ascomata, peridium, asci, and to some extent ascospores with L. macrostomoides, indicating a close relationship. We observed dictyospores in all material of L. pseudomacrostomum examined, in some instances dictyospores were few and in others numerous. No dictyospores were seen in the material of L. macrostomoides. Still, high intraspecific variability in spore shape and septation was observed within each specimen and even within ascomata, both for L. pseudomacrostomum and L. macrostomoides.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 838997

Basionym. Neopaucispora rosae-ecae (as ‘rosaecae’) Wanas. et al., Fungal Diversity 89: 65. 2018. — MycoBank MB 554147.

Notes — The host of this specimen is Rosa ecae (Rosaceae), and therefore the correct epithet is rosae-ecae, not rosaecae as given in the original publication. This species is erroneously listed under the epithet Neopaucispora rosacearum (isotype, ex-type MFLUCC 17-0807) in Phukhamsakda et al. (2020).

Andreasen, Jaklitsch & Voglmayr, nom. nov. — MycoBank MB 838998

Etymology. Referring to its host Scrophularia.

Replaced synonym. Sigarispora scrophulariae Wanas. et al., Fungal Diversity 89: 79. 2018. — Index Fungorum IF 554152, non Lophiostoma scrophulariae Peck, Ann. Rep. N.Y. State Mus. Nat. Hist. 28: 76. 1876 ‘1875’. — MycoBank MB 151334.

Notes — As the epithet is already occupied by Lophiostoma scrophulariae Peck, a new epithet was necessary.

Andreasen, Jaklitsch & Voglmayr, nom. nov. — MycoBank MB 839062

Replaced synonym. Coelodictyosporium muriforme Thambug. et al., Fungal Diversity 74: 218. 2015. MycoBank MB 551237. — MycoBank MB 362316, non Lophiostoma muriforme Hazsl., Mathem. Természettud. Közlem. Magg. Tudom. Akad. 25 (2): 84. 1893 ‘1892’. — MycoBank MB 141107.

Notes — Although Coelodictyosporium muriforme may be synonymous with Lophiostoma pseudodictyosporium, we currently keep the taxa separate (see Notes of L. pseudodictyosporium). The host of these taxa is Spartium junceum. As the names L. muriforme and L. spartii already exist, a new name was necessary for C. muriforme in Lophiostoma.

Andreasen, Jaklitsch & Voglmayr, sp. nov. — MycoBank MB 838999; Fig. 14

Fig. 14

Lophiostoma submuriforme (O-F-256926 - holotype). a. Habit; b–c. sections of ascomata; d. ascomatal apices; e. peridium; f–g. hymenium; h, l–s. ascospores; i–k. asci. — Scale bars: a = 2 mm; b = 200 μm; c = 100 μm; d = 300 μm; e, g = 40 μm; f, i–k = 50 μm; h, l–s = 20 μm.

Etymology. With reference to the submuriform ascospores.

Typus. MOROCCO, near the water reservoir between Touaachak and Seissid, N30°02′38,6 W09°05′47,3, elev. 588 m, on twigs of Genista cf. ferox, 9 May 2015, W. Jaklitsch (O-F-256926 - holotype; ex-type culture CBS 147274 = C217).

Sexual morph: Ascomata 140–340 μm diam, solitary to gregarious, immersed to erumpent, coriaceous, black, globose to subglobose, ostiolate, apex well-developed. Ascoma apex crest-like, central, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 92–112 μm thick, strongly developed around the whole hymenium, composed of brown to lightly pigmented cells of tendencies to textura angularis but also textura prismatica in ostiole regions and at the base. Hamathecium, unbranched, pseudoparaphyses, anastomosing above the asci, embedded in a gelatinous matrix. Asci (96–)103–126(–139) × (11–)12–15.8(–17) μm (n = 22), bitunicate, fissitunicate, clavate, with a long pedicel, apically rounded, with an ocular chamber, with 8 partly biseriate ascospores. Ascospores 18–22(–25) × 8–11 μm (n = 30), yellowish brown to dark brown, fusiform becoming ellipsoid with end cells being first acute becoming more rounded at maturity, with 1–3 transverse septa and in a variable fraction also with 1–2 longitudinal septa, distinctly constricted at the middle septum, upper part slightly wider.

Ecology — Saprobic on wood of Genista cf. ferox.

Notes — Phylogenetically, L. submuriforme is situated in a statistically unsupported clade together with L. caudatum, L. clavatum, L. coronillae, and L. scrophulariicola. The characteristic morphology with dictyospores having acute end-cells when immature along with phylogenetic evidence indicates that this is a species new to science.

(G.S. Gong) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 839000

Basionym. Trematosphaeria terricola G.S. Gong, Mycol. Progr. 13: 38. 2013 ‘2014’. — MycoBank MB 801031.

Synonym. Alpestrisphaeria terricola (G.S. Gong) Thambug. & K.D. Hyde, Fungal Diversity 74: 214. 2015. — MycoBank MB 551233.

(Wanas. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 839001

Basionym. Sigarispora thymi Wanas. et al., Fungal Diversity 89: 80. 2018. — MycoBank MB 554153.

(A. Hashim. et al.) Andreasen, Jaklitsch & Voglmayr, comb. nov. — MycoBank MB 839002

Basionym. Pseudolophiostoma tropicum A. Hashim. et al., Stud. Mycol. 90: 175. 2018. — MycoBank MB 823142.

K. Hiray. & Kaz. Tanaka, Mycoscience 52: 405. 2011 — MycoBank MB 561063

Type genus. Lophiotrema Sacc. — MycoBank MB 2934.

A. Hashim. & Kaz. Tanaka, Persoonia 39: 68. 2017 — MycoBank MB 819252

Type species. Antealophiotrema brunneosporum (Yin. Zhang et al.) A. Hashim. & Kaz. Tanaka. 2017. — MycoBank MB 819253.

Sexual morph: Ascomata subglobose to depressed ellipsoid. Ascoma apex central, carbonaceous, crest-like, elongated, laterally compressed. Peridium composed of two layers; outer layer darker red brown to black, inner pale golden brown, forming textura prismatica to textura angularis on the inner side wall, fusing with host tissue in lower parts. Hamathecium of septate, branched and anastomosed, cellular pseudoparaphyses, embedded in a gelatinous matrix. Asci bitunicate, fissitunicate, cylindrical to narrowly clavate, apically rounded with an ocular chamber, with 6–8 biseriate ascospores. Ascospores narrowly fusiform, with rounded ends, 1–3-septate, hyaline to brown, often hyaline becoming brown at maturity, guttulate when immature, smooth.

Ecology — Saprobic on woody plants.

Notes — This genus does not belong to the family, but we consider it at this place because we used this genus as outgroup for rooting the phylogenetic tree of the Lophiotremataceae and because we describe a new species in the genus.

Andreasen, Nordén & J.B. Jordal, sp. nov. — MycoBank MB 839003; Fig. 15

Fig. 15

Antealophiotrema populicola. (O-F-256929 - holotype). a–b. Ascomata; c. section of ascoma; d. peridium; e–h. asci; i–q. ascospores (immature in i–k). — Scale bars: a–c = 100 μm; d–g = 40 μm; h = 20 μm; i–q = 20 μm (n–q in Cotton blue).

Etymology. With reference to the host species Populus tremula.

Typus. NORWAY, Møre og Romsdal county, Tingvoll municipality, on the bark of old living Populus tremula, 12 Oct. 2018, J.B. Jordal (O-F-256929 - holotype; ex-holotype culture CBS 147528 = MAL63); Møre og Romsdal county, Aure municipality, on the bark of old living Populus tremula, 18 Nov. 2019, J.B. Jordal (O-F-256928 - paratype; ex-paratype culture CBS 147529 = MAL64).

Sexual morph: Ascomata 160–280 μm diam, subglobose, black. Ascoma apex central, crest-like, elongated, laterally compressed, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 20–40 μm thick, composed of two layers; outer layer darker red brown to black, inner pale golden brown, forming textura prismatica to textura angularis on the inner sidewall, fusing with host tissue in lower parts. Hamathecium comprising septate, branched, cellular pseudoparaphyses, anastomosing among and between the asci, embedded in a gelatinous matrix. Asci (116–)127–144(–161) × (13–)14–17(–18) μm (n = 30), bitunicate, fissitunicate, cylindrical to narrowly clavate, with a stipe < 10 μm, apically rounded, with an ocular chamber, with 6–8 biseriate ascospores, short-stiped. Ascospores (23–)25–38(–42) × (7–)8–9(–10) μm (n = 68), narrowly fusiform with narrowly rounded ends, 1–3-septate, strongly constricted at the median septum, first hyaline becoming brown, guttulate, smooth.

Culture characteristics — Ascospores germinated on MEA within 48 h at 20 °C. Germ tubes produced from end and central cells. Colonies 2–2.6 cm diam after 4 wk, subcircular with somewhat irregular margins; initially whitish becoming light greyish to dark grey from below; reverse black.

Ecology — Saprobic on the bark of living Populus tremula.

Notes — In the presented tree (Fig. 2), this species and Antealophiotrema brunneosporum (CBS 123095) are used as the outgroup to Lophiotremataceae. Hashimoto et al. (2017) noted that A. brunneosporum (CBS 123095) and ‘Lophiotrema’ boreale (CBS 114422) formed a fully supported clade (100 % MLB BP/1.00 BPP) outside the Lophiotremataceae. Thus, they recognised them as a distinct lineage named Antealophiotrema as a genus incertae sedis in the Pleosporales. Strains CBS 147528 and CBS 147529 as presented here might shed light on the familiar placement of this family, but an extended dataset is needed. However, we show strong support (100 % ML BP/1.00 Bayesian PP) for our two strains nesting as a sister species next to A. brunneosporum. Antealophiotrema brunneosporum and ‘Lophiotrema’ boreale were misidentified initially as species in Lophiotrema based on morphological resemblance to the genus (Mathiassen 1989, 1993, Zhang et al. 2009a). Further examination is needed to clarify the taxonomic placement of ‘Lophiotrema’ boreale (TROM-F-6942 = GM 218). Morphologically, A. populicola differs from ‘Lophiotrema’ boreale as described by Mathiassen (1989), by having significantly larger asci ((116–)127–144(–161) × (13–)14–17(–18)) μm vs 70–90(–95) × 5.5–7 μm), and by larger ascospores of slightly different shape ((23–)25–38(–42) × (7–)8–9(–10) μm and narrowly fusiform vs 13–16(–17) × 3–5 μm and ellipsoid to fusiform). Both species also have different hosts, Salix nigricans ssp. nigricans and Salix nigricans ssp. borealis for ‘Lophiotrema’ boreale (Mathiassen 1989), and Populus tremula for A. populicola. However, Holm & Holm (1988) reported ‘Lophiotrema’ boreale also from Alnus, Betula, Corylus, and Fraxinus spp. Antealophiotrema populicula differs from A. brunneosporum as described by Hashimoto et al. (2017) in smaller ascomata (160–280 μm vs 460–530 μm diam), thinner peridium (20–40 μm vs 42.5–62.5 μm thick), and shorter ascospores ((23–)25–38(–42) μm vs 34.5–48 × 6.5–10 μm). Finally, we note that the host of A. populicola (Populus tremula) differs from that of A. brunneosporum (Salix sp.).

A. Hashim. & Kaz. Tanaka, Persoonia 39: 59. 2017 — MycoBank MB 819240

Type species. Atrocalyx acutisporus A. Hashim. & Kaz. Tanaka. 2017. — MycoBank MB 819241.

Sexual morph: Ascomata solitary or scattered to gregarious, semi-immersed to immersed or erumpent, sometimes forming a black continuous crust. Ascoma apex crest-like, elongated and laterally compressed, sometimes surrounded by dark brown hyphae. Peridium composed of two to several layers of dark brown to black, thick-walled pseudoparenchymatous cells, forming textura angularis or textura prismatica, paler inwardly, fusing with host tissue at the outermost layer. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci bitunicate, fissitunicate, cylindrical to cylindric-clavate, apically rounded with an ocular chamber, containing 6–8 uniseriate to obliquely overlapping ascospores, with short stipe. Ascospores broadly fusiform to ellipsoid, with obtuse to acute ends, brown or hyaline, 1–3-septate, guttulate, smooth to verruculose, with or without mucilaginous/gelatinous sheath, with or without appendages.

Ecology — Saprobic on woody plants.

Notes — Hashimoto et al. (2017) stated that the genus Atro-calyx is morphologically similar to Lophiotrema, but can be distinguished from the latter by its well-developed peridium around the ostiolar neck and base (vs a poorly developed peridium up to 25 μm thick (Holm & Holm 1988)).

Andreasen, Nordén & J.B. Jordal, sp. nov. — MycoBank MB 839004; Fig. 16

Fig. 16

Atrocalyx nordicus (O-F-256932 - holotype). a–c. Ascomata; d–f. section of ascomata; g. peridium; h–j. hymenium; k–l. immature asci; m–u. ascospores (immature in u). — Scale bars: a–c = 200 μm; d–h = 50 μm; i–u = 20 μm (d, i–k, p–s, u in Cotton blue).

Etymology. With reference to its occurrence in a Nordic country (Norway).

Typus. NORWAY, Oslo county and municipality, on the bark of old living Fraxinus excelsior, 28 Sept. 2018, M. Andreasen (O-F-256932 - holotype; ex-holotype culture CBS 147532 = MAL27); Møre og Romsdal county, Molde municipality, on the bark of old living Populus tremula, 3 Sept. 2018, J.B. Jordal (O-F-256930 - paratype; MBT 10000179; ex-paratype culture CBS 147530 = MAL20; O-F-256931 - paratype; ex-paratype culture CBS 147531 = MAL21; O-F-256933 - paratype; ex-paratype culture CBS 147533 = MAL76).

Sexual morph: Ascomata 290–450 μm diam, black, scattered to gregarious, immersed or erumpent from the slightly blackened substrate, globose to pyriform. Ascomatal neck central, crest-like, laterally compressed, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 40–55 μm thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells, forming textura angularis, paler inwardly, fusing with host tissue at the outermost layer. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci (110–)123–168(–180) × (12–)13–15 μm (n = 80), bitunicate, fissitunicate, cylindric-clavate, with a stipe < 10 μm, apex rounded, with a minute ocular chamber and 8 obliquely uniseriate to biseriate ascospores. Ascospores (17–)18–25(–30) × (4–)6–8(–10) μm (n = 100), hyaline, ellipsoid with rather obtuse ends, 3-septate, constricted at the middle septum, with thick (up to 20 μm) diffuse mucilaginous sheath, smooth-walled, with two large globules in each cell, smooth.

Culture characteristics — Ascospores germinated on MEA within 48 h at 20 °C. Germ tubes produced from one or both ends. Colonies 3–3.4 cm diam after 4 wk, subcircular with irregular margins; initially pale grey becoming dark grey to black from below; reverse black.

Ecology — Saprobic on bark of living Fraxinus excelsior and Populus tremula.

Notes — Although there are some sequence differences between the strains CBS 147530, CBS 147531, CBS 147532 and CBS 147533, they form a clade with strong support within the genus Atrocalyx. Morphologically this new species has considerable resemblance to other species of Atrocalyx like A. acutisporus and A. lignicola as described by Hashimoto et al. (2017) (see Table 4). However, A. nordicus differs significantly from A. acutisporus by larger sizes of ascomata, peridium, asci and ascospores but overlaps with A. lignicola on the same characters. Still, the spore shape of A. nordicus is more ellipsoid-fusiform and 3-septate at maturity compared to the 1-septate and heteropolar ones of A. lignicola as noted by Zhang et al. (2009b).

Table 4

Comparison of selected morphological characters between Atrocalyx nordicus, Atrocalyx acutisporus and Atrocalyx lignicola as described by this study and by Hashimoto et al. (2017).

	Atrocalyx nordicus	Atrocalyx acutisporus	Atrocalyx lignicola
Ascomata diam	290–450 μm	190–210 μm	350–600 μm
Ascus size	(110–)120–180 × 12–15 μm	(66.5–)75–89.5 × 8–11 μm	100–146 × 12.5–17 μm
Ascospore size	(17–)18–25(–30) × (4–)6–8(–10) μm	13.5–18(–20) × 3–4(–5.5) μm	20–26 × 6.5–9.5 μm
Ascospore shape	ellipsoid with rather obtuse ends	broadly fusiform	broadly fusiform, heteropolar
Ascospore septation	3-septate	1–3-septate	1-septate
Peridium thickness	40–55 μm	20–30 μm	27.5–42 μm
Host	Populus tremula, Fraxinus excelsior	woody plant	Populus sp.

When first found, the specimens of A. nordicus were identified as Lophiotrema lennartii, which is very similar in morphological characters, particularly in ascospore shape and size. It still differs in several other aspects such as ascospore septation with up to 3-septate vs 1-septate in L. lennartii, more clavate vs strictly cylindrical, thicker-walled and more elongate asci exceeding the maximum observed for L. lennartii (140 μm) (Mathiassen et al. 2017). Ascospores have a uniseriate arrangement in asci (vs obliquely uniseriate to uniseriate). Besides, this species is found in Oceanic environments at low altitude collection sites (vs continental high altitude localities). Finally, we note that the hosts of A. nordicus (Fraxinus excelsior and Populus tremula) differ from those of L. lennartii (Aconitum septentrionale and Myricaria germanica).

Sacc. emend. Holm & Holm, Symb. Bot. Upsal. 28: 25. 1988 — MycoBank MB 2934

Type species. Lophiotrema nucula (Fr.: Fr.) Sacc., Michelia 1: 338. 1878.

Sexual morph: Ascomata immersed to erumpent, subglobose. Ascoma apex crest-like or rarely papillate, mostly elongated and laterally compressed, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium composed of cells forming textura angularis or textura prismatica, paler towards the inside, darker at the outside and fusing with host tissues. Hamathecium comprising septate, branched, cellular, anastomosing pseudoparaphyses, situated between and above the asci, embedded in a gelatinous matrix. Asci bitunicate, fissitunicate, cylindrical, with a short stipe, 8-spored. Ascospores fusiform, hyaline, smooth, verruculose at maturity.

Ecology — Saprobic on various plants.

Notes — Holm & Holm (1988) distinguished Lophiotrema from Lophiostoma based on differences in the type of peridium and asci; the peridium in Lophiotrema is nearly equal in thickness (c. 25 μm), whereas in Lophiostoma it is broader (c. 50 μm). The asci in Lophiotrema are cylindrical or oblong, but clavate or oblong in Lophiostoma. This definition was accepted by Barr (1992), Yuan & Zhao (1994), Tanaka & Harada (2003b), and Kirk et al. (2008). Hashimoto et al. (2017) found that Lophiotrema s.str. should be limited to species having ascomata with a slit-like ostiole and an ascomatal wall of uniform thickness, asci with a short stipe, and pycnidial asexual morphs. With the inclusion of Lophiotrema myriocarpum in the genus, the distinction between Lophiostoma and Lophiotrema by peridium thickness is no longer tenable.

(Fuckel) Sacc., Michelia 1 (no. 3): 338. 1878 — MycoBank MB 173362; Fig. 17

Fig. 17

Lophiotrema myriocarpum. a–r. (O-F-256934 - epitype), s–u. (G00127825 - lectotype) a. Ascomata; b, d–e. section of ascomata; c. peridium; f–i, s. asci; j–r, t–u. ascospores. — Scale bars: a = 400 μm; b = 250 μm; c–e, g–i = 50 μm; f = 10 μm; j–u = 20 μm (e–f, n–q, s–u in Cotton blue, r in Indian ink).

Basionym. Lophiostoma myriocarpum Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 156. 1870. — MycoBank MB 141605.

Synonyms. Lophiotrema vigheffulense (Pass.) Berl., IC. Fung. 1:4. 1890. — MycoBank MB 206314.

Lophiosphaera vigheffulensis Pass., Erb. Critt. Ital. Ser. 2 no. 1373. 1883. — MycoBank MB 248553.

Typus. GERMANY, Hessen, K.W.G. Fuckel, in Fuckel, Fungi Rhen. Exs. 1807 (G00127825 - lectotype designated here; MBT 10000318). – NORWAY, Rogaland county, Suldal municipality, on the bark of living Fraxinus excelsior, 19 Sept. 2018, J.B. Jordal (O-F-256934 - epitype designated here; MTB 10000178; ex-epitype culture CBS 147534 = MAL01).

Sexual morph: Ascomata densely scattered, immersed to erum-pent, 170–460 μm diam, black, globose, glabrous. Ascoma apex central or lateral, coarse, crest-like, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Hamathecium comprising septate, branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Peridium 30–55 μm thick, 2-layered, outer layer composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells fusing with host tissue at the outermost layer, thick inner layer of similar, but thinner-walled and pale brown to hyaline cells. Asci (90–)100–115(–120) × 10–12 μm (n = 20), bitunicate, cylindrical with attenuated stipe < 10 μm long, with 6–8 biseriate ascospores. Ascospores (23.5–)26–35(–38) × 4–5(–6) μm (n = 35), hyaline, narrowly fusiform, straight to slightly curved, 3–5-septate, constricted at the median septum, surrounded by inconspicuous mucilaginous sheath 1–4 μm wide, guttulate, with oil drops disappearing when overmature.

Culture characteristics — Ascospores germinated on MEA within 24 h at 20 °C. Germ tubes produced from end and central ascospore cells. Colonies 3.1–4.1 cm diam after 4 wk, subcircular with somewhat irregular margins; initially whitish, becoming pale to dark grey from below, margin dark grey to black; reverse black.

Ecology — Saprobic on wood and bark of deciduous trees and shrubs, also on Dryas.

Additional materials examined. NORWAY, Vestlandet county, Kvam municipality, on bark of Ulmus glabra, 15 May 2019, M. Andreasen (O-F-256935; culture CBS 147535 = MAL71).

Notes — Within Lophiotrema, L. myriocarpum (strains MAL01 and MAL71) forms a clade with strong support together with L. neohysterioides (strains KT 17, KT 588, KT 713, KT 756).

Lophiotrema neohysterioides M.E. Barr as re-described by Tanaka & Harada (2003b) has some morphological resemblance, but differs by, e.g., distinctly shorter ((14–)17–25(–26.5) × 3–5 μm) and consistently 3-septate ascospores and smaller ((60–)70–96(–110) × (6–)7–10 μm), narrowly clavate asci.

Holm & Holm (1988) reported that this species is well characterised by the narrow spores, which early have more than one septum. Based on the description of Holm & Holm (1988), the two collections of MAL01 and MAL71 were identified as Lophiostoma myriocarpum. The type material of L. myriocarpum (G00127825) was investigated, which confirmed the identification, and we reassign this species to the genus Lophiotrema and epitypify it with one of our specimens. As there are several syntypes of L. myriocarpum (e.g., G00127823, G00127824, G00127825, S-F-71903, S-F-71899, S-F-13329, S-F-267560), we select collection G00127825 as lectotype, which we epitypify with O-F-256934 to stabilise the species concept.

(Fr.: Fr.) Sacc., Michelia 1: 338. 1878 — MycoBank MB 151729; Fig. 18

Fig. 18

Lophiotrema nucula (O-F-247790). a. Habit; b–c. ascomata in section; d–f. peridium; g–h. asci; i–q. ascospores. — Scale bars: a–b = 150 μm; c = 200 μm; d = 40 μm; e–f, i–q = 20 μm; g–h = 10 μm (h–q in Cotton blue).

Basionym. Sphaeria nucula Fr., Kongl. Vetensk. Acad. Handl. 38: 266. 1817. — MycoBank MB 222550.

Synonym. Lophiostoma nucula (Fr.) Ces. & De Not., Comment. Soc. Crittog. Ital. 1 (4): 222. 1863. — MycoBank MB 244964.

Sexual morph: Ascomata 200–450 μm diam, scattered or gre-garious, immersed to erumpent, globose to subglobose, black, uniloculate, glabrous, ostiolate. Ascoma apex central or lateral, crest-like, carbonaceous, with a pore-like ostiole. Ostiolar canal rounded, periphysate. Peridium 10–20 μm thick, composed of several layers of dark brown to black, thick-walled pseudoparenchymatous cells forming textura angularis, paler inwardly, outermost layer fusing with host tissue. Hamathecium comprising branched, cellular pseudoparaphyses, anastomosing above and between the asci, embedded in a gelatinous matrix. Asci (70–)80–110(–120) × (8–)9–11.5 μm (n = 120), bitunicate, fissitunicate, cylindrical, with a stipe 15–33 μm long, apically rounded, with a minute ocular chamber, containing (4–)8 (obliquely) uniseriate ascospores. Ascospores (18.5–)19–23(–24.5) × (5.5–)6–9.5 μm (n = 180), hyaline becoming brownish when overmature, ellipsoid-fusiform, with rounded ends, 1–3-septate, constricted at the middle septum and slightly at others, slightly narrower towards both ends, surrounded by inconspicuous mucilaginous sheath 0.5–1 μm wide, smooth-walled, sometimes verruculose at maturity, guttulate with one or two guttules in each cell.

Culture characteristics — Ascospores germinated on MEA within 24 h at 20 °C. Germ tubes were produced from one or both ascospore ends. Colonies 2.7–3.5 cm diam after 4 wk, circular with somewhat irregular margin; initially whitish, becoming greyish from the surface; reverse greyish brown.

Ecology — Saprobic on decorticated wood and bark of various deciduous trees such as Acer pseudoplatanus, Fagus sylvatica, Fraxinus excelsior, Liriodendron tulipifera, Populus tremula, Quercus sp., Salix sp., Syringa vulgaris, and Ulmus glabra.

Materials examined. NORWAY, Agder county, Arendal municipality, on the bark of living Populus tremula, 4 Oct. 2014, Jacques Fournier (O-F-247790; culture MAL47); Viken county, Asker municipality, on branches of living Salix sp., 20 Feb. 2019, M. Andreasen (MA19-012); Froland municipality, on Ulmus glabra, 3 Oct. 2014, J. Fournier (O-F-247791); same area, on Populus cf. tremula, 3 Oct. 2014, J. Fournier (O-F-247805); Vestland county, Granvin municipality, on Ulmus glabra, 13 May 2014, B. Nordén & J.B. Jordal (O-F-251885).

Notes — The spores of the examined specimens are of a rather fusoid shape compared to the ellipsoid-fusiform (plumper and more obtuse) as presented by Holm & Holm (1988), Tanaka & Harada (2003b) and to some degree to those described by Mathiassen (1989), where the spores are described as broadly ellipsoid to oblong ellipsoid, with rounded ends. Some illustrations by Mathiassen (1989) resemble our spores to a greater extent but with more rounded ends as seen in Fig. 18.

DISCUSSION

Phylogenetic reconstruction and genetic markers

Our phylogenetic analyses based on a multigene-matrix of four molecular markers (ITS, LSU, TEF1-α and RPB2) shed a new light on the relationships within Lophiostomataceae and Lophiotremataceae. However, the phylogenetic reconstruction, particularly of the Lophiostomataceae, is not entirely settled. The four markers inferred more or less stable support for species and shallow clades. Examples for this in Lophiotremataceae are Lophiotrema myriocarpum and L. nucula, and examples for Lophiostomataceae are Lophiostoma caespitosum, L. longiappendiculatum, L. macrostomoides, L. macrostomum, L. obtusisporum, L. scabridisporium, L. tropicum, L. winteri, and the species of the genera Flabellascoma and Vaginatispora. However, in the case of the genus Lophiostoma, generally little backbone support was found, and RPB2 sequences are lacking for many taxa. Wherever RPB2 and TEF1-α were present, we observed enhanced resolution and support at the species level. These coding regions gave support to most genera in Lophiotremataceae, and of Crassiclypeus, Flabellascoma, Lentistoma, Neovaginatispora and Vaginatispora in the Lophiostomataceae. This tendency of improved support when RPB2 and TEF1-α are present was also reported in other studies of related taxa, e.g., Teichosporaceae (Jaklitsch et al. 2016). However, RPB2 was difficult to amplify in the present study, which may generally be the reason for the low number of available sequences. Thus, this molecular marker, but also TEF1-α, albeit less pronounced, are often missing in the alignments. We expect that addition of coding markers such as TEF1-α and RPB2 for all taxa would enhance resolution and support of deeper nodes and probably provide a more stable topology. We see such enhanced resolution and a much better resolved topology in our presented phylogeny of Lophiotremataceae for clades where TEF1-α and RPB2 are present for virtually all species, e.g., the clades representing the genera Atrocalyx, Lophiotrema and Cryptoclypeus.

Lophiostomataceae

The phylogenetic analyses of Lophiostomataceae showed stronger support for deeper nodes compared to previous studies (Mugambi & Huhndorf 2009, Hirayama & Tanaka 2011, Zhang et al. 2014, Thambugala et al. 2015, Jaklitsch et al. 2016, Hashimoto et al. 2018, Bao et al. 2019), but with a tendency to weaker support as compared to Phukhamsakda et al. (2020). The phylogeny strongly supports the application of a broad generic concept of Lophiostoma, satisfying the criteria of Vellinga et al. (2015) for generic circumscription, in particular a strong statistical support and monophyly.

The validity of Alpestrisphaeria, Coelodictyosporium, Guttulispora, Lophiohelichrysum, Platystomum, and Sigarispora, was earlier questioned by Hashimoto et al. (2018), and we further question the validity of Biappendiculispora, Capulatispora, Lophiopoacea, Neopaucispora, Neotrematosphaeria, Pseudocapulatispora, Pseudolophiostoma, and Pseudoplatystomum, and synonymise all with Lophiostoma based on molecular phylo-genetic evidence, thus creating a well-supported genus. Of these synonymised clades Alpestrisphaeria, Biappendiculispora, and Pseudolophiostoma, Pseudoplatystomum and the later added Pseudocapulatispora, represented as clades A11–A14 by Thambugala et al. (2015), hold strong support in our phylogeny, both for their overall placement and for the species nesting within. If these were accepted as separate genera, also the remaining clades, represented as A1–A10 (i.e., Platystomum, Coelodictyosporium, Neotrematosphaeria, Sigarispora, Lophiopoceae, Lophiohelichrysum, Guttulispora, and Capulatispora) by Thambugala et al. (2015), would need separation, but none of them nor an overall clade encompassing all of them received significant statistical support. Only particularly shallow clades of species or sister species hold sufficient support for their placement together (i.e., L. caespitosum, L. crenatum, L. fusisporum, L. macrostomoides, and L. macrostomum). Lastly, we emphasise the lack of molecular markers such as TEF1-α and RPB2 for these less supported clades within Lophiostoma.

In the case of the total alignment of Lophiostomataceae, many strains are still lacking sequences of molecular markers representing ribosomal DNA or protein coding loci, and even some are lacking representatives of both. The result is a persistently unresolved topology, which is made further indistinct in many cases by the lack of support within deeper nodes (Fig. 1).

Concerning morphology and applicable conclusions on general characters used for distinction on generic and species level, we chose to be cautious and only refer to descriptions and photo plates. For both generic and species distinction there is high intraspecific variability of several morphological traits in the genus Lophiostoma. Therefore, it has been difficult to assign a name to individual collections safely. Phylogenetic analyses provide an excellent tool for the improvement of this situation. One example is L. pseudomacrostomum, which in our phylogenetic analyses is a good species but shares morphological traits with L. compressum and L. macrostomoides, which make them difficult to distinguish based on morphology alone.

Lophiotremataceae

The results of the phylogenetic analyses show a topology com-parable to previous presentations of Lophiotremataceae with tendencies to increased support for deeper nodes (Zhang et al. 2009a, b, Hirayama & Tanaka 2011, Hashimoto et al. 2017). One reason for this may be the relatively low number of species, as compared to the Lophiostomataceae, another is the scrutinised work of Tanaka and collaborators (Hirayama & Tanaka 2011, Hashimoto et al. 2017), who provided TEF1-α and RPB2 sequences for virtually all species included. One new species is here added to the genus Atrocalyx based on four strains (CBS 147530, CBS 147531, CBS 147532, CBS 147533), creating a strongly supported clade within the genus, and further morphological evidence for this species is provided in the species description. Further, we resurrect Lophiotrema myriocarpum. This placement is based on strong phylogenetic support and morphological evidence, particularly the cylindrical asci and spore shape, as stated in the notes to the species description.

In earlier studies, only a single strain of Lophiotrema nucula (Hirayama & Tanaka 2011, Hashimoto et al. 2017) was included in phylogenetic analyses. The inclusion of our strain now provides strong support for the species as sister to L. fallopiae, L. vagabundum, and L. neoarundinariae.

Morphology

Because of the high intraspecific variability of several morphological traits of the sexual morph within Lophiostomataceae, and in particular within the genus Lophiostoma, it was challenging to provide a structured presentation of differentiating morphology that reflects both phylogenetic relationships and morphological characters. Thus, no keys for identifying genera nor species are presented here.

This high intraspecific variability of morphology is persistent within many pleosporalean genera such as, e.g., Teichospora (Jaklitsch et al. 2016) and the here presented genus Lophiostoma. Thus, it is difficult to place pleosporalean fungi in these genera based on morphology alone. It can, therefore, seem attractive to define segregate genera having narrowly defined morphology, such as, e.g., ascospore colour, shape and septation, for those who want to identify fungal species and genera by morphology alone. Still, it is not a workable solution to split these genera, creating small entities with relatively clear morphological characters. This splitting does not increase insight in the evolutionary history of the group in question, but only inflates the taxonomic framework as these genera are no longer distinguishable from other genera in other families within Pleosporales. On the other hand, a broad generic concept does not impair the situation with difficulties of identification, but will make it easier to look up the literature. There are morphologically virtually identical fungi in different genera in different families of the Pleosporales, which generally challenges the applicability of a morphological generic classification system by a narrow generic concept.

Future perspectives

Remaining issues concerning the phylogeny and taxonomy of the two families include that several old epithets have never been re-assessed, despite efforts by Chesters & Bell (1970) and Holm & Holm (1988). Materials representing these epithets need recollection at the original collection sites and from the original hosts. Also, for several taxa initially described from Europe in the phylogram, only DNA data of Asian material are present. This even includes the generic type of Lophiostoma, L. macrostomum alongside many others, e.g., L. semiliberum, L. caudatum, or L. caulium. These taxa require recollection in Europe for confirmation of the names.

Within the presented topology of the genus Lophiostoma, several groupings of strains and taxa are found nesting together without significant support but showing very similar morphological characters. A lack of molecular information (e.g., some strains miss specific molecular markers in the alignment) can in many cases explain some of this missing support, but not always. Cryptic species can be defined as ‘morphologically indiscernible biological/phylogenetic units present within taxonomic species’ (Knowlton 1993, Balasundaram et al. 2015). Lophiostoma compressum is an example of such a morphospecies showing tendencies of being a complex of cryptic species, with molecular differentiation among strains but bearing similar morphological characters. Investigations of their internal relationship, both within strains of the same taxa showing differences in molecular affinities, but also between the different species, could shed further light on this issue. Concerning Lophiostoma compressum and the here synonymised genus Platystomum, there are many proposed taxa within this species complex, e.g., ‘Platystomum’ rosae, ‘Platystomum’ salicicola, and ‘Platystomum’ crataegi that require further investigation. The strains do not show support for being distinct species and are only represented by ITS and LSU, for the most part.

Another question is the internal relationship between many of the taxa within the genus Lophiostoma. Many proposed species are unsupported phylogenetically, others are well supported as species, but their overall relationship within the genus is unclear. The lack of support shows a need for continuous sampling and procurement of sufficient molecular information followed by a thorough morphological investigation. There might even be a need for the identification of new, informative molecular markers to infer better phylogenetic resolution for species and shallow clades. Here, it will be important to select a marker that amplifies well within the group, considering the experience with RPB2 that does not amplify well in many lophiostomatoid species.