| Literature DB >> 35935236 |
Boyu Du1,2,3, Yang Guo1,2, Gang Li3, Yunhe Zhu3, Yunfu Wang4, Xueyan Xi1,2,3.
Abstract
Upon activation by the pathogen through T-cell receptors (TCRs), γδT cells suppress the pathogenic replication and thus play important roles against viral infections. Targeting SARS-CoV-2 via γδT cells provides alternative therapeutic strategies. However, little is known about the recognition of SARS-CoV-2 antigens by γδT cells. We discovered a specific Vγ9/δ2 CDR3 by analyzing γδT cells derived from the patients infected by SARS-CoV-2. Using a cell model exogenously expressing γδ-TCR established, we further screened the structural motifs within the CDR3 responsible for binding to γδ-TCR. Importantly, these sequences were mapped to NSP8, a non-structural protein in SARS-CoV-2. Our results suggest that NSP8 mediates the recognition by γδT cells and thus could serve as a potential target for vaccines.Entities:
Keywords: CDR3; NSP8; ORF1ab; SARS-CoV-2; γδT cells
Year: 2022 PMID: 35935236 PMCID: PMC9354780 DOI: 10.3389/fmicb.2022.936272
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 6.064
The primer sequences.
| Primer name | Primer sequence |
| γ9CDR3-up | 5′-AATGTAGAGAAACAGGAC-3′ |
| γ9CDR3-down | 5′-ATCTGTAATGATAAGCTTT-3′ |
| δ2CDR3-up | 5′-GCACCATCAGAGAGAGATGAAGGG-3′ |
| δ2CDR3-down | 5′-AAACGGATGGTTTGGTATGAGGC-3′ |
| Sequencing primer 1 | 5′- TTATTCGCAATTCCTTTAGTG -3′ |
| Sequencing primer 2 | 5′- GCCCTCATAGTTAGCGTAACG -3′ |
FIGURE 1Construction of SARS-CoV-2 specific γδTCR transfected cells. (A) The map of pREP7 and pREP9 vectors. (B) Detection of γδTCR expression by PCR in transfected J.RT3-T3.5 cells. mRNA was extracted from transfected cells and reverse transcribed into cDNA. The full-length γ9 and δ2 chains and their CDR3 sequences were amplified by using specific PCR primers. (C) Detection of γδTCR expression by FACS analysis in J.RT3-T3.5 transfected cells. The cells were stained with FITC-labeled γδTCR antibody and then analyzed by flow cytometry on a MoFlo XDP flow cytometer. The results are representative of three independent experiments. SARS-CoV-2 cells: SARS-CoV-2 specific γδTCR transfected J.RT-T3.5 cells; Control cells: healthy controls’ γδTCR transfected J.RT-T3.5 cells. J.RT-T3.5 cells: J.RT-T3.5 cells without plasmid transfection.
Deduced Vγ9 CDR3 amino acid sequences of COVID-19 patients and healthy donors.
| Clone | V region | N/P region | J region | Frequency | |
| COVID-19 patients | 1 | CALWE | APQ | ELGKKIKVFG | 8/60 |
| 2 | CALWE | VIS | ELGKKIKVFG | 8/60 | |
| 3 | CALWE | PPV | ELGKKIKVFG | 3/60 | |
| 4 | CALWE | VACY | ELGKKIKVFG | 2/60 | |
| 5 | CALWE | GIC | ELGKKIKVFG | 2/60 | |
| 6 | CALWE | KKA | ELGKKIKVFG | 2/60 | |
| 7 | CALWE | DEHK | ELGKKIKVFG | 2/60 | |
| 8 | CALWE | PYQ | ELGKKIKVFG | 2/60 | |
| Healthy donors | 1 |
|
|
|
|
| 2 |
|
|
|
| |
| 3 | CALWE | SKR | ELGKKIKVFG | 2/30 | |
| 4 | CALWE | GETP | ELGKKIKVFG | 1/30 | |
| 5 | CALWE | PLAAA | ELGKKIKVFG | 1/30 | |
| 6 | CALWE | GNSY | ELGKKIKVFG | 1/30 | |
| 7 | CALW | RRSG | ELGKKIKVFG | 1/30 | |
| 8 | CALWE | QIIEF | ELGKKIKVFG | 1/30 |
aTotal RNA was extracted separately from the peripheral blood of COVID-19 patients and healthy donors. One microgram of total RNA was then converted into cDNA using a reverse transcription system. Primer sequences complementary to upstream V regions and downstream C regions were used to amplify the CDR3 regions. The purified PCR products were ligated into pGEM-T easy vector and sequenced. The CDR3γ region was considered to contain conserved “CALW” at its N-terminus and conserved “KVFG” at its C-terminus.
bNumber of identical clones/total number of clones sequenced. Not all the sequencing results were listed in the table.
Deduced Vδ2 CDR3 amino acid sequences of COVID-19 patients and healthy donors.
| Clone | V region | N-D-N region | J region | Frequency | |
| COVID-19 patients | 1 | CACD | PLLGDASY | TDKLIFGKG | 18/80 |
| 2 | CACD | VLGA | TDKLIFGKG | 6/80 | |
| 3 | CACD | RLSP | TDKLIFGKG | 6/80 | |
| 4 | CACD | TLVS | TDKLIFGKG | 4/80 | |
| 5 | CACD | VRLS | TDKLIFGKG | 3/80 | |
| 6 | CACD | SLLGDSEY | TDKLIFGKG | 3/80 | |
| Healthy donors | 1 | CACD | RLGDTG | TDKLIFGKG | 5/40 |
| 2 | CACD |
| TDKLIFGKG | 4/40 | |
| 3 | CACD | PLEAP | TDKLIFGKG | 3/40 | |
| 4 | CACD | PLTS | TDKLIFGKG | 2/40 | |
| 5 | CACD | ALLI | TDKLIFGKG | 2/40 | |
| 6 | CACD | VLPG | TDKLIFGKG | 2/40 |
aTotal RNA was extracted separately from the peripheral blood of COVID-19 patients and healthy donors. One microgram of total RNA was then converted into cDNA using a reverse transcription system. Primer sequences complementary to upstream V regions and downstream C regions were used to amplify the CDR3 regions. The purified PCR products were ligated into pGEM-T easy vector and sequenced. The CDR3δ region was considered to contain conserved “CA” at its N-terminus and conserved “FGXG” at its C-terminus.
bNumber of identical clones/total number of clones sequenced. Not all the sequencing results were listed in the table.
The sequence of epitope peptide candidates.
| Name | Sequence | Frequency |
| SP1 | KKLKKSLTLPLQ | 6/20 |
| SP2 | YTPQLPSYAAFA | 5/20 |
| SP3 | VSRHALWELQQS | 4/20 |
| SP4 | SLNVAKSESCLH | 1/20 |
| SP5 | YKVVIFDWRRSD | 1/20 |
| SP6 | KDAHPESEFDRD | 1/20 |
| SP7 | KHKHPPFDPSRP | 1/20 |
| SP8 | AQTPVSYSPTTF | 1/20 |
aAccording to the results of phage-ELISA, 20 phage clones that could specifically bind with SARS-CoV-2-specific γδTCR transfected cells were obtained and amplified by RT-PCR. The PCR products were then sequenced and the corresponding amino acid sequences were analyzed. Eight dominant epitope candidates (SP1 to SP8) were obtained.
bNumber of identical clones/total number of clones sequenced.
FIGURE 2Confirmation of peptide binding to SARS-CoV-2 specific γδTCR transfected cells. (A) Spiral structure of three identified peptides predicted by bioinformatics tools on the Heliquest website (http://heliquest.ipmc.cnrs.fr/?tdsourcetag=s_pcqq_aiomsg). (B) IL-2 secretion after stimulation by the identified peptides in SARS-CoV-2 specific γδTCR transfected cells. The three peptides and control peptide were separately co-cultured with SARS-CoV-2 specific γδTCR transfected cells and control cells for 24 h. IL-2 production in the supernatant of the cell culture medium was detected by ELISA. Data was presented as mean ± SD from triplicate experiments. (C) The results of FACS analysis revealed the affinity between identified peptides and SARS-CoV-2 specific γδTCR transfected cells. The identified peptides and control peptides had been conjugated with FITC (10 μg) and were separately co-cultured with SARS-CoV-2-specific γδTCR transfected cells. The results showed that SP1 (76.3%) and SP2 (58.9%) could bind more effectively to the transfected cells than SP3 (2.78%). The results are representative of three independent experiments. ∗Denotes p < 0.05.
BLAST analysis of epitope peptide candidates.
| Reference no. | Protein name | Species | E value | Matching part | |
| SP1 | UEX01438.1 | ORF1a polyprotein | SARS-CoV-2 | 26.5 | KKLKKSLT |
| SP1 | UEX01439.1 | ORF1ab polyprotein | SARS-CoV-2 | 26.5 | KKLKKSLT |
| SP1 | UMA92726.1 | ORF1ab polyprotein | SARS-CoV-2 | 25.7 | KKLKKSL L |
| SP2 | UGC79169.1 | ORF1ab polyprotein | SARS-CoV-2 | 27.8 | LPSYAAFA |
| SP2 | UJY79755.1 | ORF1ab polyprotein | SARS-CoV-2 | 27.8 | LPSYAAFA |
| SP2 | UJE21816.1 | ORF1ab polyprotein | SARS-CoV-2 | 27.8 | LPSYAAFA |
FIGURE 3NSP8 protein contains potential epitopes that could activate γδT cell. (A) The sequence alignment of two peptide candidates with the sequence of SARS-CoV-2 and NSP8 protein sequence. (B,C) NSP8 protein could stimulate SARS-CoV-2 specific γδTCR transfected cells to produce more IL-2. The control protein and NSP8 protein were pre-coated in a 24-well plate. The SARS-CoV-2-specific γδTCR transfected cells were then added and cultured for 24 h. IL-2 secretion was measured either by RT-PCR (B) or by ELISA (C). (D) NSP8 protein could bind to natural peripheral γδT cells. The control protein and NSP8 protein were pre-coated in a 24-well plate and incubated with γδT cells isolated from five healthy donors’ peripheral blood. IFN-γ secretion was measured in supernatants collected 24 h after incubation. Data were presented as mean ± SD from triplicate experiments. ∗Denotes p < 0.05; ∗∗Denotes p < 0.01.