Literature DB >> 35928004

Protocol for genome-wide CRISPR knockout screens of bacterial cytotoxins in HeLa cells.

Qi Yang1, Yao Zhou2, Liuqing He2, Yuanyuan Zhang2, Liang Tao3.   

Abstract

CRISPR screening is a powerful tool to identify host factors for pathogenic agents including viruses and bacterial toxins. Here, we present a protocol to conduct a genome-scale CRISPR screen on HeLa cells for host factors involved in the toxin action of Clostridioides difficile TcdB4. We describe in detail how to prepare the library, set up the screen, obtain the gene sequences, and analyze the results. This protocol can also be modified for other genome-scale libraries, cell lines, and cytotoxins. For complete details on the use and execution of this protocol, please refer to Luo et al. (2022).
© 2022 The Author(s).

Entities:  

Keywords:  CRISPR; Cell Biology; Cell culture; High Throughput Screening; Microbiology; Molecular Biology; Sequence analysis; Sequencing

Mesh:

Substances:

Year:  2022        PMID: 35928004      PMCID: PMC9344021          DOI: 10.1016/j.xpro.2022.101595

Source DB:  PubMed          Journal:  STAR Protoc        ISSN: 2666-1667


Before you begin

The protocol below describes the CRISPR knockout screen for TcdB4 on HeLa cells using the GeCKO v2 library. However, we have also used this protocol in other human cell lines and with other genome-wide CRISPR libraries. To minimize possible biases, we strongly suggest using one batch of the toxin throughout the screen. Bacterial toxins can be divided into small aliquots and stored at −80°C for one year without overt loss of activity. The toxin should be used immediately after being thawed, and never refreeze and/or reused thawed toxin aliquots. Earlier versions of this protocol were applied for targeted screens with other bacterial cytotoxins (Tao et al., 2016, 2019; Zhou et al., 2021). For complete details on the use and execution of the protocol, please refer to (Luo et al., 2022).

Model cell line determination

Timing: 3 days Below we provided a detailed step-by-step protocol for testing the sensitivity of multiple cell lines to the target toxin (here TcdB4). The determined cell line is adopted for the CRISPR screen for TcdB4. Grow candidate cell lines. After the trypsin digestion, collect and dilute the cells to appropriate concentrations with the respective medium. Seed each cell line to a 24-well plate and allow them to grow to a ∼60% confluent before adding the toxin. The inoculating density for each cell line may be different. The choice of the model cell line is critical to performing the CRISPR screen, as resistant cells possibly lack the host factors for the toxin actions. In this protocol, we tested five cell lines including HeLa, U2OS, A549, MCF-7, and HT-29. Prepare serial dilutions of the toxin (here TcdB4) within DMEM complete (DMEM supplemented with 10% FBS, 50 units/mL of penicillin, and 50 μg/mL of streptomycin). Dilute the stocked TcdB4 to 1 μM as a starting concentration. Perform the serial dilution with a dilution factor of three. Prepare a total of 23 dilutions and final concentrations of TcdB are the following: 1 μM, 0.33 μM, 0.11 μM, 0.037 μM, 0.012 μM, 4 nM, 1.4 nM, 0.46 nM, 0.15 nM, 0.051 nM, 0.017 nM, 5.6 pM, 1.9 pM, 0.63 pM, 0.21 pM, 0.070 pM, 0.023 pM, 0.0077 pM, 0.0026 pM, 0.00086 pM, 0.00029 pM, and 0.0001 pM. Remove the spent medium of the cell culture in the 24-well plate and add 0.5 mL of toxin dilution to each well. Leave one well of cells with the fresh medium as an untreated control. Put the plates back into the cell culture incubator. After 14 h, capture the bright-field images of each well under the microscope. Manually count the numbers of round-shaped and normal-shaped cells (Figure 1A), calculate the cell rounding ratio, and plot them onto the toxin dose-cell rounding curves (Figure 1B).
Figure 1

TcdB4-induced cytopathic effects as the readout for the screen

(A) Microscopy images show normal HeLa, U2OS, A549, HT-29, and MCF-7 cells and cells treated by TcdB4 (round-shaped). The scale bar represents 50 μm.

(B) The measured TcdB4 concentration-cell rounding chart for HeLa cells. Data are presented as mean ± standard deviation (SD) (n = 6).

TcdB4-induced cytopathic effects as the readout for the screen (A) Microscopy images show normal HeLa, U2OS, A549, HT-29, and MCF-7 cells and cells treated by TcdB4 (round-shaped). The scale bar represents 50 μm. (B) The measured TcdB4 concentration-cell rounding chart for HeLa cells. Data are presented as mean ± standard deviation (SD) (n = 6). Calculate the CR50 (toxin concentration that induces 50% of cell rounding) from the cell rounding curves for each cell line (Figure 1B). Cell lines with low CR50 value would be ideal model cells for the CRISPR screen. Here, HeLa cells are sensitive to TcdB4 and thus were chosen for the screen.

Generating HeLa-Cas9 cell line

Timing: 4–6 weeks We utilize lentivirus to integrate the Streptococcus pyogenes cas9 gene together with the blasticidin resistance gene into the genome of HeLa cells. Preparing Cas9 lentivirus. Seed 2 × 106 HEK293T cells into a 10 cm dish with the antibiotic-free DMEM complete. Grow the cells at 37°C with 5% CO2. The cells should achieve 80% confluency after 24 h of incubation. The transfection using PolyJet transfection reagent is performed following the manufacturer’s protocol (https://signagen.com/DataSheet/SL100688.pdf). The amounts of transfection reagent and plasmids are used as follows: set up a mixture of plasmids: 0.25 mL DMEM (serum-free), 3 μg psPAX2, 0.3 μg pMD2.G, and 3 μg pLenti-cas9-blasticidin; set up a transfection agent mixture: 0.25 mL DMEM (serum-free) and 18 μL of Polyjet. At 18 h post-transfection, replace the medium with 20 mL of fresh DMEM complete. Grow the cells for additional 30 h at 37°C in 5% CO2. At this step, all operations should be as gentle as possible, as 293T cells may easily be detached from the plate. At 48 h post-transfection, collect the culture medium containing lentiviruses to a 15 mL sterile centrifuge tube (low retention). To completely remove the detached cells and cell debris, centrifuge the tube at 500 g for 5 min. Then filter the supernatant through a 0.45 μm syringe filter to a new 15 mL centrifuge tube. Split the lentiviral solution into 1 mL aliquots in the 1.5 mL microcentrifuge tubes. Store the lentivirus in the −80°C freezer. CRITICAL: When working with lentivirus, specific safety procedures must be followed. All materials including cell cultures, cell culture materials, and virus stocks that have contacted lentivirus must be bleached for 15 min before disposal. Lentivirus infection. Seed the HeLa cells at a density of 5 × 105 cells/mL onto a 6-well plate and incubate at 37°C in 5% CO2. The cells should achieve ∼80% confluency after 24 h of incubation. Dilute the lentiviral stock to the DMEM complete with dilution factors of 2, 6, 18, 54, and 162. Add the diluted lentivirus into the cell culture dropwise and gently rock the plate three times. Leave one well of the cells without lentivirus infection as an uninfected control. Place the culture plate back in the incubator. At 24 h post-infection, replace the culture medium with fresh DMEM complete containing 5 μg/mL Blasticidin. At 72 h post-infection, remove the culture medium and wash the cells with PBS three times. Add 2 mL of fresh DMEM complete with 2.5 μg/mL Blasticidin and continue the cultivation for additional 48 h. At this point, you should find that all cells in the uninfected control well are dead. For wells with infected cells normally grow under Blasticidin selection, pick the one with the highest viral dilution factor for following single colony isolation. Single colony isolation and validation. Use trypsin to digest the cells, count the cell number, and dilute to a density of 3 cells/mL in the DMEM complete. Transfer 200 μL of diluted cells into a 96-well plate. Put the plate back in the cell culture incubator. Check 96-well plate under a microscope after one week. Mark the wells with only one colony formed, and replace the DMEM complete media. Allow the cells to grow for another week and then passage colonies to the 6-well plates. Pick up at least 10 colonies. Once the cells reach ∼80% confluency, freeze stock the cells of each colony as backups, and passage the cells to new 6-well plates for validation. Use RIPA to lyse the cells for each colony, load the lysate onto an SDS-PAGE, transfer it to a nitrocellulose membrane, and blot it with an anti-Cas9 antibody. The uninfected HeLa cells serve as the negative control (Figure 2). Save the colonies with robust Cas9 expression and select one for the following study.
Figure 2

Validation of Cas9 expression

The Cas9 expression levels in different single clones of HeLa-Cas9 cells were detected by immunoblot analysis. Actin is a loading control.

Validation of Cas9 expression The Cas9 expression levels in different single clones of HeLa-Cas9 cells were detected by immunoblot analysis. Actin is a loading control.

Estimating CR95 for TcdB4 on HeLa-Cas9

Timing: 3 days Below we provided a detailed step-by-step protocol for estimating the CR95 for TcdB4 on HeLa cells. The CR95 value would be a reference toxin concentration when setting up the formal CRISPR screen. Seed the HeLa-Cas9 cells with a density of 7 × 104 to a 24-well plate and incubate at 37°C with 5% CO2 for 24 h. The cells should reach ∼60% confluency. Thaw one vial of TcdB4 stock, dilute the toxin with DMEM complete to 30 pM as a starting concentration, and perform the serial dilution with a dilution factor of 3. Twelve dilutions are prepared. Remove the spent medium and add 0.5 mL of toxin dilution to each well. Put the plates back into the cell culture incubator. After 14 h, capture bright-field images for each well under the microscope. Count the numbers of round-shaped and normal-shaped cells, calculate the cell rounding ratio, plot them onto a toxin concentration-cell rounding chart, and align the cell rounding curve. Calculate the CR95 from the cell rounding curve for HeLa-Cas9 (Figure 1B). This CR95 value would be a reference concentration on the screen.

Key resources table

Step-by-step method details

Generating human GeCKO v2 lentiviral library

Timing: 6 days Below we provided a detailed step-by-step protocol for generating the human GeCKO v2 lentiviral library from the purchased human GeCKO v2 plasmid library. Human GeCKO v2 Pooled library contains over 100,000 unique gRNAs targeting 19,052 human genes (Sanjana et al., 2014). The lentiviral plasmid library is originally purchased from Addgene and then amplified strictly following the manufacturer’s protocol (https://media.addgene.org/cms/filer_public/b5/fd/b5fde702-d02c-4873-806f-24ac28b2a15a/GeCKO v20_library_amplification_protocol_1.pdf). GeCKO v2 library is delivered and amplified as two half-libraries (A and B). Combine the two plasmid half-libraries with a 1:1 ratio before making the lentiviral library. Seed 293T cells into two 150 mm dishes at a seeding density of 5 × 106 cells/plate with the antibiotic-free DMEM complete (no Penicillin/Streptomycin). Grow the cells at 37°C with 5% CO2 and allow the cells to achieve 80% confluency. Transfection of HEK293T cells using PolyJet transfection reagent is performed following the manufacturer’s protocol (https://signagen.com/DataSheet/SL100688.pdf) with some modifications. For each 150 mm plate, replace the medium with 20 mL of fresh antibiotic-free DMEM complete 30 min before transfection. For each 150 mm plate, prepare two clean 1.5-mL microcentrifuge tubes. Add 0.5 mL of DMEM (serum-free), 10 μg of psPAX2, 1 μg of pMD2.G, and 10 μg of GeCKO v2 plasmid library into one tube. Add 0.5 mL of DMEM (serum-free) and 48 μL of PolyJet into the other tube. Mix well by gentle pipetting respectively. Add the diluted PolyJet immediately into the diluted plasmids, pipette up and down 3–4 times, or vortex briefly to mix. Incubate the mix at 25°C for 10–15 min. Carefully transfer the mixture to the HEK293T cell culture dropwise and rock the dish to spread the mixture evenly. Put the cells back in the incubator. Harvest GeCKO v2 lentiviral library. At 18 h post-transfection, replace the medium with 20 mL of fresh DMEM complete in each plate. Grow the cells for additional 30 h at 37°C in 5% CO2. At this step, all operations should be as gentle as possible, as 293T cells may easily be detached from the plate. At 48 h post-transfection, collect the culture medium containing the lentiviral library to a 50 mL sterile centrifuge tube (low retention). To completely remove the detached cells and cell debris, centrifuge the tube at 500 g for 5 min. Then filter the supernatant through a 0.45 μm syringe filter to a new 50 mL centrifuge tube. Split the lentiviral solution into 1 mL aliquots in the 1.5 mL microcentrifuge tubes. Store the lentivirus in the −80°C freezer.

Lentiviral titer estimation

Timing: 5 days Below we provided a detailed step-by-step protocol for estimating the titer of the lentiviral library. A lentiviral library with high titer would be beneficial to generate a high-quality pooled cell library. Seed HeLa-Cas9 cells into the 6-well plate with a seeding density of 0.3 × 106 cells/plate and incubate the cells at 37°C with 5% CO2. After 24 h, the cells should be ∼80% confluent. Thaw the GeCKO v2 lentiviral library on ice. Prepare six 15 mL tubes and dilute the lentiviral library in DMEM complete with a 3-fold serial dilution (dilution factors of 3, 9, 27, 81, and 243, respectively). Leave one well without lentiviral infection as a control. Remove the medium in the 6-well plate and transfer the diluted lentiviral library solution to each well. After 12 h, replace the medium with fresh DMEM complete. At 24 h post-transfection, change the medium with DMEM complete containing 2.5 μg/mL puromycin. Incubate the cells with DMEM complete containing 2.5 μg/mL puromycin for 48 h. Trypsin digest and count live cell numbers with trypan blue staining. Plot infected cell ratio (estimated by colony-forming method) versus dilution rate into a chart (Figure 3). The multiplicity of infection (MOI) is approximately equal to the infected cell ratio at low numbers (<20%).
Figure 3

Estimation of MOI

A representative plot of the percentage of infected cells versus dilution rate.

Estimation of MOI A representative plot of the percentage of infected cells versus dilution rate. Estimate the lentivirus volume that can achieve an MOI of 0.3 for the next step (Shalem et al., 2014, 2015).

Pooled cell library preparation

Timing: 8 days Below we provided a detailed step-by-step protocol for the preparation of the pooled CRISPR cell library. We recommend checking the gRNA coverage of the starting cell library sample before starting the toxin screen, though it can also be performed by the end of the whole screen process. Seed HeLa-Cas9 cells into four 15 cm dishes at a seeding density of 8 × 106 cells/plate and incubate at 37°C in 5% CO2. After 24 h of incubation, the cells would reach 80% confluent. Thaw the GeCKO v2 lentiviral library on ice. Transfect the HeLa-Cas9 cells at an MOI of 0.3 and put the cells back in the incubator. Add the lentiviruses dropwise into the cell culture, and rock gently three to four times to ensure the even separation of the viruses. At 12 h post-infection, replace the medium with 20 mL of fresh DMEM complete. At 24 h post-infection, replace the medium with 20 mL of DMEM complete containing 2.5 μg/mL puromycin to start the puromycin selection. Keep the cells under 2.5 μg/mL puromycin for 48 h. Change the medium every 24 h. Replace the medium with 20 mL of DMEM complete containing 1.25 μg/mL puromycin and incubate for additional 48 h. Change the medium every 24 h. Passage cells into a new plate if the confluency is too high. Trypsin-digest all cells and combined all cells. Freeze half of the cells at −80°C as a backup stock. For the rest of the cells, seed into three 15 cm dishes and allow to grow to 70% confluent. The backup cell stock can be resuscitated as starting cell library. Harvest one plate of cell libraries and save it as the starting library sample (R0). Proceed to the toxin screen with the other two plates.

TcdB4 screen on HeLa-Cas9 cell library

Timing: 5–6 weeks In this part, we selected the genome-wide CRISPR cell library with TcdB4 for three rounds. Each round takes about 2–3 weeks. A timeline of the screening procedure is shown in Figure 4.
Figure 4

Timeline of the TcdB4 screening procedure

Created with BioRender.com.

Thaw TcdB4 stock on ice. Dilute TcdB4 in 40 mL of DMEM complete to a final concentration of 0.045 pM. Replace the culture medium of the HeLa-Cas9 cell library with DMEM complete containing 0.045 pM TcdB4. After 14 h, remove the supernatant and gently wash the cells 6 times with PBS to remove loosely attached round-shaped cells. Trypsin-digest the rest cells and seed all cells back to the original plate. Add 20 mL of fresh DMEM complete to each dish and place the plates back in the incubator. There’s no need to transfer the cells to a new dish. After 6 h, wash the plate again with PBS to remove the unattached cells, Add 20 mL of fresh DMEM complete to each plate. Use microscopy to check the condition of the cells until large cell colonies form (∼300 cells/colony). Change the medium with fresh DMEM complete if the spent turns yellow. This step takes 2–3 weeks for the first round of screen and 1–2 weeks for the second/third round of screen. Trypsin digest and combine all cells. Seed the cells into three new 10-cm dishes and allow them to grow to 70% confluent. Harvest one plate of cell libraries and save it as the cell library sample for the first round of screen (R1). Proceed to the next round of screens with the other two plates. Repeat steps 15–20 with 0.15 and 0.45 pM TcdB4 for the second and third rounds of the TcdB4 screen (R2 and R3). Collect the cell library samples with clear labels after each round of screen. Timeline of the TcdB4 screening procedure Created with BioRender.com.

PCR amplification of DNA sequences encoding small guide RNA (gRNA)

Timing: 3 days Below we provided a detailed step-by-step protocol for obtaining the pooled gDNA fragments from the collected cell library samples. Extract the genomic DNA from the cell libraries R0, R1, R2, and R3 using QIAGEN Blood & Cell Culture DNA Kit following the manufacturer’s instruction (https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/dna-purification/genomic-dna/blood-and-cell-culture-dna-kits). A HeLa cell contains about 6 pg of genomic DNA. Each HeLa cell in the cell library is expected to harbor only one gRNA encoding gene. To ensure 20-fold coverage of the gRNA library (GeCKO v2 library contains over 100,000 gRNAs), 12 μg of genomic DNA is needed for the PCR amplification (6 pg of genomic DNA per cell X 100,000 gRNAs X 20-fold coverage). R1, R2, and R3 are expected to contain much fewer numbers of gRNAs, a lower amount of genomic DNA may be used as the template for PCR recovering gRNAs encoding sequences from these samples. For PCR amplification of DNA sequences encoding gRNAs, set up PCR reactions like the following: PCR reaction master mix Run PCR reaction using the following conditions: PCR cycling conditions Agarose gel electrophoresis. Prepare a 2% agarose gel. Load 200 μL of PCR product for gRNA and run the gel. Agarose gel extraction. Visualize the gel under Transilluminator (Figure 5). Cut the ∼200 bp band and purify DNA using an agarose gel extraction kit.
Figure 5

PCR amplicons of the pooled gDNA

The PCR amplicons of the pooled gDNA are separated on a 2% agarose gel.

PCR amplicons of the pooled gDNA The PCR amplicons of the pooled gDNA are separated on a 2% agarose gel. Quantify DNA and send for next-generation sequencing. 100 μg DNA yield is sufficient to perform the next-generation sequencing (NGS).

NGS and data processing

Timing: 1 week In this step, we perform NGS on Illumina Novaseq 6000 platform, align raw data to human GeCKO v2 library reference, use Cutadapt (Martin, 2011) to trim down raw sequencing reads and get the count number of each gRNA. Library construction: 1 μg DNA per sample was used as input material for the preparation of libraries for NGS on the Illumina platform. Sequencing libraries were generated using NEB Next® UltraTM DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations (https://international.neb.com/protocols/2014/05/22/protocol-for-use-with-nebnext-ultra-dna-library-prep-kit-for-illumina-e7370). At this step, index codes were added to attribute sequences. Sequencing: NGS is performed using an Illumina Novaseq 6000 platform at Novogene Bioinformatics Technology (China, https://en.novogene.com/). Sequencing cycles for read1/i7 index/i5 index/read2 are 150/8/8/150 respectively. 150 bp paired-end reads were generated. Around 2,000,000 reads for each sample (∼0.5 GB NGS data) were collected. NGS data processing. Go to https://github.com/liuqinghe-007/Sequencing_results_analysis_of_CRISPR-cas9_screen.git. To align and count gRNAs in raw sequencing files, two perl scripts total_numbers_from_fq_file.pl and combine_a_b.pl, were written. Reference sequence files for human GeCKO v2 library (human_GeCKO v2_library_a.csv and human_GeCKO v2_library_b.csv) were downloaded from Addgene (https://www.addgene.org/pooled-library/zhang-human-gecko-v2). Forward sequencing primer: 5′-AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG-3′. Reverse sequencing primer: 5′- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTA-3′ Raw sequencing reads are trimmed down to the 20-nucleotide gRNA sequence by Cutadapt version 4.0 (https://github.com/marcelm/cutadapt.git) and two files containing trimmed sequences are generated as trimmed_raw_reads.fq.gz. To obtain the count number for each gRNA, the script total_numbers_from_fq_file.pl is used to align trimmed sequences in trimmed_raw_reads.fq.gz to reference sequences in human_GeCKO v2_library_a.csv and human_GeCKO v2_library_b.csv files. This will produce two files including a_library_count.txt and b_library_count.txt. To launch the script, use the following bash command on the terminal: >perl total_numbers_from_fq_file.pl trimmed_raw_reads1.fq.gz trimmed_raw_reads2.fq.gz STEP1_OUTPUTDIR Use the script combine_a_b.pl to combine counts from A- and B- half-libraries via typing the command: >perl combine_a_b.pl -i1 STEP1_OUTPUTDIR -o1 STEP2_OUTPUTDIR The number of unique gRNAs and NGS reads for each gene are plotted in a chart. Quality control of the initial CRISPR knockout cell library (R0) is very important. In a high-quality cell library, the gRNA/gene coverage should be as high as possible, while the number of NGS reads per gRNA need to be even. An example of gRNA/gene coverage in R0 is shown here (Figure 6).
Figure 6

Quality control of the initial CRISPR knockout cell library

(A) The number of unique gRNAs and the number of NGS reads for each gene in R0 are plotted in a chart.

(B) The number of gRNAs/genes in R0 versus the number of total gRNAs/genes, as shown by breakdowns.

(C) The number of identified genes in R0 versus the number of total targeted genes in the GeCKO v2 library.

Quality control of the initial CRISPR knockout cell library (A) The number of unique gRNAs and the number of NGS reads for each gene in R0 are plotted in a chart. (B) The number of gRNAs/genes in R0 versus the number of total gRNAs/genes, as shown by breakdowns. (C) The number of identified genes in R0 versus the number of total targeted genes in the GeCKO v2 library.

Expected outcomes

Using this genome-wide CRISPR screen protocol in HeLa-Cas9 cells, we can uncover several host cell genes involving major steps in the TcdB4 toxin action, including cell surface recognition, endocytosis, acidification of the endosome, and production of the co-substrate UDP-glucose. An example of outcomes after three rounds of TcdB4 selection is shown in Figure 7. We have successfully unveiled two TcdB4 receptors, one enzyme responsible for producing UDP-glucose, and multiple receptor-related genes (Figure 7). For detailed outcomes, please refer to the original article (Luo et al., 2022).
Figure 7

Genes identified from the TcdB4 screen (R3) as a screen outcome example

The x-axis shows the number of NGS reads per gene, and the y-axis represents the number of identified gRNAs for each targeted gene.

Genes identified from the TcdB4 screen (R3) as a screen outcome example The x-axis shows the number of NGS reads per gene, and the y-axis represents the number of identified gRNAs for each targeted gene.

Limitations

This protocol provides detailed materials and reagents for the loss-of-function screen on HeLa cells and can be modified to other cell lines or cytotoxins. We chose HeLa cells in this protocol because HeLa cells are sensitive to TcdB4 in the cell rounding assay. But this protocol can be modified and applied to other cell lines. As a loss-of-function CRISPR screen, only functional but non-essential genes expressed in the model cells will be targeted. Also, gene redundancy could reduce the screening efficiency, therefore genes with multiple homologs may not be easy (but still possible) to be targeted.

Troubleshooting

Problem 1

Lentivirus integration efficiency on HeLa-Cas9 cells is much lower than the WT HeLa cells (before you begin step 8).

Potential solution

When making the HeLa-Cas9 stable cell line, avoid infecting cells with high MOI.

Problem 2

The screen results show a bias when using the resuscitated cells as starting cell library (step 22). Always perform the quality control for the starting library (R0). If the gDNA coverage is low in R0, regenerate the starting cell library.

Problem 3

The numbers of cytopathic cells induced by the toxin are not consistent when the assays are performed in the 12-well plate and 15-cm dish (step 26). Usually, toxin concentration tested in a 12-well plate can be used directly in a 15-cm dish screen. However, if the cell rounding rate in a 15-cm dish appears different from the 12-well plate test, you can adjust toxin concentration. For instance, if very few cells survive in a given toxin concentration, try lowering the toxin concentration by 2-fold.

Problem 4

Cells get contaminated by germs during the long-term screening (step 32). Sterilizing all reagents and materials before use. In particular, sterilizing the culture medium after adding the bacterial toxins by filtration through a 0.22 μm pore.

Problem 5

NGS shows that the gRNA coverage in R0 is lower than expected (step 43). Don’t use viruses of low titer for R0 cell library preparation. Optimized virus package conditions as the following: Use 293T cells with low passage numbers. Estimate transient transfection efficiency with a reporter plasmid before making the library. If plasmid transfection efficiency is low, transfect using high-quality DNA and adjust the transfection reagent-DNA ratio.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Liang Tao (taoliang@westlake.edu.cn).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact with a Material Transfer Agreement.
REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies

SpCas9 Antibody Clone 14B6 (1:3000)GenScriptCat# A01936

Chemicals, peptides, and recombinant proteins

PuromycinBBICat# A610593-0025
Blasticidin SThermo Fisher ScientificCat# R21001
TcdB4(Pan et al., 2021)N/A
PolyJetSignaGenCat# SL100688
2 × Hieff PCR Master MixYeasenCat# 10102ES03

Critical commercial assays

Blood & Cell Culture DNA Mini KitQIAGENCat# 133223
GoldHi EndoFree Plasmid Maxi KitCWBIOCat# CW2104XQ
DNA Gel Extraction KitAxygenCat# AP-GX-250
NEB Next® UltraTM DNA Library Prep Kit for IlluminaNEBCat# E7370

Experimental models: Cell lines

Human: HeLaATCCCRL-1958; RRID: CVCL_3334
Human: 293TATCCCRL-3216; RRID: CVCL_0063
Human: U2OSATCCHTB-96; RRID: CVCL_0042
Human: A549ATCCCRM-CCL-185; CVCL_0023
Human: MCF-7ATCCHTB-22; CVCL_0031
Human: HT-29ATCCHTB-38; CVCL_0320

Oligonucleotides

lentiGP-1_F:AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG(Luo et al., 2022)N/A
lentiGP-1_R:TAAAAAAGCACCGACTCGGTGCCACTTTTTCAAG(Luo et al., 2022)N/A

Recombinant DNA

psPAX2AddgeneCat# 12260
pMD2.GAddgeneCat# 12259
GeCKO v2 (gRNA pooled library in lentiGuide-Puro + lentiCas9-Blast plasmid)AddgeneCat# 1000000049

Software and algorithms

Cutadapt version 4.0(Martin, 2011)https://github.com/marcelm/cutadapt.git

PCR reaction master mix

ReagentAmount
DNA template30 μg
Primer 1 (10 μM): lentiGP-1_F10 μL
Primer 2 (10 μM): lentiGP-1_R10 μL
2 × Taq (High-fidelity)100 μL
ddH2OUp to 200 μL

PCR cycling conditions

StepsTemperatureTimeCycles
Initial denaturation98°C30 s1
Denaturation98°C10 s35
Annealing50°C20 s
Extension72°C15 s
Final extension72°C2 min1
  8 in total

1.  Genome-scale CRISPR-Cas9 knockout screening in human cells.

Authors:  Ophir Shalem; Neville E Sanjana; Ella Hartenian; Xi Shi; David A Scott; Tarjei Mikkelson; Dirk Heckl; Benjamin L Ebert; David E Root; John G Doench; Feng Zhang
Journal:  Science       Date:  2013-12-12       Impact factor: 47.728

Review 2.  High-throughput functional genomics using CRISPR-Cas9.

Authors:  Ophir Shalem; Neville E Sanjana; Feng Zhang
Journal:  Nat Rev Genet       Date:  2015-04-09       Impact factor: 53.242

3.  TFPI is a colonic crypt receptor for TcdB from hypervirulent clade 2 C. difficile.

Authors:  Jianhua Luo; Qi Yang; Xiaofeng Zhang; Yuanyuan Zhang; Li Wan; Xiechao Zhan; Yao Zhou; Liuqing He; Danyang Li; Dazhi Jin; Ying Zhen; Jing Huang; Yanyan Li; Liang Tao
Journal:  Cell       Date:  2022-03-17       Impact factor: 41.582

4.  Improved vectors and genome-wide libraries for CRISPR screening.

Authors:  Neville E Sanjana; Ophir Shalem; Feng Zhang
Journal:  Nat Methods       Date:  2014-08       Impact factor: 28.547

5.  Sulfated glycosaminoglycans and low-density lipoprotein receptor mediate the cellular entry of Clostridium novyi alpha-toxin.

Authors:  Yao Zhou; Diyin Li; Jianhua Luo; Aizhong Chen; Xingxing Li; Zhenrui Pan; Li Wan; Liuqing He; Danyang Li; Yanyan Li; Min Dong; Liang Tao
Journal:  Cell Res       Date:  2021-05-10       Impact factor: 46.297

6.  Sulfated glycosaminoglycans and low-density lipoprotein receptor contribute to Clostridium difficile toxin A entry into cells.

Authors:  Liang Tao; Songhai Tian; Jie Zhang; Zhuoming Liu; Lindsey Robinson-McCarthy; Shin-Ichiro Miyashita; David T Breault; Ralf Gerhard; Siam Oottamasathien; Sean P J Whelan; Min Dong
Journal:  Nat Microbiol       Date:  2019-06-03       Impact factor: 17.745

7.  Functional analyses of epidemic Clostridioides difficile toxin B variants reveal their divergence in utilizing receptors and inducing pathology.

Authors:  Zhenrui Pan; Yuanyuan Zhang; Jianhua Luo; Danyang Li; Yao Zhou; Liuqing He; Qi Yang; Min Dong; Liang Tao
Journal:  PLoS Pathog       Date:  2021-01-28       Impact factor: 6.823

8.  Frizzled proteins are colonic epithelial receptors for C. difficile toxin B.

Authors:  Liang Tao; Jie Zhang; Paul Meraner; Alessio Tovaglieri; Xiaoqian Wu; Ralf Gerhard; Xinjun Zhang; William B Stallcup; Ji Miao; Xi He; Julian G Hurdle; David T Breault; Abraham L Brass; Min Dong
Journal:  Nature       Date:  2016-09-28       Impact factor: 49.962

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.