Literature DB >> 35926068

Expanding the tolerance of segmented Influenza A Virus genome using a balance compensation strategy.

Xiujuan Zhao1, Xiaojing Lin2, Ping Li2, Zinuo Chen2, Chengcheng Zhang2, Balaji Manicassamy3, Lijun Rong4, Qinghua Cui1,5, Ruikun Du1,5.   

Abstract

Reporter viruses provide powerful tools for both basic and applied virology studies, however, the creation and exploitation of reporter influenza A viruses (IAVs) have been hindered by the limited tolerance of the segmented genome to exogenous modifications. Interestingly, our previous study has demonstrated the underlying mechanism that foreign insertions reduce the replication/transcription capacity of the modified segment, impairing the delicate balance among the multiple segments during IAV infection. In the present study, we developed a "balance compensation" strategy by incorporating additional compensatory mutations during initial construction of recombinant IAVs to expand the tolerance of IAV genome. As a proof of concept, promoter-enhancing mutations were introduced within the modified segment to rectify the segments imbalance of a reporter influenza PR8-NS-Gluc virus, while directed optimization of the recombinant IAV was successfully achieved. Further, we generated recombinant IAVs expressing a much larger firefly luciferase (Fluc) by coupling with a much stronger compensatory enhancement, and established robust Fluc-based live-imaging mouse models of IAV infection. Our strategy feasibly expands the tolerance for foreign gene insertions in the segmented IAV genome, which opens up better opportunities to develop more versatile reporter IAVs as well as live attenuated influenza virus-based vaccines for other important human pathogens.

Entities:  

Mesh:

Year:  2022        PMID: 35926068      PMCID: PMC9380948          DOI: 10.1371/journal.ppat.1010756

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   7.464


Introduction

Influenza A virus (IAV) is a respiratory pathogen that causes seasonal epidemics and occasional pandemics globally [1]. Although there are several FDA-approved drugs available to treat IAV infections, including the viral ion channel M2 blockers (amantadine and rimantadine), the neuraminidase inhibitors (oseltamivir, zanamivir and peramivir) and a cap-dependent endonuclease inhibitor baloxavir marboxil [2,3], the emergence of drug resistance mutations illustrates the pressing need for novel anti-influenza therapeutics [4]. Recently, the rapid development of reverse genetics facilitates generation of replication-competent recombinant IAVs carrying varied reporter genes, allowing for rapid quantification of viral replication, and noninvasive imaging of infected tissues in living animals [5-9]. These live imaging animal models of IAV infection will have far-reaching benefits for novel antiviral developments. However, since the tolerance of IAV genome to foreign insertions is limited due to its segmented architecture, most of these reporter IAVs up to date are either attenuated or unstable during replication in cell culture or animals [5-9]. Moreover, the reporter genes are usually restricted to those with relatively small ones in size. To further optimize the reporter IAVs, a directed evolution strategy has been developed. For example, Katsura et al. and Cai et al. independently passaged reporter IAVs serially in mice, generating mouse-adapted variants with restored virulence and enhanced reporter gene expression [10,11]. Sequencing analysis revealed that mutations in the RNA-dependent RNA polymerase (RdRp) constituents contribute to the wildtype-like fitness in both cases, although the precise mutation sites differ [10,11]. Nonetheless, this directed evolution strategy is time-consuming and the desired outcome may not always be guaranteed. Thus it is desirable to develop a general method that allows free manipulation of IAV genome. The genome of IAV consists of eight negative-stranded viral RNA (vRNA) segments, of which each segment encodes one or two major open reading frames (ORFs), including PB2 (Polymerase basic 2), PB1 (Polymerase basic 1), PA (Polymerase acid), HA (Hemagglutinin), NP (Nucleoprotein), NA (Neuraminidase), M (Matrix proteins) and NS (Non-structural proteins). The central coding region of individual vRNAs is flanked by conserved 3’ and 5’ non-coding terminal sequences [12]. The first 13 nucleotides (nts) at the 5’ end and the first 12 nts at the 3’ end of vRNAs that are partially complementary interact to form promoter structures for viral RdRp complex [13,14]. Both the conformations of influenza polymerase complex and promoter structure are flexible and interactively regulate the dynamical initiation of transcription and replication [14,15]. In addition, the multiple segments compete with each other to recognize viral polymerase for replication and transcription [16]. For instance, if the amount of RdRp complexes is limited, the replication/transcription of one segment vRNA would be negatively affected by the presence of the other seven counterparts, but this competition could be relieved as polymerase subunits accumulates [16]. This is consistent with the finding that the replication and transcription of the different segments follow different kinetics during IAV infection, reflecting a delicate dynamical balance of the segmented genome [17]. The balance of the multiple segments during IAV infection is vulnerable to artificial modifications. For example, it was reported that specific mutations in the promoters can enhance the levels of vRNA and mRNA [18,19], however, upon incorporation of these promoter-upregulating mutations, the recombinant IAV attenuates in replication, highlighting the critical need for the delicate balance between replication, transcription and protein expression of IAV segments [19]. In addition, many other factors including the segment-specific non-coding regions (NCRs), the length of coding regions, as well as the inherent activity and template preference of viral RdRp are involved in the competition [16,17,20]. In our previous report, we demonstrated that foreign insertions can drastically reduce the replication/transcription capacity of the modified segment due to inevitable increase in segment length, adversely impacting the balance of the multiple segments in the levels of vRNA and mRNA during IAV infection [21]. For example, when the imbalance occurred to the NS segment: First, inadequate vRNAs of modified NS are available for incorporation into progeny virions, producing a large amount of NS-null noninfectious particles [21]; Second, the expression of NS1 proteins decreased accordingly and may no longer counteract the host immune responses efficiently [22]; Third, the accumulation of NEPs which play a pivotal role to mediate nuclear export of viral ribonucleoproteins was greatly affected [23,24]. Together these mechanisms lead to a reduced replication and attenuation of the reporter IAVs. In this study, we propose that incorporation of compensatory enhancing mutations during initial construction of a reporter IAV can rebalance the multiple segments, and subsequently reduce or eliminate the mechanism of attenuation. As a proof of concept, a reporter influenza PR8-NS-Gluc virus which carries a Gaussia luciferase (Gluc) gene fusing to NS1 was used as a starting point [25], and the aforementioned enhancing mutations were introduced into the promoter elements of the modified NS-Gluc segment to rectify the imbalance. We show that an optimized reporter IAV that shows improved replication kinetics and virulence was generated. Moreover, the tolerance of IAV genome can be further expanded using this “balance compensation” strategy. In conjugation with stronger compensatory enhancements, a recombinant IAV carrying a much larger firefly luciferase (Fluc) gene was subsequently generated.

Results

Evaluation of replication-enhancing mutations of IAV vRNA segments

Diverse structures could be formed from the 3’- and 5’-terminal nucleotides of influenza vRNA segments, including cockscrew, panhandle, fork and hook-like structures, dynamically regulating the transcription and replication of vRNA during virus life cycle [26]. Interestingly, it has been well documented that the panhandle structure is involved in the initiation of replication/transcription, while panhandle-stabilizing mutations within the conserved 3’-NCR can enhance the promoter activity [16,18]. These panhandle stabilizing mutations have potential to be employed as compensatory enhancements for reporter IAVs. We first evaluated how panhandle-stabilizing mutations enhanced vRNA replication, transcription and subsequent protein expression, especially in competition with its natural counterpart. To this end, a dual-template reporter RdRp assay was employed. In brief, the firefly and renilla luciferase (Fluc and Rluc) genes were flanked by 3’- and 5’- NCRs of the NS segment and inserted in a negative sense orientation under the control of the human RNA polymerase I (Pol-I) promoter, generating IAV minigene expressing plasmids pNCRNS-Fluc and pNCRNS-Rluc, respectively. Mutations of interest were then introduced into pNCRNS-Fluc, producing various mutants (pNCRx-Fluc), while pNCRNS-Rluc was set as a constant competitive control. When pNCRx-Fluc and pNCRNS-Rluc were co-transfected into 293T cells expressing IAV RdRp components and NP, mini vRNA reporters NCRx-Fluc and NCRNS-Rluc were expected to compete with each other to bind RdRp complex. We thus measured the relative expression of vRNA and mRNA from the dual-templates by qRT-PCR as a measure of the replication and transcription efficacy of mutated versus wildtype vRNA promoter. Fig 1A shows a schematic overview of the dual luciferase reporter-based competition assay.
Fig 1

Pan-handle stabilizing mutations at the 3’-NCR enhances the transcription/replication of influenza vRNA.

(A) A schematic overview of the dual-template reporter constructs and the cell-based dual-template RdRp assay. (B) Presentation of two of the proposed vRNA promoter structure models. #, indicates the pan-handle stabilizing mutation site. (C) Normalized ratio of firefly to Renilla luciferase (Fluc/Rluc) at the vRNA, mRNA as well as protein expression levels. ***, p<0.001, students’ t test.

Pan-handle stabilizing mutations at the 3’-NCR enhances the transcription/replication of influenza vRNA.

(A) A schematic overview of the dual-template reporter constructs and the cell-based dual-template RdRp assay. (B) Presentation of two of the proposed vRNA promoter structure models. #, indicates the pan-handle stabilizing mutation site. (C) Normalized ratio of firefly to Renilla luciferase (Fluc/Rluc) at the vRNA, mRNA as well as protein expression levels. ***, p<0.001, students’ t test. As described previously, three pan-handle stabilizing mutations at 3’-NCR (G3A, U5C, C8U) and the varied combinations were introduced into NCRNS-Fluc separately by PCR using primers listed in S1 Table, and dual competition assay was conducted using minigenome NCRNS-Rluc as a competitive control (Fig 1B) [16,18]. As shown in Fig 1C, double mutations G3A/C8U could significantly enhance both vRNA replication and transcription, while triple mutations G3A/U5C/C8U exhibited stronger enhancement, providing two sets of potent compensatory enhancement (CE). Here we will refer the G3A/C8U and G3A/U5C/C8U mutations as CE1 and CE2, respectively. It is worth noting that mutations G3A, C8U, G3A/U5C, U5C/C8U drastically impaired the transcription and subsequent protein expression without affecting vRNA replication, indicating that paired G3/C8 or A3/U8 is essential for the formation of transcription favored structures, e.g., the corkscrew like structure (Fig 1B).

Compensatory promoter enhancements can rebalance vRNA segments of reporter IAV and restore the wildtype-like fitness in-vitro and in-vivo

To determine whether the compensatory enhancements can restore the replication kinetics and virulence of the reporter influenza PR8-NS-Gluc virus, the two sets of promoter-upregulating mutations were incorporated into the modified NS-Gluc segment (Fig 2A) [25]. Through a modified dual-template RdRp assay with wildtype M segment as a competitive control template, the expression of the mutated NS-Gluc vRNA was compared to the original NS-Gluc and natural NS by qRT-PCR analysis. As anticipated, both sets of mutations CE1 and CE2 significantly increased the replication of NS-Gluc vRNA (Fig 2B). Moreover, it is noteworthy that segment NSCE1-Gluc which carries G3A/C8U mutations could replicate similarly in efficacy to natural NS, while segment NSCE2-Gluc carrying G3A/U5C/C8U mutations replicated more efficiently. Similar compensatory enhancement was observed for vRNA transcription (S1 Fig).
Fig 2

Compensatory enhancement restores the replication kinetics and virulence of a reporter influenza PR8-NS-Gluc virus.

(A) Construction of modified NS-Gluc segment. *, replication enhancing mutations. (B) Relative replication efficacies of NS-derived vRNAs normalized to M. (C) In vitro replication kinetics of wildtype and modified influenza viruses. (D and E) Female BALB/c mice were infected with 100 TCID50 of indicated viruses, and the body weight (D) and survival (E) were monitored for 14 days. (F) Relative genome copies to virus titer ratio of the parental PR8-WT and recombinant IAVs PR8-NS-Gluc, PR8-NSCE1-Gluc and PR8- NSCE2-Gluc viruses. Indicated viruses derived from MDCK were titrated and extracted for vRNAs followed by quantification of segment M by qPCR. The ratio of genome copies to virus titer were then evaluated. The standard deviations were calculated based on three replicates. *, p<0.05; ***, p<0.001; ns, no significance; students’ t test.

Compensatory enhancement restores the replication kinetics and virulence of a reporter influenza PR8-NS-Gluc virus.

(A) Construction of modified NS-Gluc segment. *, replication enhancing mutations. (B) Relative replication efficacies of NS-derived vRNAs normalized to M. (C) In vitro replication kinetics of wildtype and modified influenza viruses. (D and E) Female BALB/c mice were infected with 100 TCID50 of indicated viruses, and the body weight (D) and survival (E) were monitored for 14 days. (F) Relative genome copies to virus titer ratio of the parental PR8-WT and recombinant IAVs PR8-NS-Gluc, PR8-NSCE1-Gluc and PR8- NSCE2-Gluc viruses. Indicated viruses derived from MDCK were titrated and extracted for vRNAs followed by quantification of segment M by qPCR. The ratio of genome copies to virus titer were then evaluated. The standard deviations were calculated based on three replicates. *, p<0.05; ***, p<0.001; ns, no significance; students’ t test. Next, reporter influenza PR8-NS-Gluc viruses harboring additional CE1 or CE2 mutations at 3’-NCR of the modified NS-Gluc segment were rescued using reverse genetics system and were designated as PR8-NSCE1-Gluc and PR8-NSCE2-Gluc, respectively. Interestingly, the PR8-NSCE1-Gluc virus showed improved replication kinetics as compared to original PR8-NS-Gluc, although decreased replication was still observed compared to the parental wildtype PR8 virus (PR8-WT); however, PR8-NSCE2-Gluc replicated even less efficiently than the original PR8-NS-Gluc virus (Fig 2C). Together, these results suggest that proper compensation to the modified segment can restore the wildtype-like in-vitro replication kinetics of reporter IAVs. To determine whether CE1 could rescue the attenuated virulence of reporter PR8-NS-Gluc virus, the lethality of PR8-NSCE1-Gluc to mice was assessed alongside with PR8-WT and PR8-NS-Gluc viruses as controls. At a dose of 100 TCID50, PR8-WT infection caused rapid body weight loss of mice, while delayed and mild body weight loss were observed for PR8-NS-Gluc infected mice, indicating drastic attenuation of PR8-NS-Gluc virus (Fig 2D). Interestingly, PR8-NSCE1-Gluc virus induced more rapid and severe body weight loss compared to the original PR8-NS-Gluc virus, although it was still not as virulent as the parental PR8-WT virus (Fig 2D). Similar enhancement could also be reflected by the lethality data, as PR8-NS-Gluc virus was sublethal at indicated dose, PR8-NSCE1-Gluc caused 60% lethality (Fig 2E). These data clearly demonstrate that the in vivo fitness of reporter IAVs can be, at least partially, restored by rebalancing the levels of modified genome segments. Our previous study has demonstrated that the ratio of genome copies to infective virus of PR8-NS-Gluc is much higher than the parental PR8-WT virus [21], suggesting an increased production of defective interfering (DI) particles. We therefore assessed the effect of CE incorporation on DI particles production. Consistently, the genome copies to infective virus ratio of PR8-NS-Gluc was about 11.6-folds compared to PR8-WT, while the PR8-NSCE1-Gluc virus showed a 2.5-folds increase only, which was not statistically significant (Fig 2F). These results suggest that CE1 incorporation can reduce the abnormal production of DI particles caused by foreign gene insertion. However, the PR8-NSCE2-Gluc virus produced 11.4-folds more DI particles than PR8-WT virus (Fig 2F), which is in accordance with the overcompensation of CE2 incorporation to genome balance and the attenuated replication of PR8-NSCE2-Gluc virus (Fig 2B and 2C).

Compensatory enhancement augments reporter protein expression

Considering CE1 could restore the replication capacity of the modified segment NS-Gluc, we reasoned that it was likely that the reporter protein expression could also increase correspondingly. To validate this, the kinetics of Gluc expression during PR8-NSCE1-Gluc replication was monitored (Fig 3A). Further, the relative reporter protein expression level was determined by normalizing the bioluminescence signal to viral titer. As expected, Gluc expression in the PR8-NSCE1-Gluc infected cells was significantly augmented by more than 10-folds (Fig 3B).
Fig 3

Compensatory enhancement augments the expression of reporter genes.

(A) Kinetics of reporter luciferase expression during virus replication in vitro. (B) Normalized Gluc activity to virus titers of identical time points (relative Gluc activity/viral titer) for original PR8-NS-Gluc and mutated PR8-NSCE1-Gluc viruses. (C) Adaptation of the reporter viruses as an in vitro high-throughput screening approach. CV, coefficient of variation; S/N, signal-to-noise ratio. (D) Kinetics of reporter luciferase expression during virus replication in mice. (E) Ex-vivo imaging of excised mice lungs. (F) The signals of ex-vivo imaging derived from mice lungs infected by reporter PR8-NS-Gluc and PR8-NSCE1-Gluc viruses.

Compensatory enhancement augments the expression of reporter genes.

(A) Kinetics of reporter luciferase expression during virus replication in vitro. (B) Normalized Gluc activity to virus titers of identical time points (relative Gluc activity/viral titer) for original PR8-NS-Gluc and mutated PR8-NSCE1-Gluc viruses. (C) Adaptation of the reporter viruses as an in vitro high-throughput screening approach. CV, coefficient of variation; S/N, signal-to-noise ratio. (D) Kinetics of reporter luciferase expression during virus replication in mice. (E) Ex-vivo imaging of excised mice lungs. (F) The signals of ex-vivo imaging derived from mice lungs infected by reporter PR8-NS-Gluc and PR8-NSCE1-Gluc viruses. The reporter influenza PR8-NSCE1-Gluc was next adapted for high-throughput antiviral screening. The signal-to-noise (S/N) ratio with PR8-NSCE1-Gluc was boosted from 24 to 1109 compared to the original PR8-NS-Gluc based screening, while the coefficient of variation (CV) and Z’ score were not affected (Fig 3C). Considering S/N ratio is one of the most important factors of quality control for high-throughput screens, and a higher S/N value usually means higher sensitivity, the optimized PR8-NSCE1-Gluc virus described here can be used as a powerful platform for antiviral screening. In-vivo bioluminescence imaging (BLI) of viral infection provides a valuable tool to investigate virus-host interactions and evaluate antiviral therapies. Our previous study revealed that PR8-NS-Gluc infected mice failed for in-vivo imaging, likely due to the combined effects of low expression level of Gluc and low transmission light generated by Gluc through tissues. Since PR8-NSCE1-Gluc exhibited enhanced virulence and augmented Gluc expression compared to the original PR8-NS-Gluc, we asked whether PR8-NSCE1-Gluc virus could be used for in-vivo imaging in mice. To test this, female BALB/c mice (4 weeks old) were infected with 100 TCID50 of influenza PR8-NSCE1-Gluc and PR8-NS-Gluc separately, and the kinetics of Gluc expression in the lung tissues were monitored. As shown in Fig 3D, although similar trend of rising and declining of Gluc expression were observed in both groups, which reflected similar kinetics of virus spreading and clearance, the bioluminescence level in lung tissues from the PR8-NSCE1-Gluc infected mice was roughly 20-fold higher than those from the PR8-NS-Gluc infected mice throughout the course of infection. Moreover, ex-vivo imaging revealed similar bioluminescence enhancement of PR8-NSCE1-Gluc compared to PR8-NS-Gluc (Fig 3E and 3F). However, live imaging in the PR8-NSCE1-Gluc infected mice was not successful after several rounds of attempt.

Development of a recombinant IAV carrying a large firefly luciferase gene

Considering our success in directed optimization of the reporter influenza PR8-NS-Gluc virus, we asked whether the “balance compensation” strategy would allow IAV genome to tolerate larger foreign insertions, e.g., the Fluc gene. Fluc possesses unique advantages in live imaging, including the relative ease of substrate administration (intraperitoneal injection), longer duration of signal, low cost, and more importantly, the longer peak emission wavelength (~612 nm), which contributes to its high transmission ability through tissues, providing a high level of sensitivity. However, since Fluc is large in size (~1,650 bp) and the IAV genome might not tolerate such a large insertion. In this study, we replaced the Gluc gene of the modified NS-Gluc segment with Fluc, generating NS-Fluc. An additional 2A protease sequence was inserted between NS1 and Fluc to avoid potential interfere of Fluc, due to its larger size, to the function of NS1 (Fig 4A) [27]. In addition, NS-Fluc constructs incorporating CE1 or CE2 mutations at 3’-NCR were also generated, designated as NSCE1-Fluc and NSCE2-Fluc, respectively. The replication capacities of the NS-Fluc and two mutants were determined using dual-template RdRp assay. As shown in Fig 4B, the replication of NS-Fluc was greatly impaired, with a signal roughly 0.2% of the parental NS, which was even worse than NS-Gluc (10% of the parental NS). In contrast, both CE1 and CE2 mutations at 3’-NCR improved the replication efficacy of vRNA NS-Fluc, by 3.8 and 9.4- fold, respectively.
Fig 4

Generation and characterization of a recombinant IAV expressing Fluc gene.

(A) Schematic representation of the natural NS segment and modified NS encoding the Fluc reporter gene. SD/SA—Splice donor/acceptor sites. (B) Relative replication efficacies of NS-derived vRNAs normalized to M. (C) MDCK cells were infected with PR8-NSCE1-Fluc or PR8-NSCE2-FLuc viruses from serial passage experiments in eggs (passages 1 to 5) at an MOI of 0.01. At 24 h.p.i. cells were harvested, and luciferase assays were performed. (D) Comparation of the in vitro replication kinetics of PR8-WT and reporter PR8-NSCE2-Fluc viruses. (E) PR8-NSCE2-Fluc infection induces severe body weight loss and lethal disease in mice.

Generation and characterization of a recombinant IAV expressing Fluc gene.

(A) Schematic representation of the natural NS segment and modified NS encoding the Fluc reporter gene. SD/SA—Splice donor/acceptor sites. (B) Relative replication efficacies of NS-derived vRNAs normalized to M. (C) MDCK cells were infected with PR8-NSCE1-Fluc or PR8-NSCE2-FLuc viruses from serial passage experiments in eggs (passages 1 to 5) at an MOI of 0.01. At 24 h.p.i. cells were harvested, and luciferase assays were performed. (D) Comparation of the in vitro replication kinetics of PR8-WT and reporter PR8-NSCE2-Fluc viruses. (E) PR8-NSCE2-Fluc infection induces severe body weight loss and lethal disease in mice. Next, we tried to incorporate the original NS-Fluc and two mutants into recombinant IAVs by reverse genetics. Not surprisingly, no recombinant IAV harboring the original NS-Fluc segment was generated, because the replication capacity of NS-Fluc segment was severely compromised. In contrast, both recombinant IAVs harboring NSCE1-Fluc or NSCE2-Fluc were rescued successfully. While the NSCE1-Fluc segment appeared to be unstable since the signal of exogenous reporter was lost rapidly within three passages when propagated in chicken embryo, the PR8-NSCE2-Fluc virus exhibited good stability for at least five passages (Fig 4C and S2 Fig). Interestingly, deep sequencing of the fifth passage of PR8-NSCE2-Fluc virus identified a U1G mutation with 20% frequency at the 3’-NCR of NA segment (S3 Fig). As shown in Fig 4D, PR8-NSCE2-Fluc replicated efficiently in MDCK cells, although the peak titer was 1-log lower than the parental PR8-WT virus. In a mouse model, PR8-NSCE2-Fluc was shown to be infectious and pathogenic, causing rapid body weight loss and leading to 100% lethality at high challenge doses (Fig 4E).

Establishment of a robust live imaging animal model of IAV infection

We next evaluated the potential use of PR8-NSCE2-Fluc in a live imaging mouse model of IAV infection. A group of mice were inoculated intranasally with PR8-NSCE2-Fluc at a sub-lethal dose (1,000 TCID50), and the real-time bioluminescence was performed every day for nine days to monitor temporal changes in virus replication and tissue distribution over time (Fig 5A). It could be observed that viral infection was initiated in nasal-related tissues and both lobes of the lungs, as previously described [6,9,28]. The dynamics of IAV infection was also clearly delineated. As shown in Fig 5B, the BLI signal could be detected as early as day 1 post infection (p.i.), then elevated and peaks at day 2 or 3 p.i., while the signal decreased greatly after 6 days p.i., indicating virus clearance. In a separate experiment, cohorts of mice were imaged and necropsied at 1, 3, 5, 7, 9 days p.i. (3 mice per time point), and the high correlation between BLI signal intensity and virus load in lungs was observed (r2 = 0.68, p < 0.001; Fig 5C), indicating that BLI measure can accurately reflect the virus replication in vivo.
Fig 5

Establishment of an in vivo imaging mouse model of IAV infection.

(A) Mice were infected with 1,000 TCID50 of PR8-NSCE2-Fluc virus and the bioluminescence was monitored daily for 9 days. (B) Bioluminescence imaging data corresponding to the time course of PR8-NSCE2-Fluc infection. (C) In a separate experiment, in vivo imaging was performed and mice were then euthanized for determination of viral load in lungs. The bioluminescence density and viral load from individual animals were plotted against each other from time courses of PR8-NSCE2-Fluc infection. (D) PR8-NSCE2-Fluc infected mice were treated with 10–30 mg/kg/day of oseltamivir phosphate or vehicle only, and the in vivo imaging was carried out on days 2 and 5. (E) Data correspond to the in vivo imaging. *, p<0.05; **, p<0.01; students’ t test.

Establishment of an in vivo imaging mouse model of IAV infection.

(A) Mice were infected with 1,000 TCID50 of PR8-NSCE2-Fluc virus and the bioluminescence was monitored daily for 9 days. (B) Bioluminescence imaging data corresponding to the time course of PR8-NSCE2-Fluc infection. (C) In a separate experiment, in vivo imaging was performed and mice were then euthanized for determination of viral load in lungs. The bioluminescence density and viral load from individual animals were plotted against each other from time courses of PR8-NSCE2-Fluc infection. (D) PR8-NSCE2-Fluc infected mice were treated with 10–30 mg/kg/day of oseltamivir phosphate or vehicle only, and the in vivo imaging was carried out on days 2 and 5. (E) Data correspond to the in vivo imaging. *, p<0.05; **, p<0.01; students’ t test. To further test if our BLI-based mouse model of IAV infection could be used to evaluate efficacy of antiviral therapeutics, the mice were administrated with 10 or 30 mg/kg/day oseltamivir phosphate per oral twice a day starting at 2 hours prior to virus challenge. Mice treated with vehicles only were used as controls. BLI was acquired at day 2 and 5 p.i.. Both doses of oseltamivir reduced the signal intensities greatly (Fig 5D and 5E). These results demonstrate that our PR8-NSCE2-Fluc based live-imaging mouse model accurately reflects the in vivo efficacy of oseltamivir.

Development of a live imaging animal model of H3N2 IAV infection

To investigate whether we could develop a similar live imaging mouse model with another IAV strain, we developed and evaluated an A/X31(H3N2)-based live imaging strain. The X31 virus is a reassortant virus harboring six internal segments from A/PR8 as backbone and the HA and NA segments from a mouse adapted virus of the H3N2 Hong Kong epidemic strain, and it has been broadly used to establish mouse models of H3N2 infection [29]. First, we generated a reporter X31-NSCE2-Fluc virus containing the six internal segments from the PR8-NSCE2-Fluc as backbone by reverse genetics. Subsequently, the X31-NSCE2-Fluc virus was characterized both in vitro and in vivo. Predictably, the in vitro replication of X31-NSCE2-Fluc was reduced compared to wildtype X31 virus, with peak virus tier of more than 2-log lower (Fig 6A). In addition, the X31-NSCE2-Fluc virus was attenuated in mice compared to the X31 virus (Fig 6B). Nonetheless, the X31-NSCE2-Fluc virus exhibited similar lethality as the recombinant PR8-NSCE2-Fluc virus.
Fig 6

Establishment of an in vivo imaging mouse model of IAV subtype H3N2 infection.

(A) Comparation of the in vitro replication kinetics of wildtype X31 and reporter X31-NSCE2-Fluc viruses. (B) The lethality of wildtype X31 and reporter X31-NSCE2-Fluc viruses in mouse models. (C) Mice were infected with series doses of X31-NSCE2-Fluc virus and the bioluminescence was monitored at days 1, 2, 3, 5, and 8 post challenge. (D) The kinetics of bioluminescence imaging in mice infected with varies doses of X31-NSCE2-Fluc virus. Inset, linearization analysis of the bioluminescence signals at day 2 post challenge to challenge doses.

Establishment of an in vivo imaging mouse model of IAV subtype H3N2 infection.

(A) Comparation of the in vitro replication kinetics of wildtype X31 and reporter X31-NSCE2-Fluc viruses. (B) The lethality of wildtype X31 and reporter X31-NSCE2-Fluc viruses in mouse models. (C) Mice were infected with series doses of X31-NSCE2-Fluc virus and the bioluminescence was monitored at days 1, 2, 3, 5, and 8 post challenge. (D) The kinetics of bioluminescence imaging in mice infected with varies doses of X31-NSCE2-Fluc virus. Inset, linearization analysis of the bioluminescence signals at day 2 post challenge to challenge doses. The live imaging of X31-NSCE2-Fluc in mice was evaluated. BALB/c mice were grouped and inoculated intranasally with X31-NSCE2-Fluc at a series of doses from 102 to 105 TCID50, followed by monitoring real-time bioluminescence at day 1, 2, 3, 5 and 8 post challenge (Fig 6C). As shown in Fig 6D, the kinetics of BLI signal clearly showed the initiation, spreading and clearance of virus infections. Moreover, the signals at day 2 from different groups correlated well to the challenge doses (Fig 6D), suggesting this IAV strain can be adapted to be used for live imaging.

Discussion

The limited tolerance of IAV genome to foreign gene insertion has hampered the development of recombinant IAVs as tools, e.g, reporter viruses [5,6,30], and live-attenuated influenza virus-vectored vaccines bearing foreign antigens [31-33]. Previously, we have unraveled an underlying mechanism that foreign insertions may cause reduced transcription/replication capacity of the modified vRNA segment in competition with other wildtype segments, impairing the balance of the segmented genome during infection. Thus, the balanced profiles of the eight segments at the levels of vRNA, mRNA and protein expression are all adversely affected, leading to defective genome packaging into progeny virions [21]. As a consequence, the replication and virulence of recombinant IAVs are attenuated, and the foreign insertions may be lost rapidly during virus passaging. In the present study, we developed a “balance compensation” strategy to expand the tolerance of the segmented IAV genome to facilitate genome manipulations. As depicted in Fig 7, directed optimization of recombinant IAVs is achieved by incorporating compensatory enhancements (CEs) to rectify the reduced replication of modified segment and genome imbalance.
Fig 7

Representative diagram of the molecular mechanism underlying attenuation of reporter IAVs and the proposed “balance compensation” strategy for directed optimization.

(A) The NS segment was modified with foreign insertions, resulting in reduced replication/transcription of the NS-derived vRNA and impaired balance of the multiple segments. Subsequently, a large proportion of progeny virions are NS-null and non-infectious. (B) For directed optimization of the reporter IAV, proper compensatory enhancement was incorporated during initial construction. The replication/transcription of NS-derived vRNA was specifically increased, while rebalance of the segmented genome could be achieved, restoring the wildtype-like fitness. Of note, the multiple segments in wildtype PR8 virus infected cells were shown in equal molar ratio for conceptual illustration only.

Representative diagram of the molecular mechanism underlying attenuation of reporter IAVs and the proposed “balance compensation” strategy for directed optimization.

(A) The NS segment was modified with foreign insertions, resulting in reduced replication/transcription of the NS-derived vRNA and impaired balance of the multiple segments. Subsequently, a large proportion of progeny virions are NS-null and non-infectious. (B) For directed optimization of the reporter IAV, proper compensatory enhancement was incorporated during initial construction. The replication/transcription of NS-derived vRNA was specifically increased, while rebalance of the segmented genome could be achieved, restoring the wildtype-like fitness. Of note, the multiple segments in wildtype PR8 virus infected cells were shown in equal molar ratio for conceptual illustration only. In this study, a well-studied set of replication-enhancing mutations CE1 at the promoter element was introduced into the modified NS-Gluc segment of the reporter influenza PR8-NS-Gluc virus, and it was shown that CE1 could correct the reduced replication/transcription of modified NS-Gluc segment. Further, CE1 incorporation not only restored the wildtype-like fitness of the reporter virus (see Fig 2), but also significantly enhanced the reporter Gluc expression (see Fig 3). Importantly, we successfully generated stable replication-competent recombinant IAVs integrating a much larger Fluc gene coupled with a much stronger set of replication-enhancing mutations CE2 (see Figs 4 and 6). Our work demonstrates there is delicate balance of the segmented IAV genome for genome manipulations. For instance, since CE1 can compensate the reduced replication/transcription efficacy of NS-Gluc to the level of natural NS, and CE2 leads to overcompensation (see Fig 2B), it seems reasonable to assume that CE1 but not CE2 was more suitable for directed optimization of the recombinant PR8-NS-Gluc virus. However, since Fluc is much larger and its insertion to the genome could impair the balance of segmented genome more drastically, the CE2 but not CE1 was more optimal for generating a more stable recombinant PR8-NS-Fluc virus (see Fig 4). It is noteworthy that CE2 is likely not optimal enough to compensate the reduced replication of NS-Fluc segment, and additional compensation(s) is likely required to generate more stable IAVs (see Fig 4B). In addition, since PR8 strain was laboratory-adapted and likely harbors increased tolerance for genome rearrangement, generation of recombinant IAVs from clinical isolates may require more optimization for genome balance. Our “balance compensation” strategy, described here, is also segment dependent. Besides NS, other segments including PB1, PB2, PA, NA and NP have also been engineered to create reporter IAVs [5-7,30,34]. Considering the promoter sequences is highly conserved among all segments, the aforementioned promoter enhancing mutations should also apply to optimize these reporter viruses. In addition, many segment-specific enhancement candidates should be considered. First, as a U/C polymorphism at position 4 exists within the 3’-NCR of IAV segments, U4 contributes to a higher transcription/replication capacity compared to C4 [35]. For those segments that carry original C4 at the 3’-NCR, a C4 to U4 mutation should be employed as compensatory enhancement. Second, the segment-specific NCR sequences are also involved in vRNA transcription/replication [36-38]. For example, it was reported that a U13 to C13 mutation in the 3′ end of the NA gene promoted the expression of viral RNA and protein, while mutation of other sites within the UTR could differentially regulate viral genomic transcription and translation [36]. We speculate that a U13 to C13 mutation at the variable NCR sequence of the modified NA would compensate to the attenuation [7]. Third, since the accumulation of vRNA and mRNA during IAV infection is dynamic and segment-specific, both the inherent activity and template preference of viral RdRp may be involved in the regulation [17,20]. As mentioned above, Katsura et al. generated a mouse-adapted reporter influenza Venus-PR8 virus carrying a Venus gene within NS segment, and identified a PB2-E712D substitution that could stabilize the foreign gene insertion and restore wildtype-like replicative ability and virulence in mice [10,22]. Mechanistic studies revealed that the polymerase fidelity was not affected by PB2-E712D substitution [22], and the inherent polymerase activity of PB2-E712D is even lower than that of wildtype PB2 [10]. Notably, considering the inherent polymerase activity was determined using an NP-derived template [10], and it was demonstrated that PB2-E712D enhanced the transcription/replication efficiency of the modified NS as compared to NP [22], we speculate that the mutated polymerase may possess an increased preference to NS segment over NP. Further studies are needed to investigate the preference profile of the mutated polymerase to the eight segments. It is possible that these enhancement candidates can be used independently or in combination to achieve appropriate compensation, i.e., to rebalance the segmented genome. In summary, we have developed a “balance compensation” strategy for generation of reporter IAVs. Our strategy allows us to further expand the tolerance of IAV genome to foreign insertions. The success of the present study not only provides diverse valuable reporter IAVs and robust live-imaging mouse models of IAV infection, but also encourages generation of novel reporter viruses with more versatile capabilities, e.g., the bi- or tri- reporter viruses that express two or three foreign reporters from different segments [39]. Moreover, the feasibility of our strategy opens up better opportunities to develop live attenuated influenza virus-vectored vaccines for other highly pathogenic viruses and bacteria.

Materials and methods

Ethics statement

All animal experiments within this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Shandong University of Traditional Chinese Medicine (Approval: SDUTCM20211230001).

Cell culture

Human embryonic kidney cell line 293T and Madin-Darby canine kidney (MDCK) epithelial cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Cellgro, Manassas, VA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), 1000 units/mL penicillin and 100 μg/mL streptomycin (Invitrogen, Carlsbad, CA, USA). Infections were performed in Opti-MEM containing 2 μg/mL N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)–trypsin (Sigma-Aldrich, St. Louis, MO, USA). All cells were grown at 37 °C in 5% CO2.

Plasmids

(i) Construction of the IAV minigene expressing plasmids. The plasmids expressing NS-derived reporter vRNAs were constructed by replacing the NS1-NEP ORFs with Fluc or Rluc encoding ORFs, under the control of the human RNA polymerase I (Pol-I) promoter. The NCRNS-Fluc fragment was amplified with primers NCRNS-Fluc-Forward/NCRNS-Fluc-Reverse using the pISRE-Luc plasmid as template, while the NCRNS-Rluc fragment was amplified with primers NCRNS-Rluc-Forward/NCRNS-Rluc-Reverse from pRL-TK plasmid. Both NCRNS-Fluc and NCRNS-Rluc fragment were then cloned into the Sap I linearized pPol-I vector using In-fusion cloning kit (Takara, Beijing, China) following the manufacturer’s protocol, generating pNCRNS-Fluc and pNCRNS-Rluc respectively. Next, NCRNS-Fluc fragments carrying panhandle-stabilizing mutations were amplified using indicated primer NCRNS-x-Forward paired with NCRNS-Fluc-Reverse from pNCRNS-Fluc template, and then cloned into pPol-I as described above, generating pNCRNS-x-Fluc mutants. (ii) Construction of plasmids expressing mutated NS-Gluc vRNAs. In order to introduce desired mutations into the modified NS-Gluc segment, NCRns-3,8m-Forward and NCRns-3,5,8m-Forward were respectively paired with the primer 5’-NCR-Reverse to amplify NSCE1-Gluc and NSCE2-Gluc fragments from the original pDZ-NS-Gluc plasmid [25]. The two fragments were then cloned into pPol-I vector as described above, generating pPolI-NSCE1-Gluc and pPolI-NSCE2-Gluc respectively. As controls, the natural NS, original NS-Gluc and natural M were amplified using primers 3’-NCR-Forward/5’-NCR-Reverse and cloned into pPol-I vector, generating pPolI-NS, pPolI-NS-Gluc, and pPolI-M, respectively. (iii) Construction of plasmids expressing wildtype and mutated NS-Fluc vRNAs. The modified NS-Fluc was constructed using similar strategy for construction of NS-Gluc, except that an additional 2A protease sequence was inserted between NS1 and Fluc to avoid fusion. The NS-Fluc construct was divided to 3 fragments for initial amplification. The left 3’-NCR-NS1 and right NEP-5’-NCR fragment were amplified using pDZ-NS-Gluc as template with primers 3’-NCR-Forward/NS1-2A-Reverse and 2A-NEP-Forward/5’-NCR-Reverse, respectively. The middle 2A-Fluc fragment was amplified using primers 2A-Fluc-Forward/Fluc-2A-Reverse from the template pNCRns-Fluc. Adjacent fragments overlap for at least 15 nts. All the three fragments and the Sap I linearized pPol-I vector were then ligated using the In-fusion cloning kit, generating wildtype pPolI-NS-Fluc plasmid. To introduce desired mutations into the modified NS-Fluc segment, NCRns-3,8m-Forward and NCRns-3,5,8m-Forward were respectively paired with the primer 5’-NCR-Reverse to amplify NSCE1-Fluc and NSCE2-Fluc mutant fragments from pPolI-NS-Fluc. The two fragments were then cloned into pPol-I vector as described above, generating pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc respectively. All the primer sequences used above were shown in supplementary S1 Table.

Reverse genetics

The influenza A/Puerto Rico/8/1934 virus (H1N1, PR8) and recombinant reporter viruses were generated and propagated as described previously [25]. In brief, the IAV rescue plasmids of PR8 backbone including pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M, and -NS1, were co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instructions. At 24 hour post transfection (h.p.t.), fresh MDCK cells were seeded and co-cultured with 293T cells. After 48 h incubation, the influenza PR8 virus was harvested from the supernatant. After plaque purification, the virus was amplified in 10-day-old chicken embryos. The viral titer was determined by inoculation of serial 10-fold dilutions of stock virus onto MDCK cells and calculated by the Reed-Muench method [25]. For modified viruses, the rescue plasmid pDZ-NS1 were replaced with indicated pDZ-NS-Gluc, pPolI-NSCE1-Gluc, pPolI-NSCE2-Gluc, pPolI-NS-Fluc, pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc for construction of recombinant viruses PR8-NS-Gluc, PR8-NSCE1-Gluc, PR8-NSCE2-Gluc, PR8-NS-Fluc, PR8-NSCE1-Fluc and PR8-NSCE2-Fluc, respectively. X31-NSCE2-Fluc was generated using rescue plasmids for the six internal segments of PR8-NSCE2-Fluc, as well as pDZ-X31-HA and pDZ-X31-NA that encode HA and NA of X31 respectively.

The dual-template RdRp assays

The dual-template reporter RdRp assay was conducted as previously described with slight modifications [16]. Briefly, the minigene expressing plasmids pNCRNS-Fluc (or its mutants pNCRx-Fluc) and pNCRNS-Rluc were co-transfected into 293T cells with IAV RdRp constituent expressing plasmids pFlu-NP, pFlu-PB1, pFlu-PB2, and pFlu-PA using Lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instructions. At 24 h.p.t., the cells were harvested, and a proportion of the cells were removed for luciferase assays using Dual-Glo Luciferase Assay System (Promega, Madison, WI USA), while the left cells were extracted for total RNAs using Simply P Total RNA Extraction Kit (Bioflux, Zhejiang, China). The vRNA and mRNA were reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, China) with the NS-specific primer RT-vRNA-NS and oligo(dT), respectively, followed by quantitative-PCR using Fluc-specific and Rluc-specific qPCR primers. The relative level of Fluc were normalized to Rluc for vRNA, mRNA as well as luciferase activity were calculated to reflect the efficacy of vRNA replication, transcription and protein expression of indicated minigene constructs. Alternatively, the natural or modified NS segments expressing plasmids were separately co-transfected with natural M-expressing plasmid (pPolI-M) into 293T cells expressing RdRp constituents. After 24h incubation, the cells were harvested for total RNA extraction. The vRNA and mRNA were reverse transcribed as described above, except for vRNA M were reverse transcribed using a universal 3’NCR primer RT-3’NCR, followed by qPCR using NS-specific and M-specific qPCR-primers. The vRNA and mRNA level of NS-derived segments were normalized to those of M to reflect their replication and transcription efficacy respectively. The primers used for reverse transcription and qPCR were shown in supplementary S2 Table.

In vitro growth curves

MDCK cells growing in 6 well plates were infected by indicated viruses at a multiplicity of infection (MOI) of 0.01 TCID50/cell. After 1 h incubation at 37°C, cells were washed and fresh Opti-MEM containing 2 μg/ml TPCK-trypsin were added. Aliquots were removed at various time points for viral titration and luciferase assays.

Luciferase assays

To determine the activity of Gluc, 50 μL of viral culture medium or lung tissue homogenate (appropriate dilution applied to avoid over range) were mixed with 50 μL of luciferase substrate using Pierce Gaussia Luciferase Flash Assay Kit (Thermo Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. The luminescence was detected immediately using Sirius L Tube Luminometer (Berthold, Germany). Fluc assays were performed using a Britelite plus Reporter Gene Assay System (PerkinElmer, Waltham, MA, USA) according to the manufacturer’s instructions. In brief, MDCK cells growing in 96 well plates were infected by indicated viruses at an MOI of 0.01. After 1 h incubation at 37°C, cells were washed and fresh Opti-MEM containing 2 μg/ml TPCK–trypsin were added. At 24 h post infection (p.i.), the culture medium was discarded, followed by sequentially adding 50 μL PBS and 50 μL substrate. After incubation for 10min, the luminescence was detected immediately using BioTek SYNERGY neo2 Microplate Reader (BioTek, Winooski, VT, USA).

Genome stability analysis

The indicated recombinant IAVs were serially passaged in chicken embryos for at least five passages. The viruses of each passage were tittered and used to infect MDCK cells grown in white 96-well plates (10,000 cells/well) at an MOI of 0.1. The cells were harvested at 24 h.p.i. for luciferase assays.

Animal models

Female BALB/c mice (4 to 6 weeks old) were used in this study. All animals were maintained under specific pathogen-free conditions and all efforts were made to minimize any suffering and the number of animals. To determine the lethality of the viruses, five mice from each group were inoculated intranasally under isoflurane anesthesia with 10-fold serial dilutions containing 100 to 105 TCID50 (30 μl) of virus. Body weight and survival were monitored daily for 14 days. To measure virus replication in mice, three to six mice in each group were inoculated intranasally under isoflurane anesthesia with indicated sublethal dose of viruses. At indicated time points, mice were subjected to in vivo imaging, ex-vivo imaging or determination of viral load/luciferase activities in lung tissues. For antiviral treatments, 10–30 mg/kg/day of oseltamivir phosphate or vehicle only (PBS) were administered via intraperitoneal (i.p.) injection. The treatments were given twice daily for 5 days starting at 2 h before virus inoculation.

Ex-vivo imaging

Mice infected with sublethal doses of PR8-NS-Gluc, PR8-NSCE1-Gluc or mock infected were euthanized on day 3 p.i. and the trachea and lungs were excised. A syringe needle was inserted into the opening of the trachea and 0.5 ml of coelenterazine (50 μg/ml, NanoLight Technology, AZ, USA) was injected into the lung, followed by imaging immediately using IVIS200.

In-vivo imaging

Mice infected with varies doses of PR8-NSCE2-Fluc or X31-NSCE2-Fluc were anaesthetized and the substrate D-Luciferin (PerkinElmer, Waltham, MA, USA) was injected intraperitoneally at 150 mg/kg. At 10 min after substrate administration, images were acquired with the Xenogen IVIS 200 and analyzed using the Living Image software (version 4.4). To measure virus replication, live imaging was conducted daily, while for antiviral determination, the imaging were conducted on days 2 and 5 p.i.

Statistical analysis

For PR8-NSCE1-Gluc based high-throughput screening approach, the quality was assessed by evaluation of the signal-to-noise (S/N) ratio, coefficient of variation (CV) and Z’ factors. (1) S/N = mean signal of negative control / mean signal of positive control; (2) CV = SD of negative control / mean of negative control; (3) Z’ = 1–3 × (SD of positive control + SD of negative control) / (mean of negative control—mean of positive control). SD represents the standard deviation. A Z’ value between 0.5 and 1.0 is considered robust enough for an HTS assay. Statistical significance was determined using unpaired Student’s t-test with two-tailed analysis and the GraphPad Prism 5 software package (GraphPad Software). Data are considered significant when P values are<0.05.

The effects of panhandle-stabilizing mutations on vRNA transcription.

The indicated NS-derived vRNAs were separately subjected to dual competition assay with wildtype M as competitive control. Data represents the relative mRNA levels of wildtype M, NS and normalized NS/M. *, p<0.05; **, p<0.01; ***, p<0.001; ns, no significance; students’ t test. (TIF) Click here for additional data file.

Genomic stability analysis.

(A) The indicated reporter viruses were serially passaged in chicken embryos and the titer of each passage was determined. Error bars indicated Mean ± SEM of three independent experiments. (B) The genome RNAs of indicated recombinant viruses were extracted using TIANamp Virus RNA Kit (Tiangen, China). The complementary DNA was prepared using PrimeScript RT reagent Kit with gDNA Eraser (Takara, China) and NS segment specific primer (5’-CAGGGTGACAAAGACATAATG-3’). Then PCR analysis was performed using the 2xTaq MasterMix (Cwbio, China) and primers covering the full length of firefly luciferase gene (NS-Fluc-specific-Forward:5’-ACGTCGAGGAGAATCCCGGGCCCATGGAAGACGCCAAAAA-3’; NS-Fluc-specific-Reverse: CAGGCTAAAGTTGGTCGCGCCGCTGCCCAATTTGGACTTT). The PCR product was analyzed using 1% agarose gel electrophoresis. The plasmids pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc were used as positive controls, while pPolI-NS was used as the negative control. (TIF) Click here for additional data file.

Deep sequencing analysis.

The viral RNA of PR8-NSCE2-Fluc (Passage 5) was extracted using SparkZol reagent (SparkJade, China) according to the manufacturers manual and sequentially subjected to first and second strand cDNA synthesis using BeyoRT II First Strand cDNA Synthesis Kit (RNase H-) and Second Strand cDNA Synthesis Kit (Beyotime, China). The double stranded cDNA library of virus genome was deep sequenced by Novogene (China) using Illumine nova 6000. Structural variation (SV) analysis by BreakDancer software (V1.4.4, http://breakdancer.sourceforge.net/) detected no insertion, deletion, inversion and translocation of the large segments in the genome level, While SNP/InDel analysis using SAMTOOLS identified two substitutions but no insertion/deletion. (A) The depth of sequencing to positions along the reference genome. (B) Identification and characterization of the mutations. (TIF) Click here for additional data file.

Primers for construction of the plasmids.

a The substitutions at indicated positions are shown in red. (DOCX) Click here for additional data file.

Primers for reverse transcription and qPCR analysis.

(DOCX) Click here for additional data file. 26 Apr 2022 Dear Dr. Du, Thank you very much for submitting your manuscript "Expanding the Tolerance of Segmented Influenza A Virus Genome Using a Balance Compensation Strategy" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Daniel R. Perez, PhD Associate Editor PLOS Pathogens Carolina Lopez Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: The work by Zhao and collaborators (Expanding the Tolerance of Segmented Influenza A 1 Virus Genome Using a Balance Compensation Strategy) explores the gene expression of IAV after introducing foreign genes in the NS segment using a widely described laboratory-adapted strain such as PR8. The introduction of exogenous genes such as reporter genes into IAV viruses is of crucial relevance to the research community to help in the understanding of different viral processes and the evaluation of countermeasures against Influenza. Unfortunately, one of the main problems regarding the generation of recombinant viruses with heterologous sequences is the modifications of viral properties such as replication and virulence in vivo. The authors tackle this problem by the introduction of mutations in the NCR regions of the NS segments showing a modulation in the vRNA, mRNA, and protein synthesis, followed by characterization in vitro and in vivo of the replication capacity, virulence, and reporter expression; the main conclusion obtained is that a triple mutation of the 3’NCR or NS allows for the introduction of a FLuc reporter which is stable based on Fluc activity, exhibiting similar growth profiles in vitro and 100% lethality after a high dose challenge in vivo. Overall, the hypothesis and the strategy are clear. The experiments proposed are in line with the answers that the authors should provide. However, one of the main flaws in the work is the segment and strain dependency of the phenomenon observed. It is well established that PR8 is a highly laboratory-adapted strain with an increased tolerance for genome rearrangements and attenuation strategies. Based on this, the relevance of the work is compromised since we cannot establish the applicability of this type of rearrangement in more recent strains such as seasonal H3N2 or pandemic H1N1. For instance, the use of this strategy for the assessment of antiviral efficacy should be performed against current circulating strains, so the relevance of the results presented is conditioned to the tolerance of the rearrangement by different strains and not just PR8. Furthermore, is this strategy capable of tolerating different HA/NA subtypes? How is the plasticity of the rearrangement studied when other HA/NA combinations of relevance are incorporated? This is in line with the applicability and significance of the strategy that the authors did not address. This reviewer’s opinion is that besides the experimental concerns shown below, the relevance and importance of this strategy need to be studied further. All the mentioned above could improve the originality of the work. Reviewer #2: In the manuscript presented by Zhao et al, the authors researched on the improvement of influenza A segment incorporation when segments are modified for the incorporation of exogenous genes. This is very important for the field because there is an increasing interest for the use of modified influenza A viruses. One major caveat is that these viruses generally exhibit attenuation. The authors have previously demonstrated that one of the major issues relates to an imbalance in the generation of the gene segments. Basically, the modified segment produces less vRNA which in turns leads to attenuation. To overcome this problem, the authors improved the incorporation by mutagenizing the none coding regions (NCR) of a modified (PR8) segment encoding for either firefly or renilla luciferase. They used an in vitro competitive assay in which the WT NCR and the mutant(s) compete. They showed that the mutants were more efficient at producing the reporter, and vRNA and mRNA from the modified segment. However, the in vivo (mice) experiment showed that the improvement was partial; the replication of one of the mutant viruses reached titers comparable to wt but the pathogenesis were not comparable. The mutant virus did not show neither weight loss nor the lethality of wt PR8. The improvement had a more significant impact when the reporter used was larger. The manuscript needs some improvement in terms of writing. Even though the English is clear, there are some colloquial expression that must be avoided. Also, the discussion needs more work. The manuscript presented can be considered for publication after major revisions. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: Major comments Fig 1A shows an empty table. I am not sure if this is an error in the PDF version or the version submitted by the authors. In addition, the scale used in 1C does not allow the view of nuanced differences among groups. In vitro kinetics (Fig2): It is highly speculative to state an improved replication (‘álmost identical’’) of 38m-Gluc virus compared to PR8-NS Gluc and similar replication when compared with PR8 wt. Results presented are skewed by sharp differences observed at 12h, suggesting differences at time 0, which cannot be ruled out based on the information given. Furthermore, between times 12 and 36, you see (roughly) a three log10 fold increase for PR8 wt, a two-fold increase for NS-Gluc, and just a 1.5 fold increase for the mutants, so I disagree with the authors about the conclusions raised. What rationale was employed to exclude NS358m from the in vivo experiments in figure 3? As I stated previously, in vitro growth and kinetic data need to be carefully examined. On the other side, NS358m has the higher replication level shown in 2B. Although the authors provided stability data analyzed using FLuc activity, there is no sequence data about the NS segment and the rest of the IAV genome. What are the nucleotide sequence in the NS segment and the other segments? Does any new nucleotide change appear? Are the three introduced mutations maintained? How does the inclusion of Fluc affect the stability of the HA, for instance, in comparison with the wt virus? All these questions fundamental to understanding the stability of the virus generated remain unanswered. In addition, no information about yield is provided regarding the recombinant viruses. Is the yield comparable to the wt virus? How many MDL50 related to the PR8 wt is the high dose of PR8-NS358m-Fluc used? Reviewer #2: Even though some of the findings seems to address the problem, I think the authors could have dug deeper. In my view, the number of sites and virus used fall short. The authors need to increase the number of viruses and mutation to complement, at least, the in vitro part. I would also try to use other gene segments. One major problem with the production of enlarging influenza A segments is that these are usually prone to an increment in the production of defective interfering (DI) particles. The authors did not mention this possibility. I would measure DIs to see if the mutants are less prone to the production of DI particles. This could actually be the reason for the incomplete phenotype showed by the mutants when compared to WT. Where the mutant viruses stable? You showed in figure 4C that the PR8-NS358m-Fluc maintained the phenotype, but you do not show any sequencing. The authors need to sequence all the mutant viruses to show stability from the in vitro and in vivo experiments. ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: Were samples treated with DNAase for in vitro assays? Line 140: Please explain briefly how mutations were introduced Line 392: typo (sepcific) Fig 2B: Please clarify the nomenclature used for each group and their relationship with the different mutations. The differences in terminology in the text and figure are confusing. Fig 2D: TCID should say TCID50 in the title Fig 3C: Baloxivir needs to be corrected Reviewer #2: Figure 1. The table looks empty on my end. How well conserved are these alleles in the databases Figure 2B. Please change nomenclature in the figure from NS358m to something like NS3,5,8m or an alternative that helps on differentiating these mutations to mutations on nucleotide position 358. Supplementary figure 1. Change y-axis legend from mRNA to vRNA Line 169-170. “Over-compensation would on the other hand disrupt the balance of the multiple segments, which also results in attenuation”. You are assuming this is the main mechanism by which NS358m-Gluc is less efficient in vivo. But it can be any other, like cells being more sensitive to RNA detection, stronger IFN response, etc. Which at the end of the day they are all related but you guys do not show any on this respect. Since this is still speculation, I suggest to either remove the interpretation or move it to discussion and address as speculative. Line 209 live imaging remains a mission impossible. There is no impossible for science. We just don’t know yet. As Fig 4B shows, the replication of the original NS-Fluc is impaired much worse compared to NS- Gluc, not to mention the natural NS. I think there could be more proper ways to write about the results. Line 275. Please, find a different word for “Encouragingly”. Line 305-306. “…may contribute a lot”. Please, reword. ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at . Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Submitted filename: Comments_PLOS Pathogens Expanding the Tolerance of Segmented Influenza A Virus Genome Using a Balance Compensation Strategy.docx Click here for additional data file. 15 Jul 2022 Submitted filename: Response to reviewer2.docx Click here for additional data file. 21 Jul 2022 Dear Dr. Du, We are pleased to inform you that your manuscript 'Expanding the Tolerance of Segmented Influenza A Virus Genome Using a Balance Compensation Strategy' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Daniel R. Perez, PhD Associate Editor PLOS Pathogens Carolina Lopez Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Reviewer Comments (if any, and for reference): 2 Aug 2022 Dear Dr. Du, We are delighted to inform you that your manuscript, "Expanding the Tolerance of Segmented Influenza A Virus Genome Using a Balance Compensation Strategy," has been formally accepted for publication in PLOS Pathogens. We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  38 in total

Review 1.  Orthomyxovirus replication, transcription, and polyadenylation.

Authors:  G Neumann; G G Brownlee; E Fodor; Y Kawaoka
Journal:  Curr Top Microbiol Immunol       Date:  2004       Impact factor: 4.291

2.  Highly sensitive real-time in vivo imaging of an influenza reporter virus reveals dynamics of replication and spread.

Authors:  Vy Tran; Lindsey A Moser; Daniel S Poole; Andrew Mehle
Journal:  J Virol       Date:  2013-10-02       Impact factor: 5.103

3.  In vivo bioluminescent imaging of influenza a virus infection and characterization of novel cross-protective monoclonal antibodies.

Authors:  Nicholas S Heaton; Victor H Leyva-Grado; Gene S Tan; Dirk Eggink; Rong Hai; Peter Palese
Journal:  J Virol       Date:  2013-05-22       Impact factor: 5.103

4.  Multi-spectral fluorescent reporter influenza viruses (Color-flu) as powerful tools for in vivo studies.

Authors:  Satoshi Fukuyama; Hiroaki Katsura; Dongming Zhao; Makoto Ozawa; Tomomi Ando; Jason E Shoemaker; Izumi Ishikawa; Shinya Yamada; Gabriele Neumann; Shinji Watanabe; Hiroaki Kitano; Yoshihiro Kawaoka
Journal:  Nat Commun       Date:  2015-03-25       Impact factor: 14.919

5.  Visualizing influenza virus infection in living mice.

Authors:  Weiqi Pan; Zhenyuan Dong; Feng Li; Weixu Meng; Liqiang Feng; Xuefeng Niu; Chufang Li; Qinfang Luo; Zhengfeng Li; Caijun Sun; Ling Chen
Journal:  Nat Commun       Date:  2013       Impact factor: 14.919

Review 6.  Structural and Functional Motifs in Influenza Virus RNAs.

Authors:  Damien Ferhadian; Maud Contrant; Anne Printz-Schweigert; Redmond P Smyth; Jean-Christophe Paillart; Roland Marquet
Journal:  Front Microbiol       Date:  2018-03-29       Impact factor: 5.640

7.  Conserved T-cell epitopes of respiratory syncytial virus (RSV) delivered by recombinant live attenuated influenza vaccine viruses efficiently induce RSV-specific lung-localized memory T cells and augment influenza-specific resident memory T-cell responses.

Authors:  Victoria Matyushenko; Tatiana Kotomina; Igor Kudryavtsev; Daria Mezhenskaya; Polina Prokopenko; Anastasia Matushkina; Konstantin Sivak; Arman Muzhikyan; Larisa Rudenko; Irina Isakova-Sivak
Journal:  Antiviral Res       Date:  2020-06-22       Impact factor: 5.970

8.  A Mechanism Underlying Attenuation of Recombinant Influenza A Viruses Carrying Reporter Genes.

Authors:  Xiujuan Zhao; Lin Wang; Qinghua Cui; Ping Li; Yanyan Wang; Yingying Zhang; Yong Yang; Lijun Rong; Ruikun Du
Journal:  Viruses       Date:  2018-11-30       Impact factor: 5.048

9.  Amino acid changes in PB2 and HA affect the growth of a recombinant influenza virus expressing a fluorescent reporter protein.

Authors:  Hiroaki Katsura; Satoshi Fukuyama; Shinji Watanabe; Makoto Ozawa; Gabriele Neumann; Yoshihiro Kawaoka
Journal:  Sci Rep       Date:  2016-02-05       Impact factor: 4.379

10.  A Simple and Robust Approach for Evaluation of Antivirals Using a Recombinant Influenza Virus Expressing Gaussia Luciferase.

Authors:  Ping Li; Qinghua Cui; Lin Wang; Xiujuan Zhao; Yingying Zhang; Balaji Manicassamy; Yong Yang; Lijun Rong; Ruikun Du
Journal:  Viruses       Date:  2018-06-13       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.