Internal transcribed spacer region 1 as a promising target for detection of intra-specific polymorphisms for Strongyloides stercoralis.

Background: Strongyloides stercoralis, the causative agent of strongyloidiasis, is a parasitic worm that has larvae capable of reinfecting the same host. This nematode infection is therefore difficult to treat and to achieve total cure. Information about genetic variation and differences in drug susceptibility between strains is needed to improve treatment outcomes. Aim: To develop a polymerase chain reaction (PCR) to identify the intra-species variation among 13 S. stercoralis isolates collected from Bangladesh, USA and Australia. Material &
Methods: PCR assays were designed by using primers targeting S. stercoralis internal transcribed spacer (ITS) regions 1 and 2. Sequence data generated by these PCR products were compared to the existing ITS1/2, 18S and 28S rRNA gene sequences in GenBank for phylogenetic analysis.
Results: Intra-species single nucleotide polymorphisms (SNPs) were identified in ITS1 and in the 5.8S rRNA gene. The generated phylogram grouped the 13 isolates into dog, Orangutan and human clusters.
Conclusion: This method could be used as an epidemiological tool to study strain differences in larger collections of S. stercoralis isolates. The study forms the basis for further development of an ITS-based assay for S. stercoralis molecular epidemiological studies. Copyright:

INTRODUCTION

It is estimated that up to 100 million people, worldwide, are infected with Strongyloides stercoralis.[1] Another subspecies, Strongyloides. fuelleborni kellyi, from nonhuman primates, also infects humans in Africa, Southeast Asia, and Oceania.[2]

Infection is sustained in individuals by repeated episodes of autoinfection, which makes it difficult to eradicate. Chronically infected individuals usually become asymptomatic, but lifelong carriers can develop fatal symptomatic disease if they become immunocompromised. Successful treatment is dependent on 100% clearance of the parasite. Little is known about the genetic differences of S. stercoralis isolates and whether there is any variation in susceptibility to ivermectin of these isolates. Furthermore, the transmission of S. stercoralis in the community would be better understood if molecular typing were available so that sources of infection and person-to-person transmission could be traced.

The internal transcribed spacer (ITS) region has been used as a target for species identification and investigation of intra-specific strain variation of parasitic helminths.[34567] The genetic variation in a cestode parasite, Echinococcus granulosus, showing distinct genotypes within isolates using ITS1 and ITS2, has been documented.[8] However, there is limited information about the genotypes of S. stercoralis. More studies are required to improve the knowledge of parasite transmission and epidemiology. A study was carried out on intraspecies diversity based on the Strongyloides 18S ribosomal RNA gene; it was found to be highly conserved and not suitable for species identification.[9] RFLP analysis of ITS1 and ITS2 polymerase chain reaction (PCR) products was used as the basis for species identification and strain typing of Strongyloides species in human and dog isolates.[10] A study of S. stercoralis in humans from three endemic provinces in Iran also mentioned intraspecies variations based on ITS region characterization, but details were not provided.[11]

In this study, PCR primers targeting ITS regions 1 and 2 were designed based on the existing S. stercoralis ITS1/2 and 18S and 28S rRNA gene sequences in GenBank. The ITS region was analyzed to identify intraspecies polymorphisms in isolates collected from three countries.

SUBJECT AND METHODS

Origin of parasites/stool specimens

S. stercoralis larvae from 11 culture-positive specimens were collected from a high-risk group living in a slum community of Dhaka[12] and one isolate from an Australian case was used in this study. S. stercoralis isolated by Harada–Mori and/or agar plate culture methods was identified by morphological characteristics on microscopy.[13] The late Professor G. Schad (University of Pennsylvania, United States) provided S. stercoralis larvae, originally isolated from a patient in West Virginia, USA, and laboratory cultured in dogs. All isolated parasites (n = 13) were stored at −80°C until used.

Isolation of genomic DNA

Total genomic DNA was isolated from the parasites using a SIGMA GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich Pty. Ltd, NSW, AUSTRALIA; Catalogue number G 1N350) according to manufacturer's instructions.

Polymerase chain reaction

Three sets of primer pairs were used in this PCR assay, two for ITS1 and one for the ITS2 region [Table 1]. Conserved sequences suitable for primers were inferred from multiple alignments of all the available S. stercoralis and Strongyloides robustus ITS1, ITS2, 28S-like, and 5.8S rDNA sequences in GenBank. Primers ITS2Fm and ITS1F2 bind to the end of the 18S-like rRNA gene. Primer pairs ITS4Rm and ITS3R were designed to bind to the 5’-end of the 28S-like rRNA gene [Figure 1].

Table 1

Primers for amplification of Strongyloides stercoralis internal transcribed spacer

Primers	Gene target	GenBank accession number	Primer sequences (5’- 3’)a	Sequence (5’ - 3’)	Tm (°C)
ITS2Fm	18S rRNA gene	JF699148	25-55	ACTGAGCAATATCGAGAGGCAGGAAGAGATG	74.16
ITS4Rm	28S rRNA gene	EF653265	562-596	CTTAAGTTCAGCGGGTAATCATATATAATTGAGGC	70.13
ITS1F2	18S rRNA gene	JF699148	128-155	GGTGAACCTGCAGAAGGATCATTATGAT	70.17
ITS3R	28S rRNA gene	EF653265	348-378	ATATACAATACTACTTGTTATCACCCTCAAT	61.06
5.8SF1	5.8S rRNA gene	EF653265	205-228	TAAAATCGTGTCGGTGGATCATTC	67.48
28SR1	28S rRNA gene	EF653265	562-586	GCGGGTAATCATATATAATTGAGGC	63.96

a Numbers indicate sequence positions in corresponding GenBank sequences. Theoretical size-differences between PCR products amplified by different primer pairs versus 16S-USA/23S-USA were 16S-UK/23S-UK, 32 bp; 16S-AU/23S-AU, 13 bp; 16S-UK/23S-AU, 53 bp, b The Tm value was calculated with DNA calculator from Sigma website (http://www.sigma-genosys.com/calc/DNACalc.asp). PCR: Polymerase chain reaction, ITS: Internal transcribed spacer

Figure 1

The alignment of Strongyloides stercoralis and Strongyloides robustus genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA sequences. Upper lines sequences were generated by integrated GenBank sequences of JF699148 and EF653265. Lower lines is S. robustus GenBank AB272232.1 sequence. 18S rRNA (green), 5.8S rRNA (pink), and 28S rRNA gene (light blue) sequences are shown according to S. robustus GenBank sequence AB272232.1. (Sequences for S. stercoralis in this region were not available in GenBank). The location of listed Primers is shown by yellow highlight and the given primers names are in bold text near the 3’-end of primer sequences

Single and nested polymerase chain reaction for internal transcribed spacer 1 and single polymerase chain reaction for internal transcribed spacer 2

Primers pair ITS1F2 and ITS3R was used to amplify ITS1. Some samples failed to amplify in the single PCR so a nested PCR was developed to increase the sensitivity of the assay. In the nested PCR, the outer primer pair ITS2Fm and ITS4Rm was used for the first round reaction, followed by a second-round reaction using inner primer pair ITS1F2 and ITS3R. The ITS2 region primers were 5.8SF1 and 28SR1, which bind to the 5.8S rRNA gene and 28S-like rRNA gene, respectively.

The 25-μl PCR mixture for the amplification of both ITS1 and 2 was prepared as follows: 10 μl template DNA and 0.5 μM forward and reverse primers (Sigma-Aldrich, Sydney, Australia) in a final volume of 25 μL of PCR buffer (HostarTaq master mix, Qiagen). The PCR was performed as follows: 95°C for 15 min, 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min followed by a further extension at 72°C for 5 min. PCR products were separated on a 2% agarose gel and visualized using SYBR safe stain (Invitrogen, Victoria, Australia).

Purification of polymerase chain reaction product, sequence confirmation

PCR products were purified using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK). PCR products were separated on 2% agarose gel and sequenced by ARGF (http://www.agrf.org.au/sequencing.html) in Westmead Millennium Institute (WMI), Westmead, Sydney, Australia. The correct product was confirmed for every amplified sample by sequence analysis and NCBI BLAST alignment.

Internal transcribed spacer sequence analysis

All the sequences (n = 13) were manually checked against the chromatograms for sequencing quality. Sequences were aligned using Mega 5.05 and Bioedit Sequence Alignment Editor Program, version 7.0.5.3 and further aligned with published Strongyloides reference sequences (GenBank reference number EF545004, EF653264, EF653265, EF653266, JF699148, JF699149 U43576, U43577, U43578, and U43579). Phylogenetic analyses were performed using the program PAUP, version 4.0b10.

RESULTS

Internal transcribed spacer sequence polymorphism

ITS regions of all 13 clinical isolates were successfully amplified by one or both PCRs. Both ITS1 and ITS2 regions of 11 isolates were amplified. However, in two of our isolates (nos. 63 and 169), reliable sequences were obtained only from the ITS1 regions [Table 2]. ITS sequence alignment showed intraspecies single-nucleotide polymorphisms (SNPs) in ITS1 and in the 5.8S rRNA gene. Polymorphism in the ITS2 region could not be checked due to length variations in our sequence products.

Table 2

Allele types found from the internal transcribed spacer 1/2 region of the RNA gene

GenBank ID	Specimen ID	Geographical regiona	Hostb	Informative SNPc	AT
JX489144	58	Bangladesh	Humans	12-A-Ins; 75-A-Del; 166_C; 178-T-Del; 203-T-Del; 211-T	1
JX489142	155	Bangladesh	Humans	12-A-Ins; 75-A-Del; 166_C; 178-T-Del; 203-T-Del; 211-T	1
JX489141	6890	Bangladesh	Humans	12-A-Ins; 75-A-Del; 166_C; 178-T-Del; 203-T-Del; 211-T	1
JX489143	9001	Bangladesh	Humans	12-A-Ins; 75-A-Del; 166_C; 178-T-Del; 203-T-Del; 211-T	1
JX489140	100	Bangladesh	Humans	12-A-Ins; 75-A-Del; 166_C; 178-T-Del; 203-T-Del; 211-T	1
JX489145	52	Bangladesh	Humans	12-A-Ins	2
JX489146	53	Bangladesh	Humans	12-A-Ins	2
JX489147	63	Bangladesh	Humans	12-A-Ins	2
JX489148	169	Bangladesh	Humans	12-A-Ins	2
JX489149	216	Bangladesh	Humans	12-A-Ins; 51-T; 75-A-Del; 203-T-Del	3
JX489150	Australia	Australia	Humans	12-A-Ins; 51-T; 75-A-Del; 203-T-Del	3
JX489151	57	Bangladesh	Humans	12-A-Ins; 75-A-Del; 203-T-Del	4
JX489152	USA	USA	Dog	<103 unique; 166-C; 203-T-Del	5
EF653264	-	Iran	Humans	75-A-Del; 203-T-Del	6
EF653265	-	Iran	Humans	N/A	7
EF545004	-	Iran	Humans	None	7
EF653266	-	Iran	Humans	None	7
JF699148	-	Indonesia	Orangutans	Unique	8
JF699149	-	Indonesia	Orangutans	Unique	9
U43578	-	USA	Humans	12-A-Ins; 75-A-Del; 79-A-Del; 86-A-Ins	10
U43579	-	USA	Humans	12-A-Ins; 75-A-Del; 79-A-Del; 86-A-Ins	10
U43577	-	USA	Humans	12-A-Ins; 75-A-Del; 79-A-Del; 86-A-Ins; 162-T-Ins	11
U43576	-	South-east Asia	Humans	12-A-Ins; 75-A-Del; 79-A-Del; 203-T-Del	12

a Geographical region: Bangladesh, Indonesia, South-east Asia; b Humans, orangutans, dog, c SNPs combination was used to decide AT. AT: Allele types, SNP: Single-nucleotide polymorphisms

Subtyping and phylogram analysis

Based on informative SNPs (presence/absence combination) in ITS1 and 5.8S region sequences and integrating GenBank references with our own collected isolates, a total of 12 subtypes/allele types were categorized in our study [Table 2].

A dendrogram was generated using PAUP version 4.0.b10 including 13 of our isolates with 10 GenBank sequences for ITS1 and 5.8S regions [Table 2]. The 13 isolates were divided into five groups; all human isolates were separated into three closely related groups. The branch lengths of the dog isolate and isolates collected from Orangutans (GenBank isolates), from the common node, were much longer than human isolates collected from Bangladesh and Australia. This suggests that either important groups are missing from the analyses or that significant variation occurs among isolates from different hosts, and thus, the pattern of the phylogram in terms of strain differences corresponded to host diversity rather than the geographical distribution. All sequences from isolates in this study have been deposited in GenBank with accession numbers JX489140 to JX489153.

DISCUSSION

The ITS region has been reported to be a reliable diagnostic target for species identification of bacteria,[14] fungi,[15] and both human and animal parasites.[3456] An Iranian study used ITS as a species-specific target for the detection of S. stercoralis in stool,[11] but intraspecies diversity was not discussed. Furthermore, there are only ten S. stercoralis ITS sequences in GenBank, of which only four contain both ITS1 and ITS2. More sequence data, from different geographic regions, are needed to define intra-specific variation in S. stercoralis, to which this study makes a useful contribution. To our knowledge, this is the first comparison of S. stercoralis ITS1 region in isolates collected from three countries, Bangladesh, Australia, and the USA.

The SNPs found in our study in ITS 1 gave some differentiation ability, 12 allele types/subtypes were identified in both ITS1 and 5.8S gene regions (comparing our isolates and GenBank sequences based on ITS1 only) [Figure 2]. The diversity of the isolates observed in the phylogram suggested that S. stercoralis strain heterogeneity remains regardless of the geographic location even when a small number of isolates were studied. The branch lengths among the human isolates show there is little genetic divergence among the human isolates. In contrast, the branch lengths to isolates from orangutans and dogs are longer, and indicative of greater genetic divergence between the human isolates and those collected from other hosts. The evolution and dispersion of human strongyloidiasis was illustrated by the phylogenetic analysis of mitochondrial cytochrome c-oxidase subunit 1 gene (cox 1) gene;[9] this study also highlighted the diversity of Strongyloides spp. strains in different hosts from different geographical regions. Dispersal of S. fuelleborni and S. stercoralis has been addressed with a target to find out the causative agent of strongyloidiasis in a Japanese mammalogist. In the earlier study, interpretation of the constructed phylogenetic tree indicates that distribution of S. stercoralis happened with human migration while spread and diversity of S. fuelleborni occurred with movement of Old World primates through Africa and Asia.[9] Furthermore, maximum-likelihood analysis of S. stercoralis grouped the 10 isolates into dog and primate clades which supports findings in the current study.

Figure 2

Phylogram based on the internal transcribed spacer 1 region and 5.8S partial sequence of 23 strains of Strongyloides stercoralis. Numbers of mutated positions are shown on top of the branches. Bootstrap values above 50 are shown in bold below the branches. Maximum parsimony analysis. PAUP 4.0b10 (Altivec)

Variation in response to treatment as the result of gene mutation was suggested long ago. Gene involvement and association between genetic variation and anthelmintic resistance was also discussed in Caenorhabditis elegans.[16] No data are available on drug efficacy and the genetic differences in Strongyloides spp. However, a study on closely related species was carried out where 96%–99% nuclear diversity in Trichostrongylus and in Haemonchus contortus isolates was explained as drug resistant.[17] Further evidence of resistance to anthelmintic in different strains of Teladorsagia circumcinata isolated from goats shows that drug efficacy was different in different strains of this helminth parasite.[18]

CONCLUSIONS

Comparison of SNP in the ITS1 region of S. stercoralis isolates can provide genetic information on the worm isolate and help to identify whether the infection source is from animal or human. We can identify differences of S. stercoralis based on ITS sequencing even with this limited number of isolates. However, broader studies are required to determine whether sufficient genetic data can be used to identify the source of infection (i.e., human or zoonotic) and whether there is any genetic association to anthelminthic efficacy.

Financial support and sponsorship

Financial support was received from NSW CIDM Public Health Funds and the corresponding author was supported by an Australian AusAID scholarship.

Conflicts of interest

There are no conflicts of interest.