| Literature DB >> 35923229 |
Keila Acevedo-Villanueva1, Gabriel Akerele1, Walid Al-Hakeem1, Daniel Adams1, Renukaradhy Gourapura2, Ramesh Selvaraj1.
Abstract
There is a critical need for an oral-killed Salmonella vaccine for broilers. Chitosan nanoparticle (CNP) vaccines can be used to deliver Salmonella antigens orally. We investigated the efficacy of a killed Salmonella CNP vaccine on broilers. CNP vaccine was synthesized using Salmonella enterica serovar Enteritidis (S. Enteritidis) outer membrane and flagella proteins. CNP was stable at acidic conditions by releasing 14% of proteins at pH 5.5. At 17 h post-incubation, the cumulative protein release for CNP was 75% at pH 7.4. Two hundred microliters of PBS with chicken red blood cells incubated with 20 μg/ml CNP released 0% hemoglobin. Three hundred chicks were allocated into 1) Control, 2) Challenge, 3) Vaccine + Challenge. At d1 of age, chicks were spray-vaccinated with PBS or 40 mg CNP. At d7 of age, chicks were orally-vaccinated with PBS or 20 μg CNP/bird. At d14 of age, birds were orally-challenged with PBS or 1 × 107 CFU/bird of S. Enteritidis. The CNP-vaccinated birds had higher antigen-specific IgY/IgA and lymphocyte-proliferation against flagellin (p < 0.05). At 14 days post-infection, CNP-vaccinated birds reversed the loss in gut permeability by 13% (p < 0.05). At 21 days post-infection, the CNP-vaccinated birds decreased S. Enteritidis in the ceca and spleen by 2 Log10 CFU/g, and in the small intestine by 0.6 Log10 CFU/g (p < 0.05). We conclude that the CNP vaccine is a viable alternative to conventional Salmonella poultry vaccines.Entities:
Keywords: Enteritidis; Salmonella; broilers; nanoparticles; vaccines
Year: 2022 PMID: 35923229 PMCID: PMC9340066 DOI: 10.3389/fphys.2022.920777
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Summary of experimental treatment groups. For all experimental groups, the experimental unit was the pen, n = 6 pen/treatment, with 16 technical replicates as birds/pen. For the gel-spray vaccination, 2 mg of CNP vaccine was reconstituted in 25 ml of Gel-Pac solution and sprayed on 100 chicks. For the mock gel-spray vaccination, PBS (pH 7.4) was added to the Gel-pac stock solution. For the oral gavage booster vaccination, birds in the experimental group were given 20 μg CNP/bird, and birds in the control groups were given 0.5 ml PBS/bird. At d14 of age birds in the negative control group were given a mock challenge of 0.5 ml PBS/bird and birds in the positive control and the treatment group were orally challenged with 1 × 107 CFU/bird of S. Enteritidis (nalidixic acid-resistant).
| Group | 1st Gel-spray vaccination | Oral gavage booster vaccination | Experimental challenge |
|---|---|---|---|
| Control | PBS | PBS | PBS |
| Challenge | PBS | PBS | 1 × 107 CFU/bird |
| Vaccine + Challenge | CNP | CNP | 1 × 107 CFU/bird |
Primers and PCR conditions for RT-PCR.
| Target Gene | Sequence (5’—3′) | Ta (°C) | Reference |
|---|---|---|---|
| IL-1β (F) | TCCTCCAGCCAGAAAGTGA | 57.0 |
|
| IL-1β (R) | CAGGCGGTAGAAGATGAAGC | ||
| IFN-γ (F) | GTGAAGAAGGTGAAAGTATCATGGA | 57.0 |
|
| IFN-γ (R) | GCTTTGCGCTGGATTCTCA | ||
| IL-10 (F) | CATGCTGCTGGGCCTGAA | 57.5 |
|
| IL-10 (R) | CGTCTCCTTGATCTGCTTGATG | ||
| iNOS (F) | AGTGGTATGCTCTGCCTGCT | 60.0 |
|
| iNOS (R) | CCAGTCCCATTCTTCTTCC | ||
| TGF-β (F) | AGGATCTGCAGTGGAGTGGAT | 54.0 |
|
| TGF-β (R) | CCCCGGGTTGTGTTGGT | ||
| IL-6 (F) | CAAGGTGACGGAGGAGGAC | 57.5 |
|
| IL-6 (R) | TGGCGAGGAGGGATTTCT | ||
| TNF-α (F) | ATCCTCACCCCTACCCTGTC | 56.0 |
|
| TNF-α (R) | GGCGGTCATAGAACAGCACT | ||
| IL-17 (F) | GCAGATGCTGGATGCCTAAC | 55.5 |
|
| IL-17 (R) | ATGGAGCCAGTGAGCGTTT | ||
| TLR 4 (F) | ACCTACCCATCGGACACTTG | 60.0 |
|
| TLR 4 (R) | TGCCTGAGAGAGGTCAGGTT | ||
| TLR 5 (F) | CCTTGTGCTTTGAGGAACGAGA | 52.3 |
|
| TLR 5 (R) | CACCCATCTTTGAGAAACTGCC | ||
| K60 (F) | ATTTCCTCCTGCCTCCTACA | 55.0 |
|
| K60 (R) | GTGACTGGCAAAAATGACTCC | ||
| Claudin-1 (F) | TGTAGCCACAGCAAGAGGTG | 55.0 |
|
| Claudin-1 (R) | GACAGCCATCCGCATCTTCT | ||
| Zona Occludens-1 (F) | TGTAGCCACAGCAAGAGGTG | 55.0 |
|
| Zona Occludens-1 (R) | CTGGAATGGCTCCTTGTGGT | ||
| RPS13 (F) | CAAGAAGGCTGTTGCTGTTCG | 55.5 |
|
| RPS13 (R) | GGCAGAAGCTGTCGATGATT |
The pH stability assay and cumulative protein release assay of the synthesized CNP vaccine. The CNP was incubated in 1 × PBS at multiple pH’s for 6 h.
| pH stability of the CNP vaccine | |
|---|---|
|
|
|
| 3.5 | 3 |
| 4.0 | 9 |
| 4.5 | 10 |
| 5.5 | 14 |
| 6.5 | 31 |
| 7.5 | 26 |
The pH stability assay and cumulative protein release assay of the synthesized CNP vaccine. The CNP were incubated in 1 × PBS at 7.4 pH and the cumulative antigen release was assessed at different time points. Means +SD. n = 2.
| Cumulative protein release of the CNP vaccine | |
|---|---|
|
|
|
| 2 | 11 |
| 3 | 14 |
| 10 | 21 |
| 17 | 75 |
Effect of CNP on chicken red blood cells. The CNP was synthesized by entrapping a crude-enriched extract of OMP and Flagellin proteins from Salmonella enterica serovar Enteritidis. Mean ± SD. n = 2.
| cRBCs hemolysis (%) | ||
|---|---|---|
| 20 μg/ml | 50 μg/ml | 100 μg/ml |
| 0.07 ± 0.030 | 0.09 ± 0.007 | 0.94 ± 0.021 |
The GMT of anti-S. Enteritidis OMP IgY and IgA antibodies. Blood, bile, and cloacal swabs samples were collected at d14 of age (pre-challenge) and d35 of age (post-challenge). Samples were analyzed for anti-Salmonella OMP IgY and OMP IgA levels by ELISA (n = 6). Results were reported as geometric mean titers (GMT). Values with no common superscript differ (p < 0.05). The percent increase was determined as [(GMT of Vaccine + Challenge)–(GMT of Control)] ÷ (GMT of Control) × 100.
| OMP | |||||
|---|---|---|---|---|---|
| Sample | Day of age | Treatment group | GMT | % CV |
|
| Serum | d14 | Control | 228b | 69 |
|
| Challenge | 128ab | 79 | |||
| Vaccine + Challenge | 724a | 49 | |||
| d35 | Control | 144 | 20 |
| |
| Challenge | 1448 | 42 | |||
| Vaccine + Challenge | 1290 | 47 | |||
| Bile | d14 | Control | 645c | 82 |
|
| Challenge | 724b | 63 | |||
| Vaccine + Challenge | 4096a | 0 | |||
| d35 | Control | 512b | 59 |
| |
| Challenge | 4096a | 0 | |||
| Vaccine + Challenge | 3250a | 31 | |||
| Cloacal swabs | d14 | Control | 23 | 67 |
|
| Challenge | 51 | 20 | |||
| Vaccine + Challenge | 2298 | 52 | |||
| d35 | Control | 161b | 89 |
| |
| Challenge | 2580a | 49 | |||
| Vaccine + Challenge | 1824a | 68 | |||
The meaning of the symbol for (a, b) in Table is in indicated in the figure legend as “Values with no common superscript differ (p < 0.05).” It indicates the significance of the data.
The GMT of anti-S. Enteritidis Flagellin IgY and IgA antibodies. Blood, bile, and cloacal swabs samples were collected at d14 of age (pre-challenge) and d35 of age (post-challenge). Samples were analyzed for anti-Salmonella Flagellin IgY and Flagellin IgA levels by ELISA (n = 6). Results were reported as geometric mean titers (GMT). Values with no common superscript differ (p < 0.05). The percent increase was determined as [(GMT of Vaccine + Challenge)–(GMT of Control)] ÷ (GMT of Control) × 100.
| Flagellin | |||||
|---|---|---|---|---|---|
| Sample | Day of age | Treatment group | GMT | % CV |
|
| Serum | d14 | Control | 512 | 0 |
|
| Challenge | 181 | 70 | |||
| Vaccine + Challenge | 1024 | 56 | |||
| d35 | Control | 574 | 35 |
| |
| Challenge | 1024 | 59 | |||
| Vaccine + Challenge | 812 | 75 | |||
| Bile | d14 | Control | 456b | 68 |
|
| Challenge | 813 ab | 72 | |||
| Vaccine + Challenge | 1448a | 37 | |||
| d35 | Control | 512b | 0 |
| |
| Challenge | 2047a | 0 | |||
| Vaccine + Challenge | 1824a | 22 | |||
| Cloacal swabs | d14 | Control | 57 | 34 |
|
| Challenge | 18 | 32 | |||
| Vaccine + Challenge | 91 | 30 | |||
| d35 | Control | 80b | 82 |
| |
| Challenge | 813a | 70 | |||
| Vaccine + Challenge | 1448ab | 85 | |||
The meaning of the symbol for (a, b) in Table is in indicated in the figure legend as “Values with no common superscript differ (p < 0.05).” It indicates the significance of the data.
FIGURE 1Ex-vivo recall-response of spleenocytes of vaccinated birds. At d12 of age, splenocytes PBMCs were stimulated with either 20 μg/ml OMP, 20 μg/ml Flagellin or 20 μg/ml proteins of different S. Enterica serovars HKA for 3 days. As a negative control splenocytes were stimulated with 0.0 μg/ml of antigen. As a positive control splenocytes were stimulated with 20 μg/ml Con A. (A) OMP and Flagellin. Bars (+SE) with no common superscript differ (p < 0.05); (B) HKA from S. Enterica serovars. Means + SE Bars. n = 6. “*” signifies p < 0.05.
FIGURE 2Salmonella loads in the ceca, spleen, and small intestines of vaccinated birds. Organ samples were collected from 1 bird per pen (n = 6) at 21 dpi. Samples were analyzed for S. Enteritidis loads by plating. Samples that were double negative for S. Enteritidis presence after selective enrichment were considered negative for Salmonella colonization. Data were recorded as CFU/g of organ and transformed to Log 10 CFU/g of organ for statistical analysis. (A) Ceca; (B) Spleen; (C) Small intestine. Bars (+SE) with no common superscript differ (p < 0.05).
FIGURE 3FITC-d concentration in the serum of vaccinated birds. At d1 of age birds were allocated into treatment groups: 1) Control; 2) Challenge; or 3) Vaccine + Challenge. At d1 and d7 of age birds in the negative and positive control groups were mock vaccinated with PBS and birds in the treatment group were vaccinated with CNP. At d14 of age birds in the negative control group were given a mock challenge of 0.5 ml PBS/bird and birds in the positive control and the treatment group were orally challenged with 1 × 107 CFU/bird of S. Enteritidis. At 14 dpi, one bird per pen was given 2.2 mg FITC-d by oral gavage. After 2 h blood samples were collected. The Optical Density (OD) was measured at 485 nm. Bars (+SE) with no common superscript differ (p < 0.05).
FIGURE 4The Effects of Salmonella CNP Vaccine on Gene Expression in the Cecal Tonsils of Vaccinated Birds at 12 h post-vaccination. At d1 of age birds were allocated into treatment groups: 1) Control; 2) Challenge; or 3) Vaccine + Challenge. At d1 and d7 of age birds in the negative and positive control groups were mock vaccinated with PBS and birds in the treatment group were vaccinated with CNP. At d14 of age birds in the negative control group were given a mock challenge of 0.5 ml PBS/bird and birds in the positive control and the treatment group were orally challenged with 1 × 107 CFU/bird of S. Enteritidis. Cecal tonsils were collected from one bird/pen (n = 6) at 12 h post-vaccination. Data represented as fold change compared to control. (A) TNF-α mRNA; (B) TLR 5 mRNA; (C) IL-6 mRNA. Bars (+SE) with no common superscript differ (p < 0.05).
FIGURE 5The Effects of Salmonella CNP Vaccine on Gene Expression in the Cecal Tonsils of Vaccinated Birds at 12 h post-challenge. At d1 of age birds were allocated into treatment groups: 1) Control; 2) Challenge; or 3) Vaccine + Challenge. At d1 and d7 of age birds in the negative and positive control groups were mock vaccinated with PBS and birds in the treatment group were vaccinated with CNP. At d14 of age birds in the negative control group were given a mock challenge of 0.5 ml PBS/bird and birds in the positive control and the treatment group were orally challenged with 1 × 107 CFU/bird of S. Enteritidis. Cecal tonsils were collected from one bird/pen (n = 6) at 12 h post-challenge. Data represented as fold change compared to control. (A) TNF-α mRNA; (B) IL-17 mRNA; (C) IL-6 mRNA. Bars (+SE) with no common superscript differ (p < 0.05).