Prevalence of bovine tuberculosis and characterization of the members of the Mycobacterium tuberculosis complex from slaughtered cattle in Rwanda.

BACKGROUND: Bovine tuberculosis (bTB) is an endemic disease in Rwanda, but little is known about its prevalence and causative mycobacterial species. The disease causes tremendous losses in livestock and wildlife and remains a significant threat to public health.
MATERIALS AND METHODS: A cross-sectional study employing a systematic random sampling of cattle (n = 300) with the collection of retropharyngeal lymph nodes and tonsils (n = 300) irrespective of granulomatous lesions was carried out in six abattoirs to investigate the prevalence and identify mycobacterial species using culture, acid-fast bacteria staining, polymerase chain reaction, and GeneXpert assay. Individual risk factors and the origin of samples were analysed for association with the prevalence.
FINDINGS: Of the 300 sample pools, six were collected with visible TB-like lesions. Our findings demonstrated the presence of Mycobacterium tuberculosis complex (MTBC) in 1.7% (5/300) of sampled slaughtered cattle. Mycobacterium bovis was isolated from 1.3% (4/300) animals while one case was caused by a rifampicin-resistant (RR) M. tuberculosis. Non-tuberculous mycobacteria were identified in 12.0% (36/300) of the sampled cattle. There were no significant associations between the prevalence and abattoir category, age, sex, and breeds of slaughtered cattle.
CONCLUSIONS: This study is the first in Rwanda to isolate both M. bovis and RR M. tuberculosis in slaughtered cattle indicating that bTB is present in Rwanda with a low prevalence. The isolation of RR M. tuberculosis from cattle indicates possible zooanthroponotic transmission of M. tuberculosis and close human-cattle contact. To protect humans against occupational zoonotic diseases, it is essential to control bTB in cattle and raise the awareness among all occupational groups as well as reinforce biosafety at the farm level and in the abattoirs.

Introduction

Apart from Mycobacterium leprae, the genus Mycobacterium comprises two groups, Mycobacterium tuberculosis complex (MTBC) and non-tuberculous mycobacteria (NTM) also known as atypical mycobacteria or mycobacteria other than tuberculosis (MOTT) [1]. The bovine tuberculosis (bTB) is a mycobacterial disease of cattle, other domestic and wild animals, as well as humans [2-5]. The disease is characterized by granulomatous lesions in affected tissues [2,4,6]. The disease is primarily caused by Mycobacterium bovis [7], however, other members of the MTBC have also been identified in diseased cattle such as M. africanum [8], M. caprae [9-11], M. tuberculosis [12,13] and M. orygis [14]. Mycobacterium tuberculosis infection in cattle has been identified more recently from African countries and is of concern [4,15-17]. These species belong to the MTBC whose members share 99.9% of their genome [18].

In Rwanda, only two studies are available on bTB prevalence including one that reported 0.5% prevalence in slaughtered cattle at société des abattoirs de Nyabugogo (SABAN Nyabugogo) [19]. This study also found that the disease was associated with financial losses related to the condemnation of carcasses which negatively affected the livelihood of small Rwandan farmers [19]. The other was a retrospective study recording TB-like macroscopic lesions at the same abattoir from 2006 to 2010 and reported the prevalence ranging from 1.4% in Kigali city to 11.8% in Eastern Province [20]. In Rwanda, the veterinary services lack the capacity and facility to isolate airborne pathogens. Thus, the control program for bTB relies mostly on monthly reports of gross TB-like lesions from the main private abattoir, SABAN Nyabugogo.

The cattle population in Rwanda was estimated at 1,293,768 in 2018 [21]. Although informal slaughtering of goats, sheep, chicken, and rabbits for family or small bar consumption does occur in Rwanda, it is estimated that 95% of slaughtered cattle are processed by abattoirs. Determining the bTB prevalence and identification of MTBC members is essential to understand the transmission dynamics at the animal-human interface and to design adequate control programs. The objective of this study was therefore to determine the prevalence of bTB and characterize MTBC members in slaughtered cattle in Rwanda as well as to investigate association with individual risk factors and the origin of samples. The findings of this study will contribute to building the bTB database essential for policymakers to establish informed control policies and strategies to mitigate bTB in Rwanda.

Materials and methods

Ethics statement

The authorization to conduct the study was obtained from the research screening and ethical clearance committee of the College of Agriculture, Animal Sciences and Veterinary Medicine, University of Rwanda (Ref: 026/DRIPGS/2017), institutional review board of the College of Medicine and Health Sciences, University of Rwanda (No 006/CMHS IRB/2020), and Animal Ethics Committee of the Faculty of Veterinary Science, University of Pretoria, South Africa (V004/2020). Informed consents were obtained from district officials, managers of abattoirs, and owners of animals at the abattoirs.

Study area

The present study was carried out in six abattoirs in Rwanda. Rwanda is a member of the East African Community (EAC) located in the southern hemisphere, near the equator. Six abattoirs that consented to participate in this study included high throughput abattoirs (n = 4) slaughtering more than 50 cattle daily, and low throughput abattoirs (n = 2), slaughtering 50 or less every day. Three of these abattoirs slaughtered cattle and goats and three specialised in cattle. The location of the six abattoirs is shown in Fig 1.

Fig 1

Map of Rwanda with provinces and districts and red stars show the locations of abattoirs visited in this study.

This map was produced in the ArcGis Desketop 10.1–10.8.2 of the University of Rwanda with concurrent use and Education licence. Spatial data (shapefiles) are freely available from DIVA-GIS. (https://gadm.org/download_country.html and https://diva-gis.org/gdata).

Study design and sample size

A cross-sectional study was carried out from August 2018 through October 2019 to determine the prevalence of bTB and characterize Mycobacterium spp. in cattle slaughtered at abattoirs. The abattoirs that accepted to participate in the study were purposively selected based on their strategic locations in the thirty districts of Rwanda (Fig 1) and their slaughtering capacity. High throughput abattoirs received cattle from different districts. For instance, cattle that were sampled at SABAN abattoir located in Kigali City were from 19 districts including Nyarugenge, and Gasabo (Kigali City), Ngoma, Kirehe, Nyagatare, Gatsibo, Bugesera, and Kayonza (Eastern Province), Gakenke, Burera, Rulindo, and Gicumbi (Northern Province), Rutsiro, Karongi, Ngororero (Western Province), Ruhango, Nyanza, Kamonyi, and Muhanga (Southern Province). Cattle that were sampled at Rugano abattoir located in Kigali City were from four districts including Gasabo, Kicukiro, Nyarugenge (Kigali City), and Rwamagana of Eastern Province. Cattle that were sampled at Kamembe abattoir located in the Western Province, were from eight districts including Gisagara, Huye, Nyaruguru, Ruhango, Nyanza, Nyamagabe (Southern Province), Nyamasheke, and Rusizi (Western Province). Cattle that were sampled at Rubavu abattoir located in the Western Province, were from two districts including Nyabihu, and Rubavu (Western Province).

The sample size was calculated as previously described [22]. Where N is the sample size, a 95% confidence level (z) equivalent to 1.96; P is an expected prevalence (= 0.5%) based on a previous study in cattle in Rwanda [19], and the absolute precision (d = P/2) of 0.25%. According to the formula, the total sample size was supposed to be 291 but it was rounded to 300 cattle to include and respect the systematic sampling of 10 cattle for each of the 30 districts of Rwanda.

Sampling procedure and tissue collection

A systematic random sampling procedure among dairy cattle was adopted, and the strategy was to sample five animals from the same district per day. The movement permit was collected on arrival to record the origin of the animals. The age was determined using dentition as previously described [23]. Animals of two years and above were selected with a preference on dairy except for some low throughput abattoirs that slaughtered mostly young male cattle. Animals were aligned in a crush pen and every fourth animal was selected, individual demographic information (district of origin, age, breed, and sex) recorded, restrained, marked on the head with original paint, and released for resting waiting for slaughter. Upon decapitation, the marked head was inspected, and medial and lateral retropharyngeal lymph nodes and lingual and palatine tonsils were aseptically collected into the same sterile 50 ml tube (pooled) and stored at—20°C until processing.

Culture and detection of acid-fast bacilli (AFB)

Retropharyngeal lymph nodes and tonsils from each sampled animal (n = 300) were decontaminated as previously described [24]. Briefly, tissues were thawed, sliced, grounded in a sterile mortar with sea sand (Glentham Life Sciences, UK). An aliquot of each pool of tissue samples was kept at -20°C. Another aliquot was divided into two 50 ml falcon tubes. The content of one tube was decontaminated by adding an equal volume of 2% hydrochloric acid and the other one with an equal volume of 4% sodium hydroxide for 10 min at room temperature, then centrifuged at 3500 rpm for 10 min. The pellet was neutralized with 25 ml of sterile water centrifuged at 3500 rpm for 10 min [24]. Löwenstein-Jensen (LJ) medium was prepared according to the manufacturer’s guidelines (Becton Dinkson, Franklin lakes, USA). Briefly, 37.3 g of LJ medium were completely dissolved in 600 ml of distilled water containing 12 ml of glycerol by heating. The dissolved LJ solution was then autoclaved at 121°C for 15 min. The homogenised sterile egg content (1000 ml) was added to the cooled LJ solution, then, 7 ml of the mixture was distributed into 14 ml–tubes (slopes) which were immediately inspissated at 85°C for 45 min. The slopes were checked for sterility and stored in the fridge until use. Glycerol was replaced by 4 g of sodium pyruvate (Labkem, Spain) for the preparation of LJ with pyruvate. The pellet that was decontaminated by hydrochloric acid and sodium hydroxide were each inoculated onto duplicate slopes of LJ with glycerol and duplicate slopes of LJ with sodium pyruvate, and then incubated at 37°C for 10 weeks with weekly readings. Cultures were scored positive, negative, or contaminated. When contamination occurred, the original sample was reprocessed and reinoculated. Any suspected growth was tested for AFB using auramine O staining and fluorescence microscope as previously described [25]. All manipulations of samples including processing, inoculation, and DNA extraction were performed in the biosafety level three at National Reference Laboratory (NRL), Kigali, Rwanda.

Molecular assays

DNA extraction

Lysate DNA was extracted from each AFB culture isolate as previously described [26]. Briefly, two loopful bacterial cells were suspended in 300 μl of distilled sterile water, then boiled at 95°C for 25 min, quickly cooled, and stored at—20°C until required. Genomic DNA was also extracted from inactivated grown cultures using a DNA extraction kit according to the manufacturer’s instructions (Promega, USA).

Conventional PCR

Isolates that were confirmed AFB were screened for the presence of 16S rRNA sequence specific for the genus Mycobacterium and a sequence encoding the MPB 70 antigen which is specific for members of MTBC using specific primers (Mycgen–F and Mycgen-R, TB1-F and TB2-F, respectively) as previously described [27]. PCR assay based on genomic deletions differentiated members of MTBC (refer to as MTBC differential PCR assay) using primers targeting the regions of difference, RD1, RD4 and RD9 as previously described (Table 1) [28]. Mycobacterium tuberculosis 25177 was used as a reference. For all multiplex PCRs, the 15 μl PCR reaction mixture contained 1x MyTaq Red PCR Mix (Bioline, South Africa), 0.2 μM primers, and 2 μl of template DNA. The PCR cycling condition was as follows: initial denaturation at 94°C for 5 min followed by 25 cycles of denaturation at 94°C for 30 sec, annealing at 62°C for 1 min, and extension at 72°C for 1 min and a final extension step at 72°C for 8 min. Primers amplified 1030bp for the genus, 372 bp for the MTBC, 108 bp and 268 bp for M. bovis as well as 108 bp and 235 bp for M. tuberculosis. PCR products were analysed by electrophoresis using a 2% agarose gel stained with red gel nucleic acid stain and fragments were visualized under UV light. The PCR experiments were performed at Rwanda Agriculture and Animal Resources Board, Department of Veterinary Services in the Virology and Molecular Biology sections.

Table 1

Oligonucleotides used to identify Mycobacterium species isolated from slaughtered cattle in Rwanda.

PCRs	Primer name	Nucleotide sequence (5’-----------3’)	Target	Gene or RD presence/ absence	Size (bp)	Tm (°C)	References
Multiplex 1	Mycgen-F	AGA GTT TGA TCC TGG CTC AG	16s rRNA	Gene is present in M. bovis and M. tuberculosis	1030	62	[27]
	Mycgen-R	TGC ACA CAG GCC ACA AGG GA
	TB1-F	GAA CAA TCC GGA GTT GAC AA	MPB 70	Gene is present in M. bovis and M. tuberculosis	372
	TB2-R	AGC ACG CTG TCA ATC ATG TA
Multiplex 2 *	RD1-1	AAGCGGTTGCCGCCGACCGACC		RD1 present in M. bovis and M. tuberculosis	146	62	[29]
	RD1-2	CTGGCTATATTCCTGGGCCCGG
	RD1-3	GAGGCGATCTGGCGGTTTGGGG
	RD4-1	ATG TGC GAG CTG AGC GAT G	Rv 1510	RD4 absent in M. bovis but present in M. tuberculosis	268 RD is absent	62	[28]
	RD4-2	TGT ACT ATG CTG ACC CAT GCG
	RD4-3	AAA GGA GCA CCA TCG TCC AC
	RD9-1	CAA GTT GCC GTT TCG AGC C	Rv 2073	RD9 absent in M. bovis but present M. tuberculosis	108 RD is absent	62	[29]
	RD9-2	CAA TGT TTG TTG CGC TGC
	RD9-3	GCT ACC CTC GAC CAA GTG TT

MPB 70 stands for protein from M. bovis with 0.70 mobility by native polyacrylamide gel electrophoresis at pH 9.4 gel but it is an antigen common to all MTBC, Rv refers to rough morphology and virulent MTBC strain and RD for regions of differences.

GeneXpert/MTB/RIF assay

MTBC isolates characterized by conventional PCR were also tested by GeneXpert/MTB/RIF molecular diagnostic assay following the manufacturer’s instructions (Cepheid, Sunnyvale, USA). GeneXpert/MTB/RIF is a real-time PCR for the detection of MTBC and rifampin resistance. Briefly, 0.5 ml of the cell suspension was transferred into a conical-screwed tube and 1 ml of sample reagent was added. The mixture was vortexed for 10 sec and incubated for 15 min with vortexing for 10 sec after 8 min of incubation. The liquefied sample was then dispensed into the sample chamber of the cartridge containing five probes (A-E), integrated reagents tubes, a sample processing control, and a probe check control. Cartridges were then loaded into the GeneXpert Dx system version 4.8 (Cepheid, Sunnyvale, USA) and the amplification was run for two hours by activating the software installed in the computer. This assay was performed at NRL, Kigali, Rwanda.

Data analysis

Data were recorded in the Microsoft Excel spreadsheet and descriptive and inferential statistics were performed using EpiInfo software version 7.2. The significance level of 95% and P-value less or equal to 5% were considered for all analyses. The prevalence of isolation of Mycobacterium and MTBC was tested for association with individual animal characteristics such as age, sex, breed, and sampled abattoir in the univariate logistic analysis using Chi-square or Fischer exact.

Results

Out of the 300 sample pools collected from 300 cattle, 94.0% (282/300) were collected from the high throughput abattoirs while 6.0% (18/300) were from the low throughput abattoirs. Of the 300 sample pools, 95.3% (286, 95% CI: 92.3–97.4) were collected from female cattle while 4.7% (14, 95%CI: 2.6–7.7) were from male cattle. The majority of 90.3% (271/300, 95% CI: 86.4–93.4) were from adult (3 years and above) cattle while 9.7% (29/300, 95% CI: 6.6–13.6) were collected from young animals. Most sample pools, 67.9% (203/300, 95% CI: 62.3–73.2) were collected from crossbreeds, 25.8% (77/300, 95%CI: 20.9–31.1) were collected from local breed “Ankole”, while 6.7% (20/300, 95%CI: 3.8–9.5) were collected from a pure breed “Friesian”.

Of the 300 sample pools, six were collected with visible TB-like lesions including three sample pools with enlargement of all lymph nodes and one sample pool with granulomatous lesions in lungs. Other two sample pools had a mucoid pus in the popliteal lymph nodes. Of the 300 sample pools that were inoculated, 55.0% (165, 95% CI: 49.2–60.7) had bacterial growth of which 30.9% (51/165, 95% CI: 23.9–40.0) were AFB as indicated by the auramine fluorescence staining method. Of the 51 AFB, the PCR identified 80.4% (41/51, 95% CI: 69.5–91.3) as Mycobacterium spp. (amplification of 1030 bp fragment, Table 1). Of the 41 Mycobacterium spp., 87.8% (36/41, 95%CI: 77.8–97.8) were NTM, while the remaining 12.2% (5/41, 95% CI: 2.2–22.2) were MTBC (amplification of a 372 bp fragment, Table 1). MTBC differential PCR assay identified 80.0% (4/5, 95% CI: 44.9–100.0) as M. bovis (amplification of 108 bp, 146 bp, and 268 bp) and 20.0% (1/5, 95% CI: 0.0–55.1) as M. tuberculosis (amplification of 146 bp, 172 bp, 235 bp, 369 bp) (Fig 2). Overall, NTM were identified in 12.0% (36/300, 95%CI: 8.3–15.7) of the sampled cattle, MTBC were isolated in 1.7% (5/300) of the sampled cattle and among these, four were M. bovis, while one was M. tuberculosis. The GeneXpert MTBC/RIF assay confirmed MTBC isolates. Resistance to rifampicin (RR) was detected in one isolate, but such RR was not confirmed by GeneXpert testing of the original sample pool due to very low bacterial load.

Fig 2

Agarose gel electrophoresis of the Mycobacterium tuberculosis complex differential PCR assay.

Lane M: GeneRuler 100 bp (Invitrogen, Thermo Fischer Scientific, South Africa), lanes 1–4: Non-tuberculosis mycobacteria (NTM) which amplified 1030 bp; lane 5: M. tuberculosis which amplified 1030 bp, 372 bp, 235 bp, 172 bp, and 146 bp; lanes 6–9: M. bovis which amplified 1030 bp, 372 bp, 146 bp, and 108 bp; lane 10: sterile ultrapure water used as negative control; lane 11: M. tuberculosis reference strain 2517.

Among the six sample pools that were collected with visible TB-like lesions, only one was confirmed as M. bovis, another one was NTM, while the remaining four were not identified as Mycobacterium spp.

Mycobacterium spp. isolates were found in 83.3% (5/6) of the abattoirs; 80.9% (38/47) in high throughput abattoirs and 75.0 (3/4) in low throughput abattoirs, although the difference was not significant (Table 2). All the MTBC isolates were found in the high throughput abattoirs. MTBC were isolated in cattle from Nyarugenge district (n = 1) of Kigali city, Karongi (n = 1), Nyabihu (n = 1), and Rubavu (n = 2) districts of the Western Province. All five MTBC isolates were identified from adult and crossbred cattle (Table 2).

Table 2

Mycobacterial culture results for 300 slaughtered cattle and PCR results of acid-fast bacilli isolates stratified by the abattoir, age, breed, and sex of slaughtered cattle in Rwanda.

Variables	Categories	Mycobacterial culture and AFB results		PCR results of AFB isolates for detection of Mycobacterium spp.				PCR results of AFB isolates for detection of Mycobacterium tuberculosis complex (MTBC)
		Growth % (n)	AFB positive	Positive % (n)	95% CI	Chi 2	p-value	Positive n (%)	95% CI	Chi 2	p-value
Abattoirs	High throughput	53.9 (152/282)	16.7 (47/282)	80.9 (38/47)	0.3–4.8	0.80	1.0	10.6 (5/47)	0.0–16.3	0.00	1.00
	Low throughput	72.2 (13/18)	22.2 (4/18)	75.0 (3/4)				0.0 (0/4)
	Total	55.0 (165/300)	17.0 (51/300)	80.4 (41/51)				9.8 (5/51)
Provinces	East	55.7 (39/70)	17.1 (12/70)	83.3 (10/12)	-	1.60	0.9	0.0 (0/12)	-	10.20	0.04
	West	62.7 (44/70)	25.7 (18/70)	72.2 (13/18)				22.2 (4/18)
	North	56.0 (28/50)	16.0 (8/50)	87.5 (7/8)				0.0 (0/8)
	South	45.0 (36/80)	13.8 (11/80)	81.8 (9/11)				0.0 (0/11)
	Kigali city	60.0 (18/30)	6.7 (2/30)	100.0 (2/2)				50.0 (1/2)
	Total	55.0 (165/300)	17.0 (51/300)	80.4 (41/51)				9.8 (5/51)
Age	Young	65.5 (19/29)	20.7 (6/29)	50.0 (3/6)	0.2–1.7	2.10	0.1	0.0 (0/6)	0.0–9.3	0.02	1.00
	Adult	53.8 (146/271)	16.6 (45/271)	84.4 (38/45)				11.1 (5/45)
	Total	55.0 (165/300)	17.0 (51/300)	80.4 (41/51)				9.8 (5/51)
Sex	Female	55.6 (159/286)	16.8 (48/286)	79.2 (38/48)	-	0.01	1.0	8.3 (4/48)	0.4–74.8	0.20	0.30
	Male	42.9 (6/14)	21.4 (3/14)	100.0 (3/3)				33.3 (1/3)
	Total	55.0 (165/300)	17.0 (51/300)	80.4 (41/51)				9.8 (5/51)
Breeds	Ankole	54.5 (42/47)	13.0 (10/77)	80.0 (8/10)	-	0.80	1.0	0.0 (0/10)	-	1.90	0.70
	Crossbred	56.2 (114/208)	18.7 (38/203)	79.0 (30/38)				13.2 (5/38)
	Friesians	42.1 (8/19)	15.0 (3/20)	100.0 (3/3)				0.0 (0/3)
	Total	55.0 (165/300)	17.0 (51/300)	80.4 (41/51)				9.8 (5/51)

Discussion

Bovine tuberculosis (bTB) causes financial losses in livestock and remains a significant threat to public health worldwide [30,31]. This study aimed to determine the prevalence of bTB and identify Mycobacterium species in slaughtered cattle using bacterial culture and PCR assay. Although the prevalence of bTB was low, the identification of M. tuberculosis with rifampicin resistance in cattle indicates the close contact between humans and cattle suggesting transmission of M. tuberculosis from humans to cattle. The identification of M. bovis in cattle suggests that farmworkers and abattoir workers can be diagnosed with zoonotic TB.

Considering the moderate sample size (n = 300) and the random selection of animals found without visible lesions (96.7%), the prevalence observed for MTBC in this study (1.7%) is higher than 0.5% reported at SABAN Nyabugogo abattoir, Rwanda [19] which was based on 36 samples from gross bTB-like lesions. However, considering that samples were collected at a single point in time and the small sample size (n = 10) per district, the prevalence in this study is likely to be lower than the true prevalence in slaughtered cattle in Rwanda. The prevalence (1.7%) obtained in this study is consistent with 2.1% obtained in Kenya using bovine TB-like lesions, AFB staining, bacterial culture, and PCR [32] but lower compared to 7.6% obtained in Uganda using bovine TB-like lesions, bacterial culture, AFB staining, and capillia TB-neo assay for detection of MPT 64 antigens of the MTBC [33]. The prevalence obtained in this study also falls in the range of bTB herd prevalence (0.2 to 13.2%) reported in cattle in Tanzania [34]. These findings confirm that bTB is present in cattle of the East African region and the disease remains a transboundary disease through animal trading and animal movement across porous borders [35].

This study demonstrated that bTB is most probably endemic in Rwandan cattle but at low prevalence since sample pools were collected from cattle slaughtered in the six abattoirs of which four high throughput abattoirs received cattle from several districts including those from more than 90 km. However, as mentioned in materials and methods section, only ten sample pools were collected from each of the 30 districts while MTBC isolates were detected in animals from three districts. We, therefore, recommend a longitudinal study considering a larger sample size per district.

This study identified for the first time M. bovis and M. tuberculosis in slaughtered cattle in Rwanda. Similar studies in Africa isolated M. bovis and M. tuberculosis in slaughtered cattle in Kenya [32], in Cameroon [36]. However, the prevalence of M. tuberculosis in cattle is commonly below 1.0% [32,36,37], apart from some areas (27.0%) in Ethiopia where cattle owners had the habit of chewing tobacco into the mouth of their cattle [38]. The prevalence of M. tuberculosis is also high in areas with a high prevalence of TB in humans owning cattle [39]. For example, a study in the Eastern Cape province, South Africa, identified more M. tuberculosis (41.8%, 157/376) than M. bovis (1.3%, 5/376) from slaughtered cattle [40]. Mycobacterium tuberculosis (n = 1) that was isolated in this study was resistant to Rifampicin which is a cornerstone antibiotic of the first-line regimen [41]. Resistance to rifampicin (RR) is considered multidrug resistance tuberculosis (MDR-TB) [42] and has been reported in Rwandans with TB [43] suggesting that RR M. tuberculosis was of human origin. The transmission of RR M. tuberculosis from humans to cattle was not surprising since 92.0% of Rwandans owning cattle are small dairy farmers practicing a zero-grazing system [44] which may promote close animal-human contact with the risk of cross-infection from humans to cattle and vice-versa [45]. Cattle can be considered sentinels for M. tuberculosis in settings where TB is not effectively controlled in humans. It is therefore also an alert for improved TB control in humans in rural settings.

Despite the little attention given to the zoonotic TB caused by M. bovis [46], several studies have isolated M. bovis in extrapulmonary lymph nodes of humans in neighbouring Uganda [47], and Tanzania [48]. It is hence essential to raise awareness among veterinary and human health professionals about the zooanthroponotic and anthropozoonotic transmission of TB in Rwanda. Further studies on the identification of M. bovis in occupational groups are worth investigating in Rwanda to provide epidemiological data that are indispensable for the eradication of tuberculosis by 2035 [49].

The prevalence of NTM (12.0%) in this study is consistent with 8.4% obtained in Uganda [33] but higher than 3.9% in Tanzania [13]. This study considered the presence of NTM in the environment, hence, tissues were aseptically (changing gloves and sterilization of the knife into hot water) collected, stored, and processed, thus, it can be assumed that the identified NTM were recovered from the tissues of animals, but it does not prove any pathological effect, it merely demonstrates colonization. Since these NTM were not speciated, it would be important to determine their potential significance for the health of the cattle. NTM have been isolated in cattle and sometimes cause localized lymphadenitis, skin infections, TB-like pulmonary infections, and systemic diseases in immunodeficient cattle [50]. The presence of NTM in cattle may interfere with immune-diagnostic methods such as comparative tuberculin test and may negatively impact vaccination [51].

In this study, among the six sample pools with tuberculosis-like lesions, only one popliteal lymph node was associated with NTM species, and one lung was associated with M. bovis. However, a retrospective study reported the prevalence of 11.8% based on TB-like lesions recorded during routine meat inspection from 2006 to 2010 at SABAN Nyabugogo abattoir, Rwanda [20]. TB-like lesions might therefore be a poor reflection of bTB in the absence of a confirmatory laboratory test. TB-like lesions from routine meat inspection should, therefore, be confirmed by laboratory tests to obtain accurate results essential for surveillance of bTB, but also improve the knowledge of inspectors.

Mycobacterium spp. isolates were more frequently isolated in adult than in young cattle and all MTBC were isolated from adult cattle consistent with a study in Ethiopia [52]. The isolation of M. bovis depends a lot on the dose and frequency of exposure, therefore, higher infection rates in adult cattle result from a cumulative risk of infection. In other words, the older an animal the more opportunities it had to contract M. bovis. Furthermore, the literature states that young cattle are less susceptible to mycobacteria owing to the high concentration of T cells in the blood circulation and T cells play a role in the immunity against mycobacteria [53].

Conclusions

This study demonstrated that bTB is present in Rwanda at low prevalence. The present study reports for the first time MTBC in cattle in Rwanda and the presence of RR M. tuberculosis indicating possible cross-infection between humans and cattle. There is therefore a need for raising awareness among veterinary and human health professionals about the zooanthroponotic transmission and cross infection of TB in Rwanda. Further studies on the identification of M. bovis in humans are worth investigating to provide epidemiological data that are indispensable for the eradication of tuberculosis by 2035, a global movement led by the World Health Organization.

Raw data.

Excel file.

(XLSX)

Click here for additional data file.

14 Mar 2022

Dear Dr. Ntivuguruzwa,

Thank you very much for submitting your manuscript "Prevalence of bovine tuberculosis and characterization of the members of the Mycobacterium tuberculosis complex from slaughtered cattle in Rwanda" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Subash Babu

Associate Editor

PLOS Neglected Tropical Diseases

Ana LTO Nascimento

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: The research study was well introduced and sufficient. The aim and objectives were also well presented and to the point. The authors demonstrated knowledge and understanding of the nature and purpose of the subject matter. Sample size and analysis of the analysis for the purpose of the study were determined statistically. Necessary ethical clearance was obtained before the study was commenced.

Reviewer #2: It will be essential to have an additional confirmation test for the diagnosed NTMs. (any other existing biochemical or microbiological confirmation, other than culture and AFB staining, can be done to substantiate their findings, other than this PCR method.

This is essential for the validity for their results.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Results obtained were statistically analyzed and have been presented in ways that are clear, logical and appropriate for the purpose. However, special attention needs to be given to the gel electrophoresis picture (Figure 1). Some lanes are missing (labelling) hence affecting the correctness of the information provided in the figure legend.

Reviewer #2: The gel picture in the results section does not have the lane 4 mentioned, as NTM and hence request them to provide the corrected gel picture, with proper labeling. many mistakes in the labeling and legends needs to corrected. Negative control lane has bands, hence negative for what?

Why not the WGS approach for the isolated strains carried out.

additional information with reference to the lineages can be added for more authenticity of the data.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: The study is first to confirm Mycobacterium bovis, Mycobacterium tuberculosis and non-tuberculous mycobacteria in Rwanda. Additional interesting finding from the study was that not all TB-like lesions observed resulted in the isolation of Mycobacterium species, highlighting the importance of laboratory confirmation of the causative agent to obtain accurate diagnosis. Considering the moderate sample size analyzed, authors’ recommended future longitudinal studies which will consider a good sample size per district in that country. It will also be worthwhile to genotype MTBC identified to determine the genetic diversity of the strains circulating in Rwanda for epidemiological studies. The study found presence of Rifampicin resistant M. tuberculosis indicating possible cross-infection between humans and cattle. Authors highlighted a need for raising awareness among veterinary and human health professionals about the zooanthroponotic transmission and cross infection of TB in Rwanda.

Reviewer #2: This study will become valid with their additional experiments to prove the NTMs and M.bovis. It will also good for the authors to mention about the implications of the study carried out in the discussion, emphasizing how this will be helpful for the animal husbandry and zoonosis transmission besides prevalence.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Additional comments are highlighted in the attachment.

Reviewer #2: Gel picture needs extensive revision, may be relabeling or a new gel picture required .

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This work aimed to determine the prevalence of bovine tuberculosis and distinguish amongst members of the Mycobacterium tuberculosis complex (MTBC) species. The study is first to confirm Mycobacterium bovis, Mycobacterium tuberculosis and non-tuberculous mycobacteria in Rwanda. Additional interesting finding from the study was that not all TB-like lesions observed resulted in the isolation of Mycobacterium species, highlighting the importance of laboratory confirmation of the causative agent to obtain accurate diagnosis. Considering the moderate sample size analyzed, authors’ recommended future longitudinal studies which will consider a good sample size per district in that country. It will also be worthwhile to genotype MTBC identified to determine the genetic diversity of the strains circulating in Rwanda for epidemiological studies.

Reviewer #2: This study involves identification of MTBC members to understand transmission dynamics among animal-human interface and to design adequate control programs to prevent the same.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

Submitted filename: 25.11.2021 (Comments to authors).docx

Click here for additional data file.

28 May 2022

Submitted filename: response to reviewers - 2-.docx

Click here for additional data file.

22 Jun 2022

Dear Dr. Ntivuguruzwa,

Thank you very much for submitting your manuscript "Prevalence of bovine tuberculosis and characterization of the members of the Mycobacterium tuberculosis complex from slaughtered cattle in Rwanda" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Subash Babu

Associate Editor

PLOS Neglected Tropical Diseases

Ana LTO Nascimento

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Overall, the manuscript is well written and scientifically sound. The aim and objectives are clearly articulated and to the point. Well known statistical methods were used to determine the sample size and results analysis. The study was approved by relevant ethics committees.

Reviewer #2: (No Response)

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Overall, results were presented well. However, minor additions/clarity is needed in table 1 and figure 1.

Reviewer #2: The essential changes in the gel picture have been carried out and the response to the queries has been carried out satisfactorily.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: (No Response)

Reviewer #2: (No Response)

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: This is a cross sectional study that utilized a systematic sampling of cattle as well as mycobacterial species culture and molecular based techniques to determine the prevalence of bovine tuberculosis and characterize members of the isolated Mycobacterium tuberculosis complex (MTBC). The manuscript was well written and it is scientifically sound.

Comments:-

Introduction

Line 65…. It will be worthwhile to mention other members of the MTBC that cause bovine tuberculosis besides M. bovis and M. caprae before mentioning that M. tuberculosis infection in cattle has been identified more recently in African countries….

Conventional PCR

Line 179-180…Authors should also mention the fragment sizes expected for the identification of M. tuberculosis….

GeneXpert MTB/RIF assay

Line 192-193… Cartridges were ‘installed’ into the Gene Xpert DX system… Please replace ‘installed’ with ‘loaded’….

Table 1

Authors should make is clear which target gene sequence is present/absent in which mycobacterium species (i.e. RD4 is absent in M. bovis but present in M. tuberculosis etc…)

Figure 2

Line 250… Authors should please indicate what was used as a negative control for quality control purposes.

Discussion

Line 162.. Remove ‘Therefore’ at the beginning of the sentence as this point does not relate to the previous one.

Reviewer #2: Data has been represented in a better manner

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Indicated in the section above.

Reviewer #2: Can be considered for publication

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Ramalingam Bethunaickan

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice.

25 Jun 2022

Submitted filename: Response to reviewers - June.docx

Click here for additional data file.

8 Jul 2022

Dear Dr.  Ntivuguruzwa ,

We are pleased to inform you that your manuscript 'Prevalence of bovine tuberculosis and characterization of the members of the Mycobacterium tuberculosis complex from slaughtered cattle in Rwanda' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Subash Babu

Associate Editor

PLOS Neglected Tropical Diseases

Ana LTO Nascimento

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Yes.

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Yes.

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Yes.

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Accept.

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: Authors satisfactorily responded to all comments made.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

30 Jul 2022

Dear Dr Ntivuguruzwa,

We are delighted to inform you that your manuscript, " Prevalence of bovine tuberculosis and characterization of the members of the Mycobacterium tuberculosis complex from slaughtered cattle in Rwanda ," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases