| Literature DB >> 35915120 |
Hae-June Lee1, Joong-Sun Kim2, Changjong Moon2, Yeonghoon Son3.
Abstract
Although the brain is exposed to cranial irradiation in many clinical contexts, including malignant brain tumor therapy, such exposure can cause delayed neuropsychiatric disorders in the chronic phase. However, how specific molecular mechanisms are associated with irradiation-induced behavioral dysfunction, especially anxiety-like behaviors, is unclear. In the present study, we evaluated anxiety-like behaviors in adult C57BL/6 mice using the open-field (OF) and elevated plus maze (EPM) tests 3 months following single cranial irradiation (10 Gy). Additionally, by using RNA sequencing (RNA-seq), we analyzed gene expression profiles in the cortex and hippocampus of the adult brain to demonstrate the molecular mechanisms of radiation-induced brain dysfunction. In the OF and EPM tests, mice treated with radiation exhibited increased anxiety-like behaviors in the chronic phase. Gene expression analysis by RNA-seq revealed 89 and 106 differentially expressed genes in the cortex and hippocampus, respectively, following cranial irradiation. Subsequently, ClueGO and STRING analyses clustered these genes in pathways related to protein kinase activity, circadian behavior, and cell differentiation. Based on our expression analysis, we suggest that behavioral dysfunction following cranial irradiation is associated with altered expression of Cdkn1a, Ciart, Fos, Hspa5, Hspb1 and Klf10. These novel findings may provide potential genetic targets to investigate for the development of radioprotective agents.Entities:
Mesh:
Year: 2022 PMID: 35915120 PMCID: PMC9343641 DOI: 10.1038/s41598-022-17310-z
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.996
Figure 1Anxiety-related behavior during the chronic phase following cranial irradiation. (A) Schematic diagram of our experimental procedure. (B) Representative tracking of mouse movement during the open-field (OF) test. (C) Representative tracking of mouse movement during the elevated plus maze (EPM) test. (D) The time spent in the center, % distance traveled from the center, total distance traveled, and number of entries in the OF apparatus were assessed in sham-irradiated (Con) and 10 Gy-irradiated (IR) mice. (E) The time spent in the open arm, % distance traveled in the open arm, total distance traveled, and number of entries in the EPM test were assessed in the Con and IR groups. Data are expressed as the mean ± SE (n = 10 per group). *p < 0.05 and **p < 0.01 vs. the Con group.
Figure 2Gene ontology (GO) analysis of RNA-seq screening data. (A) Venn diagram of differentially expressed genes (DEGs) in the cortex and hippocampus between sham-irradiated (Con) and 10 Gy-irradiated (IR) mice. (B,C) ClueGO network analysis of enriched categories in the cortex and/or hippocampus after cranial irradiation. GO terms describing molecular interactions among targets are represented as nodes, and node size represents the term's enrichment significance.
Gene Ontology (GO) terms of genes enriched by CuleGO analysis.
| Process | Term ID | Term name | No. of Genes | Associated genes found |
|---|---|---|---|---|
| Cell cycle | GO:2000134 | Negative regulation of G1/S transition of mitotic cell cycle | 3 | Cdkn1a, Klf4, Plk3 |
| Angiogenesis | GO:0016525 | Negative regulation of angiogenesis | 6 | Cd59a, Gadd45a, Gm20498, Klf2, Klf4, Thbs4 |
| Spliceosome | GO:0071005 | U2-type precatalytic Spliceosome | 3 | Cwc27, Lsm5, Lsm8 |
| Response to radiation | GO:0071479 | Cellular response to Ionizing radiation | 4 | Cdkn1a, Egr1, Gadd45a, Hspa5 |
| Transport | GO:0089718 | Amino acid import Across plasma membrane | 3 | Ntsr1, Per2, Slc6a13 |
| Metabolic process | GO:1901800 | Positive regulation of proteasomal protein catabolic process | 6 | Hspa1b, Klhl40, Nupr1, Plk3, Trib1, Trib2 |
| Hormone metabolic process | GO:0046886 GO:0050810 | Positive regulation of hormone biosynthetic process regulation of steroid biosynthetic process | 3 4 | Bmp6, Egr1, Gh Bmp6, Egr1, Gh, Nr1d1 |
| Response to steroid hormone | GO:0051384 GO:0051412 | Response to glucocorticoid Response to corticosterone | 8 4 | Bmp6, Cdkn1a, Crh, Dusp1, Fos, Fosb, Ptgds, Sstr2 Cdkn1a, Crh, Fos, Fosb |
| Protein folding | GO:0061077 GO:0051085 | Chaperone-mediated protein folding Chaperone cofactor-Dependent protein refolding | 6 4 | Dnajb5, Hspa1b, Hspa5, Hspb1, Pdia4, Sdf2l1 Dnajb5, Hspa1b, Hspa5, Sdf2l1 |
| Steroid hormone secretion | GO:0032370 GO:0035930 GO:2000848 | Positive regulation of Lipid transport Corticosteroid hormone secretion Positive regulation of corticosteroid hormone secretion | 4 3 3 | Bmp6, Crh, Ecrg4, Ntsr1 Bmp6, Crh, Ecrg4 Bmp6, Crh, Ecrg4 |
| Cell differentiation | GO:0014812 GO:0032642 GO:0014910 GO:0002763 GO:0042531 | Muscle cell migration regulation of Chemokine production Regulation of smooth muscle cell migration Positive regulation of myeloid leukocyte differentiation Positive regulation of tyrosine phosphorylation of STAT protein | 6 4 4 5 3 | Ccl5, Ccn3, Egr1, Nr4a3, Thbs4, Trib1 Ccl5, Csf1r, Egr1, Klf4 Ccl5, Egr1, Nr4a3, Trib1 Ccl5, Csf1r, Fos, Klf10, Trib1 Ccl5, Csf1r, Gh |
| Behavior | GO:0042752 GO:0050795 GO:0048512 GO:0042745 GO:0042749 GO:0004879 | Regulation of circadian rhythm Regulation of behavior Circadian behavior Circadian sleep/wake cycle Regulation of circadian Sleep/wake cycle Nuclear receptor activity | 6 5 5 3 3 3 | Cort, Klf10, Nr1d1, Per2, Ptgds, Sik1 Cort, Crh, Nr1d1, Nr4a3, Ptgds Ciart, Cort, Egr1, Nr1d1, Ptgds Cort, Nr1d1, Ptgds Cort, Nr1d1, Ptgds Nr1d1, Nr4a1, Nr4a3 |
| Kinase activity | GO:0033549 GO:0007492 GO:0004860 GO:0006469 GO:0043407 GO:0071901 | MAP kinase Phosphatase activity Endoderm development Protein kinase inhibitor activity Negative regulation of Protein kinase activity Negative regulation of MAP kinase activity Negative regulation of Protein serine/threonine kinase activity | 4 4 5 11 5 7 | Dusp1, Dusp4, Dusp5, Dusp6 Arc, Dusp1, Dusp4, Dusp5 Cdkn1a, Hspb1, Spry4, Trib1, Trib2 Cdkn1a, Dusp1, Dusp4, Dusp5, Dusp6, Gadd45a, Hspb1, Shb, Spry4, Trib1, Trib2 Dusp1, Dusp4, Dusp5, Dusp6, Spry4 Cdkn1a, Dusp1, Dusp4, Dusp5, Dusp6, Gadd45a, Spry4 |
Figure 3STRING network and enrichment analyses. (A) STRING analysis of 181 differentially expressed genes (DEGs) obtained upon RNA-seq analysis of the cortex and hippocampus between sham-irradiated (Con) and 10 Gy-irradiated (IR) mice. (B) The top 10 Gene Ontology (GO) biological processes that were functionally enriched in genes in the network were selected in order of highest strength with an FDR < 0.05.
Genes selected for validation by qRT-PCR.
| Gene symbol | Fold change (Cortex) | Fold change (Hippocampus) | NCBI sequence | Primer pair | Length (bp) |
|---|---|---|---|---|---|
| Bmp6 | 0.814 | 0.639** | NM_007556.3 | F: CAGACTACAACGGCAGTGAG R: CCTTTGGGTGCAATGATCCA | 103 |
| Ccl5 | 3.974 | 0.035* | NM_013653.3 | F: TGCCCACGTCAAGGAGTATT R: ACTTCTTCTCTGGGTTGGCA | 107 |
| Cdkn1a | 2.460*** | 2.913*** | NM_007669.5 | F: AAGTGTGCCGTTGTCTCTTC R: CGAAGTCAAAGTTCCACCGT | 114 |
| Ciart | 0.517*** | 0.647** | NM_001033302.2 | F: GCCACAGTTTGCCAGTAACA R: GGCTCTGGGTGTCCTTTAGT | 103 |
| Crh | 1.555** | 1.037 | NM_205769.3 | F: CCGCAGCCCTTGAATTTCTT R: AGCGGGACTTCTGTTGAGAT | 114 |
| Csf1r | 0.583*** | 0.537*** | NM_001037859.2 | F: CCTACCGTTGTACCGAGCTT R: CTCCTGTGCCAGCAAATTCC | 101 |
| Dnajb5 | 1.602*** | 1.117 | NM_001355438.1 | F: TGAGTGACCCTAAGAAGCGG R: AAGGAAGCAAAGGTGGCATG | 139 |
| Dusp1 | 1.529*** | 1.124 | NM_013642.3 | F: TCTCCCCGAACTTCAGCTTC R: CTGTGGTAGTAGAGGTGCCC | 129 |
| Dusp4 | 1.742*** | 0.991 | NM_176933.4 | F: GCTCTAAAACCAAGGCCCTG R: CGAGGTAGAGGAAAGGGAGG | 144 |
| Dusp6 | 1.777*** | 1.150 | NM_026268.3 | F: AACCTGTCCATGAACGATGC R: TCCTTTCGAAGTCAAGCAGC | 100 |
| Ecrg4 | 4.054*** | 1.351* | NM_024283.3 | F: GCAGTTCCTCTACATGGGCT R: CCAATGGCCGCATCTTCATC | 135 |
| Egr1 | 2.106*** | 1.104 | NM_007913.5 | F: ATGAGAAGGCGATGGTGGAG R: CTCACGAGGCCACTGACTAG | 154 |
| Fos | 2.348*** | 1.730*** | NM_010234.2 | F: GGGCTGCACTACTTACACGT R: TGCCTTGCCTTCTCTGACTG | 169 |
| Fosb | 1.923*** | 0.990 | NM_008036.2 | F: AACCAGCTACTCAACCCCAG R: CTTCTCGGGGTCTTCTAGGC | 140 |
| Gadd45a | 1.566** | 1.078 | NM_007836.1 | F: CATTTCACCCTCATCCGTGC R: TCGTTCTCCAGTAGCAGCAG | 101 |
| Hspa1b | 1.715*** | 1.324** | NM_010478.2 | F: GGACATCAGCCAGAACAAGC R: TGTGTAGAAGTCGATGCCCT | 133 |
| Hspa5 | 1.582*** | 1.512*** | NM_001163434.1 | F: TCCTTGTGTTTGACCTGGGT R: TCAAAGTCTTCCCCACCCAG | 118 |
| Hspb1 | 1.472** | 1.911*** | NM_013560.2 | F: ACTGGCAAGCACGAAGAAAG R: AGGGAAGAGGACACTAGGGT | 110 |
| Klf10 | 1.582*** | 1.252** | NM_001289471.1 | F: GTCACATCTGTAGCCACCCA R: CCTTTCACAGCCTTTCCAGC | 122 |
| Klhl40 | 0.645*** | 0.771 | NM_028202.3 | F: CTACTGTGCATCCCTGTCCA R: GGTCCTCCTTGTTGTCCTCA | 116 |
| Nov | 0.782** | 0.602*** | NM_010930.5 | F: GAGATGAGACCCTGTGACCA R: TCAAACTTCTCTCCGTTGCG | 143 |
| Nr1d1 | 0.659*** | 0.875 | NM_145434.4 | F: TTTGCCAAACACATCCCAGG R: TGTCTGGTCCTTCACGTTGA | 126 |
| Nr4a1 | 2.108*** | 1.068 | NM_010444.2 | F: CTCTGGTTCCCTGGACGTTA R: CAGGAAGGCAGACTCTAGCA | 103 |
| Nr4a3 | 1.956*** | 1.087 | NM_015743.3 | F: CGTCTGCCTTCCAAACCAAA R: TCTCTGGGTGTTGCATCTGT | 122 |
| Nupr1 | 1.502** | 1.454 | NM_019738.1 | F: CCCTTCCCAGCAACCTCTAA R: AGCTTCTCTCTTGGTCCGAC | 124 |
| Pdia4 | 1.591*** | 1.359*** | NM_001368756.1 | F: GTCTCTGGCTACCCGACTTT R: GCCCAGACTGCTCAATCATG | 109 |
| Per2 | 1.736*** | 1.116 | NM_011066.3 | F: CCGTGTCAGTGTTGGGAAAC R: CATAGCCCGAGTGTACCCTC | 149 |
| Ptgds | 0.839* | 1.559*** | NM_008963.3 | F: CCTTGCTTTGTCCACATTGC R: AATCCCAAGAGACCCAGGAG | 113 |
| Spry4 | 1.613*** | 1.196* | NM_011898.3 | F: AGTAGCAGCACTTCCTCCGA R: CAGCGGCTTACAGTGAACCA | 120 |
| Sstr2 | 1.160 | 1.671*** | NM_001042606.3 | F: CCCATCCTGTACGCCTTCTT R: TCTCCGTGGTCTCATTCAGC | 142 |
Figure 4Changes in 13 selected differentially expressed genes (DEGs) in the cortex and hippocampus of mouse brains after cranial irradiation. The bar graphs show the relative expression levels of upregulated (A) and downregulated (B) genes from RNA-seq data collected from both the cortex and hippocampus. Data are expressed as the mean ± SE (n = 5 per group). *p < 0.05, **p < 0.01, and ***p < 0.001 vs. the Con group.