Literature DB >> 35911132

Silencing CAMK2D Promotes the Proliferation of Spermatogonia in the Testis of Experimental Varicocele Rats.

Songxi Tang1, Peng Yang1, Yilang Ding1, Qiang Chen1, Hailin Huang1, Xi Chen1, Huiliang Zhou1.   

Abstract

Varicocele is regarded as the main factor that contributes to male infertility. This study aimed to explore the effect of CAMK2D on spermatogonia in the testis of experimental varicocele rats. The experimental varicocele model was established in rats and treated using different ligation methods. mRNA expression profile analysis was performed on the left testicular tissue isolated from different groups, and differentially expressed genes (DEGs) were analysed by bioinformatics methods and identified by qRT-PCR. The effect of CAMK2D, the screened DEG, on the proliferation of spermatogonia was evaluated by CCK-8 assay. The expression level of the c-kit was measured by the immunofluorescence assay and the expression levels of CAMKII, FOXO1, and β-catenin were detected by qRT-PCR and western blotting. Five DEGs (i.e., TMCC3, FLNB, CAMK2D, OPLAH, and EGR1) were screened using the comprehensive analysis of mRNA high-throughput sequencing data. TMCC3 and FLNB were significantly downregulated, and CAMK2D, OPLAH, and EGR1 were dramatically upregulated in the testicular tissue of varicocele rats. The target DEG CAMK2D was obtained through identification by using qRT-PCR. In vitro assays revealed that the proliferation of spermatogonia was significantly facilitated by the silencing of CAMK2D, which resulted in the downregulation of CAMKII, FOXO1, and β-catenin. In conclusion, silencing CAMK2D facilitated the proliferation of spermatogonia in the testis of experimental varicocele rats.
Copyright © 2022 Songxi Tang et al.

Entities:  

Year:  2022        PMID: 35911132      PMCID: PMC9325628          DOI: 10.1155/2022/7121245

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.650


1. Introduction

Varicocele is defined as the abnormal elongation of the spermatic vein, expansion, and circuity induced by elements, such as obstruction of venous reflux and valve failure, and is accompanied by testicular atrophy or testicular pain. As a common disease observed in the male urogenital system, varicocele is regarded as the main factor that contributes to male infertility [1]. In the field of male infertility research, varicocele has been put in the first place by the World Health Organization. The morbidity of varicocele in adult males is 4.4%–26.4%, and that in infertile males is 17%–41% [2]. Varicocele is reported to show adverse effects on sperm function [3], semen quality [4], and reproductive hormones [5], finally contributing to male infertility. Currently, the main inducers for varicocele-triggered infertility include the increased local temperature of the scrotum, oxidative stress caused by hypoxia, poor renal and adrenal metabolites, low testosterone level, and abnormal sperm energy metabolism [6]. However, the specific pathophysiological mechanism of varicocele-induced infertility remains unclear. Previous studies showed that the differential expression of multiple genes or proteins is involved in the process of varicocele-induced infertility [7, 8]. For example, sperm apoptosis can be facilitated by hypoxia-induced HIF-1α to affect sperm genesis and maturation [9]. The abnormal energy metabolism of sperm and low sperm motility are induced by the abnormal expression of androgen and oestrogen receptors in sperm [10]. However, the development of varicocele is difficult to be completely explained by these mechanisms. Multiple mechanisms interact and influence each other to contribute to multiple clinical manifestations associated with varicocele. The main strategy for the treatment of varicocele is to prevent testicular venous blood reflux to block further deterioration of semen quality. Changes in the expression of proteins before and after operation in rats with the spermatic vein have previously been investigated; results show that proteins with different expression levels are involved in cellular progression, such as apoptosis, proliferation, and cell death, and reported first the changes in protein levels before and after varicocele treatments [11]. Varicocele is a complicated disease triggered by multiple pathogenic mechanisms. The comprehensive detection of differentially expressed mRNAs is helpful in further understanding the relationship between varicocele pathogenesis. In the present study, a rat model of varicocele is established and treated with different ligation methods. mRNA high-throughput sequencing is performed on the left testicular tissues of the normal, varicocele model, and ligation-treated varicocele model rats. The target gene calcium/calmodulin-dependent protein kinase IIδ (CAMK2D) is obtained and identified. CAMK2D expression in varicocele tissues is significantly higher than that in normal tissues. The proliferation of spermatogonia can be facilitated by the silencing of CAMK2D, which may be a novel diagnostic biomarker and a promising target for varicocele.

2. Materials and Methods

2.1. Animals

The animal protocol was approved by the Animal Care and Use Committee of The First Affiliated Hospital of Fujian Medical University (2020-018) and was consistent with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. A total of 24 adult male SD rats weighing 220–240 g was purchased from Hunan LaikeJingda Experimental Animal Co. Ltd and were maintained at 22°C with a 12 h/12 h light/dark cycle and fed with standard food pellets and water ad libitum.

2.2. Grouping and Varicocele Modelling

SD rats were divided into four groups (n = 6 per group): sham group, varicocele group, convention ligation group, and microscopic ligation group. In accordance with the method described by Najari et al. [12], the varicocele model in rats was established under microscopic observation (MSHOT, Guangzhou, China). After anesthetising rats, the hair in the abdominal surgical area was removed with a hair shaver, and a longitudinal incision of 1 cm was made 0.5 cm below the xiphoid process. The tissue was cut layer by layer to expose the abdominal cavity fully, and the intestine and other tissues were moved to the other side, while the blood vessels between the left kidney and the inferior vena cava fully were exposed with gauze. Under the microscope, blunt forceps were used to separate the left renal vein from the confluence of the inferior vena cava. A passage was separated between the left renal vein and the left renal artery between the spermatic cord and inferior vena cava, and a 3/0 silk thread was passed through the passage. The left renal vein was ligated along with a disinfected probe at a diameter of 0.8 mm that was in line with the left renal vein, and the probe was slowly removed to restore the renal vein. After cutting the silk thread, the abdominal organ was reset, the abdominal cavity was closed, and the incision skin was disinfected with iodophor. A longitudinal incision of about 1 cm was made 0.5 cm above the symphysis pubis and 0.5 cm to the left side of Hunter's line. The tissue was cut layer by layer to expose the left spermatic vein and the left common iliac vein fully. The vision was lowered under the microscope, and the communication branch between the left spermatic vein and the left common iliac vein was carefully dissociated. The suture was performed under the microscope using a 10/0 nylon thread. Abdominal organs were reset, and 200,000 cefoxitin sodium was sprayed to prevent infection. The incision was sutured layer by layer with a 3/0 silk thread, the abdominal cavity was closed, and the rats were continuously fed for eight weeks under the same conditions. In the sham group, the operation stopped at the point of dissociating the left renal vein. Eight weeks after the operation, the left spermatic and left renal veins were exposed, and the diameter of the left spermatic vein was measured under a microscope. During the operation, the atrophy of the left kidney and the varicose of the left spermatic vein were observed. Compared with the measurement before modelling, if the diameter expansion was higher than 0.5 mm and no significant renal atrophy was observed, the varicocele model was successfully established. No operation of ligation was conducted on varicocele rats in the varicocele group. For varicocele rats in the convention and microscopic ligation groups, after fasting for 8 h, a 1 cm longitudinal incision was made at 0.5 cm above the symphysis pubis and 0.5 cm to the left side of the alba abdominis. The tissue was cut layer by layer, and the left spermatic cord was carefully dissociated and exposed. For animals in the convention ligation group, the spermatic cord was ligated using a 5/0 silk thread. For animals in the microscopic ligation group, the spermatic vein was ligated with the 5/0 silk thread. Lastly, the incision was sutured using the 5/0 silk thread. The rats were allowed to recover in an incubator maintained at 37°C and raised for another four weeks. The brief step for modelling is visualised in Figure 1, and the workflow chart of this study is shown in Figure 2.
Figure 1

Brief step of varicocele modelling in rats. (a) Semiligation of the left renal vein (reducing blood supply, causing varicocele, and affecting the development of the left kidney). (b) Ligation of the spermatic vein and the communication branch of the common iliac vein (to further strengthen the varicocele). (c) Ligation of the spermatic vein. (d) Observation and measurement of the degree of varicocele. (e) Diameter measurement of the left spermatic vein after modelling.

Figure 2

Workflow chart. VC: varicocele, DEG: differentially expressed genes, and qRT-PCR: quantitative real-time polymerase chain reaction.

2.3. mRNA High-Throughput Sequencing Assay

The left testicular tissues from the four groups were isolated for the mRNA high-throughput sequencing assay. Total RNAs were extracted from tissues by using the TRIzol® reagent (Invitrogen, California, USA) and quantified using the Nanodrop 2000. After confirming the RNA integrity by using agarose gel electrophoresis, the Ribo-Zero magnetic kit (EpiCentre, New York, USA) was utilised to remove the rRNAs, and the RNase R kit (EpiCentre, New York, USA) was used to remove the linear RNAs. The paired-end sequencing bank was established using the TruSeqTM stranded total RNA library prep kit (Illumina, California, USA) and subjected to the Hiseq4000 sequencing platform for sequencing. SepPrep and Sickle software were used to test the data quality. The obtained data were compared and analysed using Bowtie software.

2.4. Quantitative Real-Time PCR (qRT-PCR)

The total RNAs were isolated from cells and tissues by using the TRIZOL© reagent (Invitrogen, California, USA) and transcribed into cDNA utilising the TaqMan miRNA reverse transcription kit (Invitrogen, California, USA). The ABI 7900 real-time PCR machine was used to conduct the PCR reaction by using the SYBR® green real‐time PCR master mix (Roche Diagnostics, Basel, Switzerland). β-Actin was used for the normalisation of gene expression, which was determined using the 2−ΔΔCt method. The sequences for the primers are shown in Table 1.
Table 1

The sequences of the primers.

NameSequences (5′-3′)Length of primers (bp)Length of products (bp)Annealing temperature (°C)
β-Catenin FCAGGAAAGCAAGCTCATCATTCTG2432758.8
β-Catenin RGACCACATTTATATCATCAGAACCC25
FOXO1 FTGGGGCAACCTGTCGTA1724457.5
FOXO1RGATTGAGCATCCACCAAGAAC21
CaMK II FAGCAAATCCAAAGGAGCAG1919456.8
CAMKII RCCCACCAGCAAGATGTAGAG20
β-actin FGCCATGTACGTAGCCATCCA2037559
β-actin RGAACCGCTCATTGCCGATAG20
CAMK2D FATAGAAGTTCAAGGCGACCAG2114457.8
CAMK2D RCACCAGCAAGATGTAGAGGATG22
Egr1 FACCAGTCCCAACTCATCAAAC219557.8
Egr1 RAACAGGGCAAGCATACGG18
OPLAH FAGTTTGGCTTCATTATCCCC2029358.6
OPLAH RGTCCCCTGTATCAGTCACCTC21
OPLAH FGTGAAGCAGCCAGCCAAAT1937358.8
OPLAH RCCTCTACCTCAACGCCAATG20
Tmcc3 FAAGTCAGCCCACTCCATCG198758.8
Tmcc3 RGGTCGCTCCATTCTGTTCAA20

2.5. Isolation of Primary Spermatogonia

The convoluted tubules inside the testis were separated, and collagenase was added for digestion and added with the completed DMEM to terminate the digestion. After filtration by using the 100 μm cell filter, the monocyte suspension was obtained and added with the precoll gradient separation fluid. After centrifugation at 1000 rpm for 3 min, cells located in the middle layer (28%–36%) were collected and placed in the dish to be incubated for 3 h. The cell suspension was collected and spermatogonia were achieved.

2.6. Establishment of Si-CAMK2D Spermatogonia

Isolated spermatogonia were cultured in DMEM containing 10% FBS at 37°C and 5% CO2. Cells were transfected with CAMK2D-siRNAs (Genscript, Nanjing, China) together with the Lipofectamine™ 3000 reagent (Invitrogen, California, USA) for two days to inhibit the expression level of CAMK2D. The efficacy of transfection was identified by using the qRT-PCR assay. The sequences of siRNAs are shown in Table 2.
Table 2

The sequences of the siRNAs.

siRNAssiRNA sequences (5′-3′)
CAMK2D-siRNA-1ACAUCUUGCUGGUGGGAUATT UAUCCCACCAGCAAGAUGUTT
CAMK2D-siRNA-2CCAAAGACCUCAUCAACAATT UUGUUGAUGAGGUCUUUGGTT
CAMK2D-siRNA-3CCAAGAGUUUGUUGAAGAATT UUCUUCAACAAACUCUUGGTT
Si-NCUUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

2.7. Immunofluorescence Assay

Spermatogonia were fixed by using 4% paraformaldehyde, permeabilized, and incubated with 5% goat serum dissolved in 0.2% Triton X-100 PBS buffer was used for blocking. Then, the samples were incubated with the primary antibody against the C-kit (1 : 200, Bioss, Beijing, China) and the fluorescently labelled secondary antibody (Bioss, Beijing, China), with nuclei counterstained with VECTASHIELD DAPI mounting medium (Vector Labs, California, USA). Last, images were obtained using confocal microscopy (MSHOT, Guangzhou, China).

2.8. Western Blot Assay

After proteins were extracted from cells, quantification was performed on proteins that were loaded onto 12% SDS-PAGE. Proteins were separated for 1.5 h, transferred onto the PVDF membrane (Takara, Tokyo, Japan), and blocked using the 5% fat-free milk. The membrane was incubated with the primary antibody against CAMKII (1 : 1000, 20667-1-AP, Proteintech, Wuhan, China), forkhead box O (FOXO) 1 (1 : 1000, 18592-1-ap, Proteintech, Wuhan, China), β-catenin (1 : 1000, ab32572, Abcam, Cambridge, UK), and β-actin (1 : 1000, Proteintech, Wuhan, China) followed by the appropriate secondary antibody (1 : 2000, Proteintech, Wuhan, China) incubation for 1.5 h, and was observed with the ECL solution. Quantification was conducted using the Image J software.

2.9. Statistical Analysis

Data were expressed as mean ± standard deviation (SD) and analysed using the GraphPad software. The Student's t-test was used to analyze the difference between the two groups, and the one-way ANOVA was applied to analyze the differences between more groups. P < 0.05 was regarded as a significant difference.

3. Results

3.1. Establishment of the Varicocele Model in Rats

The results of the identification on the varicocele model are shown in Table 3. The expansion of the diameter of the left spermatic vein was 0.853 ± 0.2623 mm, which was greater than 0.5 mm and indicated that the varicocele model was successfully established in rats.
Table 3

Data of measurement (n = 12).

Measuring on the first operationSpermatic cord diameter (mm)0.567 ± 0.092
Diameter of the left kidney (cm)1.005 ± 0.12

Measuring on the second operationSpermatic cord diameter (mm)1.331 ± 0.246
Diameter of the left kidney (cm)1.092 ± 0.473

Expansion (mm)0.853 ± 0.2623

3.2. Identification of DEGs

The heat map (Figure 3(a)) and volcanic map (Figure 3(b)) show the DEGs in the four groups. A total of 1230 DEGs, including 164 upregulated genes and 1066 downregulated genes, were screened in the varicocele model group compared to the sham group.
Figure 3

Results of mRNA high-throughput sequencing. (a) Heat map of differential genes based on fold-change. The red colour represents upregulation and the green colour represents downregulation. A dark red colour indicates a high upregulated ratio, whereas a dark green colour indicates a high downregulated ratio. (b) The volcanic map of expression difference amongst the groups. Each dot represents a gene, with red, green, and black colours representing upregulated, downregulated, and nondifferential genes, respectively. (c) Histogram of GO annotation classification on differentially expressed genes. Different colours represent different categories. Light colour represents differentially expressed genes and the dark colour represents all genes. (d) Significant enrichment functions scatter plot. Q value is represented by the dot colour. A small Q value indicates a close colour to red. The number of different genes contained in each function is indicated by the size of the dots. Only the top 30 GO with the highest enrichment degree are selected.

3.3. Functional Enrichment Analysis

In accordance with the results of high-throughput screening and the association between disease and genes by using GO analyses, according to the GO analysis, the significant enrichment of GO items in the DEGs was intracellular part, membrane-bounded organelle, and cytoplasm (Figures 3(c) and 3(d)). Furthermore, we identified five most significantly different DEGs, including TMCC3, FLNB, CAMK2D, OPLAH, and EGR1. Among these genes, TMCC3 and FLNB were significantly downregulated, and CAMK2D, OPLAH, and EGR1 were upregulated in the testicular tissue of the varicocele rats (Table 4).
Table 4

The DEGs in the testicular tissue of varicocele rats.

Gene IDGene nameMean TPM (A)Log 2 fold change p valueResult
ENSRNOG00000007713Tmcc311.557−2.4041.28E − 11Down
ENSRNOG00000009470FLNB9.767−3.7421.60E − 20Down
Egr1Early growth response 11.6071.8368.75E − 06Up
ENSRNOG00000011781OPLAH0.00310.9942.10E − 05Up
ENSRNOG00000011589CAMK2D0.0109.4923.37E − 06Up

3.4. Verification of the Expression of DEGs in Testicular Tissues

The expression levels of TMCC3, FLNB, CAMK2D, OPLAH, and EGR1 were determined by qRT-PCR to verify and confirm whether DEGs could be detected among these four groups. As shown in Figure 4, compared with the sham group, the expression levels of FLNB (Figure 4(a)), CAMK2D (Figure 4(c)), and EGR1 (Figure 4(e)) were significantly upregulated in the varicocele group. After ligation (microscopic ligation group and convention ligation group), FLNB and CAMK2D expressions were significantly downregulated, while ERG1 expression was significantly upregulated (P < 0.05). There was no significant difference in the expression level of TMCC3 observed between the sham and varicocele groups. However, compared with the sham group, TMCC3 expression in the convention and microscopic ligation groups was significantly downregulated (P < 0.05) (Figure 4(b)). Compared with the sham group, the varicocele group had a significantly reduced expression level of OPLAH, which was remarkably elevated in the convention ligation group (P < 0.05). According to the results of qRT-PCR, the expression of CAMK2D was consistent with the results observed in high-throughput sequencing. Therefore, CAMK2D was chosen as the target gene for research.
Figure 4

Expression levels of (a) FLNB, (b) Tmcc3, (c) CAMK2D, (d) OPLAH, and (e) Egr1 identified by the qRT-PCR assay (P < 0.05vs. sham, #P < 0.05vs. varicocele, ΔP < 0.05vs. convention ligation).

3.5. Proliferation of Rat Spermatogonia Was Facilitated by Silencing CAMK2D

Rat spermatogonia were isolated and identified by the immunofluorescence assay to determine the effects on the growth of rat spermatogonia. The C-kit was positively expressed in the cell membrane and cytoplasm, indicating successful extraction of rat spermatogonia (Figure 5(a)). Three siRNAs targeting CAMK2D were constructed and transfected into the spermatogonia to inhibit the expression of CAMK2D. QRT-PCR verification results showed that the silenced efficacy of siRNA-1 was the most significant (Figure 5(b)) and was applied in subsequent experiments. The CCK-8 assay indicated that the proliferation of rat spermatogonia was significantly facilitated by the silencing of CAMK2D (Figure 5(c)).
Figure 5

Effect of the silencing of CAMK2D on the proliferation of spermatogonia. (a) Identification of isolated spermatogonia. (b) Silencing of CAMK2D verified by qRT-PCR. (c) Evaluation of the proliferation of spermatogonia by the CCK-8 assay (P < 0.05vs. control, #P < 0.05vs. NC).

3.6. Silencing CAMK2D Facilitated the Proliferation of Spermatogonia by Regulating the β-Catenin/CAMKII/FOXO1 Pathway

The expression levels of CAMKII, FOXO1, and β-catenin genes were detected by QRT-PCR to determine whether their expression levels in spermatogonia were altered by the silencing of CAMK2D. Results showed that the expression levels of CaMKII, FOXO1, and β-catenin genes (Figures 6(a)–6(c)) were significantly repressed by the silencing of CAMK2D (P < 0.05). Western blot also showed the same results (Figures 6(d)–6(e)). These results suggested that the effect of CAMK2D on the proliferation of spermatogonia might be mediated by the regulation of the β-catenin/ CAMKII /FOXO1 pathway.
Figure 6

Effect of the silencing of CAMK2D on the β-catenin/ CAMKII /FOXO1 pathway. Gene expression levels of (a) FOXO1, (b) CAMKII and (c) β-catenin determined by qRT-PCR. (d, e). Protein expression levels of FOXO1, CAMKII, and β-catenin evaluated by western blotting assay (P < 0.05vs. control, #P < 0.05vs. siRNA NC).

4. Discussion

Varicocele is considered a common inducer of male infertility [13], and although studies demonstrated the negative effect of varicocele on fertility, the underlying mechanism remains unclear. Therefore, we aim to detect varicocele-related differential proteins in the testicular tissue of varicocele rats systematically by mRNA sequencing. In accordance with the results of high-throughput screening, five differentially expressed genes, i.e., CAMK2D, OPLAH, TMCC3, FLNB, and EGR1, were screened out which might be the key genes for the development of varicocele. Amongst these genes, TMCC3 and FLNB were downregulated in varicocele, and OPLAH, CAMK2D, and EGR1 were upregulated in varicocele. For further verification, the testicular tissues of rats in the four groups were extracted for qRT-PCR identification. QRT-PCR results confirmed that only CAMK2D expression was consistent with the mRNA sequencing results. In addition, the results suggested that the therapeutic effects of convention and microscopic ligation on varicocele may be mediated by the downregulation of CAMK2D. CAMK2D, a member of the CAMKII family, has been reported to be associated with the occurrence and development of a variety of diseases and tumours [14]. Previous studies investigated and found that pulmonary hypertension, hypoxia-induced differentiation, and calcification of HPASMC osteoblasts are mediated by CAMK2D [15]. In gastric cancer, CAMK2D is downregulated in gastric cancer tissues and is significantly associated with a poor prognosis [14]. CAMK2D can be used as a potential prognostic marker for the overall survival of early NSCLC in the Chinese population. In cisplatin-resistant human epithelial ovarian cancer, the overexpression of CAMK2D leads to a significant increase in the survival rates of A2780 and SKVO3 cells after cisplatin treatment. Apoptosis analysis shows that the overexpression of CAMK2D increases the cisplatin resistance of ovarian cancer cells by reducing the apoptosis group [16]. In addition, CAMK2D is involved in the progression of prostate cancer [17]. However, the biofunction of CAMK2D in the varicocele is currently unknown. Therefore, our findings will provide a novel perspective on the physiological and pathological mechanism of male infertility induced by varicocele. Spermatogenesis involves a complex network of processes that develop in the spermatogenic tubules to produce mature male gametes. These processes include spermatogenic cell proliferation, differentiation from spermatogonia to spermatocytes, meiosis of spermatocytes, maturation of round spermatocytes, and the release of highly specialised mature sperm into the testicular tubule lumen [18]. The entire spermatogenesis process is thought to take about 74 days. Studies showed that sperm production can be repressed by varicocele [19, 20]. Spermatogonia are essential for spermatogenesis and may be regulated by CAMK2D. Our results showed that the proliferation of spermatogonia is significantly promoted by the silencing of CAMK2D, indicating that CAMK2D is involved in spermatogenesis. George et al. showed that CAMK2D affects the transitional activation of mouse sperm cells, which is the key to successful fertilisation [21]. FOXO1 is a member of the FOXO protein family that controls the progression of spermatogenesis from the long-term self-renewal of spermatogonia to the onset of spermatogenesis and meiosis [22]. The Wnt/β-catenin signalling pathway is a key pathway that regulates spermatogenesis [23]. Chioccarelli et al. investigated the effects of bisphenol A (BPA) on germ cells and showed that BPA increases the content of germ cells (spermatogonia), reduces the population of spermatocytes and sperm cells, accelerates the process of spermatocyte and sperm cells, and promotes the epithelial exfoliation of round and concentrated sperm cells; these phenomena are accompanied by the downregulation of β-catenin [24]. In the present study, the proliferation of rat spermatogonia is facilitated by the silencing of CAM2D. Additionally, the expression levels of CAMKII, FOXO1, and β-catenin are significantly declined by the silencing of CAMK2D. Therefore, the effect of CAMKD2 on the proliferation of spermatogonia may be mediated by the regulation of the β-catenin/ CAMKII /FOXO1 pathway. mRNA expression profile analysis and validation results showed that CAMK2D is significantly increased in the varicocele rat testicular tissue. In vitro experiments showed that the proliferation of spermatogonia is facilitated by the silencing of CAMK2D. Therefore, our findings suggest that CAMK2D may promote male infertility by inhibiting spermatogenic cell proliferation. CAMK2D is also known to play a role in vascular smooth muscle proliferation and migration [25]. Vascularization is known to play a critical role in testis morphogenesis and in creating the spermatogonial stem cell niche [26, 27]. Future studies to investigate the role of CAMKD2 in spermatogonial stem cell fate decisions during testis morphogenesis would be interesting and may link increased testicular cell apoptosis in adult life to vinclozolin action. Although our findings have suggested that silencing of CAMK2D facilitates the proliferation of spermatogonia in the testis of experimental varicocele rats, further studies can be conducted to investigate the calcium-dependent regulation of CAMK2D to elucidate its molecular mechanism in the development of male infertility.
  27 in total

1.  Yolk-sac-derived macrophages regulate fetal testis vascularization and morphogenesis.

Authors:  Tony DeFalco; Indrashis Bhattacharya; Alyna V Williams; Dustin M Sams; Blanche Capel
Journal:  Proc Natl Acad Sci U S A       Date:  2014-05-27       Impact factor: 11.205

2.  Microsurgical rat varicocele model.

Authors:  Bobby B Najari; Philip S Li; Ranjith Ramasamy; Matthew Katz; Seema Sheth; Brian Robinson; Haolin Chen; Barry Zirkin; Peter N Schlegel; Marc Goldstein
Journal:  J Urol       Date:  2013-08-15       Impact factor: 7.450

3.  Hypoxia pathway has more impact than inflammation pathway on etiology of infertile men with varicocele.

Authors:  Rana Ghandehari-Alavijeh; Marziyeh Tavalaee; Dina Zohrabi; Shaqayeq Foroozan-Broojeni; Homayoun Abbasi; Mohammad H Nasr-Esfahani
Journal:  Andrologia       Date:  2018-11-26       Impact factor: 2.775

4.  CaM kinase II delta2-dependent regulation of vascular smooth muscle cell polarization and migration.

Authors:  Melissa Z Mercure; Roman Ginnan; Harold A Singer
Journal:  Am J Physiol Cell Physiol       Date:  2008-04-02       Impact factor: 4.249

5.  Effects of sodium fluoride on hyperactivation and Ca2+ signaling pathway in sperm from mice: an in vivo study.

Authors:  Zilong Sun; Ruiyan Niu; Kai Su; Bin Wang; Jinming Wang; Jianhai Zhang; Jundong Wang
Journal:  Arch Toxicol       Date:  2010-01-06       Impact factor: 5.153

6.  Estrogen receptor (ER)alpha and ER beta are both expressed in human ejaculated spermatozoa: evidence of their direct interaction with phosphatidylinositol-3-OH kinase/Akt pathway.

Authors:  Saveria Aquila; Diego Sisci; Mariaelena Gentile; Emilia Middea; Stefania Catalano; Amalia Carpino; Vittoria Rago; Sebastiano Andò
Journal:  J Clin Endocrinol Metab       Date:  2004-03       Impact factor: 5.958

Review 7.  Varicocele and male infertility.

Authors:  Christian Fuglesang S Jensen; Peter Østergren; James M Dupree; Dana A Ohl; Jens Sønksen; Mikkel Fode
Journal:  Nat Rev Urol       Date:  2017-07-04       Impact factor: 14.432

Review 8.  The spermatogonial stem cell niche in testicular germ cell tumors.

Authors:  Unai Silván; Alejandro Díez-Torre; Pablo Moreno; Jon Arluzea; Ricardo Andrade; Margarita Silió; Juan Aréchaga
Journal:  Int J Dev Biol       Date:  2013       Impact factor: 2.203

9.  Semen and reproductive hormone parameters in fertile men with and without varicocele.

Authors:  J Bruce Redmon; Erma Z Drobnis; Amy Sparks; Christina Wang; Shanna H Swan
Journal:  Andrologia       Date:  2019-08-25       Impact factor: 2.532

10.  Deferasirox, an Iron-Chelating Agent, Improves Testicular Morphometric and Sperm Functional Parameters in a Rat Model of Varicocele.

Authors:  M Rahmani; M Tavalaee; M Hosseini; A Eskandari; E Shaygannia; N Sadeghi; M N Nazem; P Gharagozloo; J R Drevet; M H Nasr-Esfahani
Journal:  Oxid Med Cell Longev       Date:  2021-04-08       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.