| Literature DB >> 35910629 |
Ling Hu1,2, Yidong Fu3,4,5, Shun Zhang3,4,5, Zhilei Pan3, Jiang Xia6, Peng Zhu3,4,5, Jing Guo1,2.
Abstract
Vibrio vulnificus (V. vulnificus) is one of the most common pathogenic Vibrio species to humans; therefore, the establishment of timely and credible detection methods has become an urgent requirement for V. vulnificus illness surveillance. In this study, an assay combining droplet digital PCR (ddPCR) with propidium monoazide (PMA) treatment was developed for detecting V. vulnificus. The primers/probes targeting the V. vulnificus hemolysin A (vvhA) gene, amplification procedures, and PMA processing conditions involved in the assay were optimized. Then, we analyzed the specificity, sensitivity, and ability to detect live cell DNA while testing the performance of PMA-ddPCR in clinical samples. The optimal concentrations of primers and probes were 1.0 and 0.3 μM, respectively. The annealing temperature achieving the highest accuracy in ddPCR assay was 60°C. With an initial V. vulnificus cell concentration of 108 CFU/mL (colony-forming units per milliliter), the optimal strategy to distinguish live cells from dead cells was to treat samples with 100 μM PMA for 15 min in the dark and expose them to LED light with an output wavelength of 465 nm for 10 min. The specificity of the PMA-ddPCR assay was tested on 27 strains, including seven V. vulnificus strains and 20 other bacterial strains. Only the seven V. vulnificus strains were observed with positive signals in specificity analysis. Comparative experiments on the detection ability of PMA-ddPCR and PMA-qPCR in pure cultures and plasma samples were performed. The limit of detection (LOD) and the limit of quantitation (LOQ) in pure culture solutions of V. vulnificus were 29.33 and 53.64 CFU/mL in PMA-ddPCR, respectively. For artificially clinical sample tests in PMA-ddPCR, V. vulnificus could be detected at concentrations as low as 65.20 CFU/mL. The sensitivity of the PMA-ddPCR assay was 15- to 40-fold more sensitive than the PMA-qPCR in this study. The PMA-ddPCR assay we developed provides a new insight to accurately detect live cells of V. vulnificus in clinical samples, which is of great significance to enhance public health safety and security capability and improve the emergency response level for V. vulnificus infection.Entities:
Keywords: Vibrio vulnificus; accurate detection; clinical; droplet digital PCR; propidium monoazide; vvhA gene
Year: 2022 PMID: 35910629 PMCID: PMC9335127 DOI: 10.3389/fmicb.2022.927285
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 6.064
FIGURE 1Technical route of PMA-ddPCR for the accurate detection of live cells of V. vulnificus by targeting the vvhA gene.
Information of bacterial strains used in this study.
| Strains | Species | Source | Results | |
| PMA- | PMA- | |||
| ATCC27562 ( |
| MCCC | + (positive) | + |
| HM2 ( |
| Clinical isolate | + | + |
| HM3 ( |
| Clinical isolate | + | + |
| HMYJ ( |
| Clinical isolate | + | + |
| HMO2 ( |
| Clinical isolate | + | + |
| HMM16 ( |
| Clinical isolate | + | + |
| HMZ2 ( |
| Clinical isolate | + | + |
| ATCC33653 ( |
| CGMCC | − (negative) | − |
| ATCC33812 ( |
| MCCC | − | − |
| ATCC700040 ( |
| CGMCC | − | − |
| ATCC17749 ( |
| CGMCC | − | − |
| CGMCC1.997 ( |
| CGMCC | − | − |
| ATCC14100 ( |
| CGMCC | − | − |
| CGMCC1.1599 ( |
| CGMCC | − | − |
| HMF1 ( |
| Clinical isolate | − | − |
| HMF2 ( |
| Clinical isolate | − | − |
| HMC13 ( |
| Clinical isolate | − | − |
| HMC14 ( |
| Clinical isolate | − | − |
| HMP96 ( |
| Clinical isolate | − | − |
| HMP97 ( |
| Clinical isolate | − | − |
| HM110 ( |
| Clinical isolate | − | − |
| HM175 ( |
| Clinical isolate | − | − |
| HM7 ( |
| Clinical isolate | − | − |
| HMA57 ( |
| Clinical isolate | − | − |
| HMA66 ( |
| Clinical isolate | − | − |
| HM31 ( |
| Clinical isolate | − | − |
| HM5 ( |
| Clinical isolate | − | − |
ATCC, American Type Culture Collection; HM, Hwa Mei Hospital; CGMCC, China General Microbiological Culture Collection Center; Ref., reference strains; Clin., clinical strains isolated from clinical samples in Hwa Mei Hospital, China.
Primer and probe sequences in this study.
| Primer/Probe | Sequence (5′-3′) | Product size |
| F1 | TGGCACGGGTATTCATTTGG | 103 bp |
| R1 | TAACTGCTGGCGAATGGACCAATG | |
| F2 | CTGACGCCAAAATTGTCCGTT | 126 bp |
| R2 | CAATGTAAGTGCGGCGGTTT | |
| F3 | CCCGTTTCTGGTTACACAC | 126 bp |
| R3 | TTCACTTCCGCACCTACTT | |
| F4 | TTGTCCGTTTCACCGTCGAT | 144 bp |
| R4 | AACGGGTTTCACCCAAAGGT | |
| F5 | AATTGTCCGTTTCACCGTCG | 115 bp |
| R5 | AATGTAAGTGCGGCGGTTTG | |
| F6 | TGACGCCAAAATTGTCCGTT | 148 bp |
| R6 | GTCGTAACTGCTGGCGAATG | |
| P6 | 6-FAM-TGCCGACAAGCCTGGCACGGGT-BHQ1 |
F, forward primer; R, reverse primer; P, probe; 6-FAM, 6-carboxy-fluorescein; BHQ1, black hole quencher 1.
FIGURE 2Analysis results of ddPCR under different processing conditions. Blue dots represent positive droplets, and gray dots represent negative droplets. The figures show the most available results of three independent replicates. (A) Optimization of primers and probe concentration combinations on ddPCR. (B) Optimization of annealing temperature on ddPCR.
FIGURE 3(A) Optimization of final PMA concentration. The different concentrations (10–180 μM) of PMA were treated on live V. vulnificus cell suspensions and heat-killed cell suspensions. Error bars represent the standard deviation based on three replicates. (B) Optimization of light-exposed time. The different light-exposed times were treated on heat-killed cell suspensions. N: PMA untreated control. Error bars represent the standard deviation based on three replicates. (C) Verification of the ability to detect live V. vulnificus cells by PMA-qPCR. The different concentrations (0–100%) of live cells were mixed with heat-killed cells and treated with PMA (PMA-qPCR group) or not (qPCR group). While the 2216E group was the blank control which was the corresponding concentration of live cells mixed with 2216E liquid medium. NT, no test. When the proportion of live V. vulnificus was 0% and 100%, the samples were pure dead bacterial solution or live bacterial solution, and it is not necessary to mix with 2216E medium. Error bars represent the standard deviation based on three replicates. (D) Specificity test of PMA-qPCR. Only the above seven V. vulnificus strains were observed positive signals. Clin., clinical strain of V. vulnificus isolated from clinical samples; Ref., reference strain of V. vulnificus.
Comparison of detection results of PMA-qPCR and PMA-ddPCR in pure culture solutions.
| Plate count (CFU/mL) | PMA-qPCR (Ct) | PMA-ddPCR (Copies/μL) |
| 1.33 × 107 | 23.51 ± 0.08 | − |
| 1.33 × 106 | 27.62 ± 0.04 | 5699.22 ± 58.13 |
| 1.33 × 105 | 30.94 ± 0.12 | 503.01 ± 3.53 |
| 1.33 × 104 | 34.30 ± 0.22 | 55.17 ± 0.04 |
| 1.33 × 103 | 37.84 ± 0.08 | 10.60 ± 0.46 |
| 1.33 × 102 | − | 0.94 ± 0.06 |
| 6.63 × 101 | − | 0.43 ± 0.08 |
| 1.33 × 100 | − | − |
“−”: No valid data.
FIGURE 4Sensitivity and regression analysis of PMA-qPCR and PMA-ddPCR. (A) Amplification curves of different concentrations of V. vulnificus from pure culture on qPCR. (B) Linear regression analysis based on qPCR in pure culture solutions. Error bars represent the standard deviation based on three replicates. (C) Picture of FAM channel from different concentrations of V. vulnificus in pure culture on ddPCR. (D) Linear regression analysis based on ddPCR in pure culture solutions. Error bars represent the standard deviation based on three replicates. (E) Linear regression analysis based on qPCR in plasma samples. Error bars represent the standard deviation based on three replicates. (F) Linear regression analysis based on ddPCR in plasma samples. Error bars represent the standard deviation based on three replicates.
Comparison of detection results of PMA-qPCR and PMA-ddPCR in spiked plasma samples.
| Plate count (CFU/mL) | PMA-qPCR (Ct) | PMA-ddPCR (Copies/μL) |
| 1.22 × 106 | 26.14 ± 0.23 | − |
| 2.44 × 105 | NT | 6784.44 ± 80.90 |
| 1.22 × 105 | 29.52 ± 0.41 | 3043.05 ± 88.28 |
| 1.22 × 104 | 33.19 ± 0.50 | 170.83 ± 0.91 |
| 2.44 × 103 | 35.55 ± 0.12 | 34.19 ± 0.61 |
| 1.22 × 103 | 36.41 ± 0.37 | 17.07 ± 0.38 |
| 2.44 × 102 | − | 2.76 ± 0.51 |
| 1.22 × 102 | − | 1.63 ± 0.15 |
| 1.22 × 101 | − | − |
“−”: No valid data. NT, not test.