Literature DB >> 35905120

Association of TLR9-1237T>C; rs5743836 polymorphism with increased risk of Hodgkin's lymphoma: A case-control study.

Sohaib Al-Khatib1, Amin Shabaneh2, Nour Abdo3, Laith Al-Eitan4, Abdel-Hameed Al-Mistarehi5, Yousef Khader6.   

Abstract

Mature B-cell neoplasms are typically divided into Hodgkin and Non-Hodgkin Lymphomas. Hodgkin Lymphoma is characterized by the neoplastic Reed-Sternberg cells, usually harbored in an inflammatory background, with a frequent clinical presentation of mediastinal lymphadenopathy. Many studies link between autoimmunity and lymphomagenesis, a large proportion of these studies evidently trace the pathogenesis back to the misdirected detection of self-derived nucleic acids by Toll-Like Receptors (TLRs), especially those of the intracellular type. In this study, we analyzed the relationship between a selected SNP in TLR9 (TLR9-1237T>C; rs5743836) and the risk and overall survival of HL patients in a Jordanian Arab population. A total of 374 subjects; 136 cases of Hodgkin lymphoma and 238 matched healthy controls were incorporated in this study. Genomic DNA was extracted from formalin-fixed paraffin-embedded tissues. Genotyping of the genetic polymorphisms was conducted using a sequencing protocol. The results show a statistically significant higher distribution of the rs5743836 (TLR9-1237T>C) allele among the case population, with a p-value of 0.031 (<0.05). This distribution proved significant when studied in the codominant (only significant in the T/C genotype, p-value = 0.030), dominant (p-value = 0.025), and overdominant (p-value = 0.035) models. None of the models showed any statistically significant difference in survival associated with the rs5743836 (TLR9-1237T>C) SNP.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35905120      PMCID: PMC9337659          DOI: 10.1371/journal.pone.0272312

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Mature B-cell neoplasms are typically divided into Hodgkin and Non-Hodgkin Lymphomas (HL and NHL) [1]. Unlike NHL which added estimated 2.78% to the global cancer burden (510,000 new cases in the year 2018), HL is considered an uncommon B-cell malignancy accounting for 0.4% of all new tumors and 0.3% of all new cancer deaths in the year 2018 [2, 3]. The incidence of HL shows variable trends that are significantly influenced by geographic, socioeconomic, racial, gender, and age differences [4]. Incidence is higher in more developed countries and among males, characteristically displaying a bimodal curve of incidence that is most significant for young adults (of age 15–34) and those above 50 years of age [5, 6]. Epidemiologic studies indicate that genetic and environmental factors both play essential roles in the pathogenesis of HL [7]. Among the most highlighted environmental factors is Epstein-Barr viral infection, which is clearly evident in the countless numbers of studies outlining its prominent but poorly elucidated role in the pathogenesis of a large proportion of HL cases [8-11]. HL is characterized by the neoplastic Reed-Sternberg cells, usually harbored in an inflammatory background, with a frequent clinical presentation of mediastinal lymphadenopathy. It is morphologically and immunohistochemically subcategorized into classical Hodgkin lymphoma (CHL) and Nodular lymphocyte predominant Hodgkin lymphoma (NLPHL). The majority of HL (around 90%) are of the classical type, while the rest are of the more indolent and slow-progressing nodular lymphocyte predominant type. CHL is further divided into nodular sclerosis (NSCHL–the most common subtype), mixed cellularity (MCCHL–the second most common subtype), lymphocyte rich (LRCHL–the subtype with the best prognosis), and lymphocyte depleted (LDCH–the rarest subtype with the most aggressive prognosis). LDCHL and MCCHL have prognoses that are significantly worse than that of NSCHL, being commonly associated with immunosuppression such as that seen in HIV infection. MCCHL subtype shows the most affiliation with EBV infection; approximately 75% of this subtype’s cases show evidence of EBV-expressed nuclear RNA transcripts and latent membrane protein 1 (LMP1) [12]. Many studies link between immune dysregulation and resultant risk of lymphomagenesis [13-15]. Other studies outline links between autoimmunity and lymphomagenesis, a large proportion of these studies evidently trace the pathogenesis back to the misdirected detection of self-derived nucleic acids by Toll-Like Receptors (TLRs), especially those of the intracellular type [16-18]. As in almost all other cancers, the inflammatory milieu set forward by the immune response is important in the pathogenesis and progression of HL. This importance has been noted in the evident interactions between Reed-Sternberg cells and the background inflammatory cell environment [19]. A huge variety of growth factors, chemokines and cytokines exists in this environment and play an essential role in the progression of the disease [20]. The local immune reaction in HL has been previously addressed as the most prominent among all tumors, with a few exceptions [21]. It is important to note however that CHL resembles a spectrum, and that LDCHL is an aggressive subtype partly due to the absence of an adequate immune microenvironment, which means an absence of an effective anti-tumor response [21]. A particular single nucleotide polymorphism (SNP) on Toll-Like Receptor 9 (TLR9) has been the center of multiple studies that analyzed its relation to lymphoma formation; this SNP is rs5743836 (TLR9-1237T>C). In the aforementioned studies, results have demonstrated that this SNP either shows no association with the risk of HL development or significantly increased the risk of developing HL and NHL [22-24]. Tumor development, growth and response to treatment is influenced by the surrounding proinflammatory microenvironment. TLR activation plays an important role in immune-response mediation [25, 26]. Disruption of TLR function promotes cancer development by evading immune system, and over activation of TLR may play an important role in inhibition of cancer evolution [27]. CPGs motifs are commonly found in bacterial DNA but not vertebrate DNA. Additionally, CpGs motifs in bacterial DNA are mostly un-methylated. The recognition of un-methylated foreign CPGs motifs in bacterial DNA and triggering an innate immune response occurs through TLR9 protein [28, 29]. Normal B lymphocytes and neoplastic lymphoma cells of small lymphocytic lymphoma, mantle cell lymphoma, follicular lymphoma and diffuse large be cell lymphoma, all have been reported to express TLR9 [30, 31]. CpG oligonucleotides are considered TLR9 agonist and stimulate TLR9 expression. Signaling through TLR9 stimulation by exogenous or endogenous ligands plays a fundamental role in host immune-response and subsequently lymphoma risk [32]. Signaling of TLR pathways are basically NF-kB dependent [33]. People carrying the variant “C” allele of rs5743836 TLR9 promoter polymorphism (TLR9-123C) show increased TLR9 mRNA expression, transcriptional activity and deregulated immunological response secondary to increased binding affinity of TLR9 to NF-κB by creation of a potential NF-κB binding site [34]. The aim of this study was to examine the relationship between a selected SNP in TLR9 (TLR9-1237T>C) and the risk and overall survival of HL patients in a Jordanian Arab population.

Material and methods

Patients and data collection

This is a retrospective cross-sectional study examine the relationship between rs5743836 (TLR9-1237T>C) polymorphism and the risk and survival of Hodgkin lymphoma patients among an Arab Jordanian population. The study population was composed of one hundred and thirty-six (136) patients and two hundred and thirty-eight (238) healthy cancer-free control subjects with similar geographic and ethnic backgrounds to the patients. The 136 cases of HL were retrieved from the archives of King Abdullah University Hospital during the period of 2013 to 2019. All cases were reviewed by (SK) and one representative section was chosen from each case. The human ethics approval was attained by the ethical committee of Jordan University of Science and Technology [Institutional Review Board (IRB) code number 5/106/2017, dated 8/06/2017] in accordance with the 1964 Declaration of Helsinki and its later amendments. Formal written informed consent was not required with a waiver by the IRB. All control subjects were voluntarily involved and signed written informed consent. Cases’ and controls’ names were coded and blinded and treated confidentially. For the patients (minors and adults); formal written informed consent was not required with a waiver by the IRB. All control subjects were voluntarily involved and a signed written informed consent was obtained by all control subjects or their parents/guardians (for minors). Cases’ and controls’ names were coded and blinded and treated confidentially.

DNA analysis

The commercially available DNeasy Blood & Tissue Kit (Qiagen Ltd., West Sussex, UK) was used, and according to manufacturer’s protocol, to DNA extraction for the HL patients from formalin-fixed paraffin-embedded tissue. Genomic DNA from control-subjects’ blood samples was extracted using the QIAamp® or Promega DNA Mini Kit according to the manufacturer’s instruction. The quality of extracted DNA was examined using agarose gel electrophoresis and ethidium bromide staining. The concentration and purity of extracted DNA were assessed using a NanoDrop 1000® spectrophotometer. The SNP was genotyped using the Sequenom MassARRAY® system (iPLEX GOLD). The pure DNA samples with their concentrations were sent to the Australian Genome Research Facility (AGRF, Melbourne Node, Melbourne, Australia) for genotyping of SNP rs5743836 (TLR9-1237T>C) in all subjects (patients and controls). The SNP, SNP’s position, and primer sequences for TLR9 gene are shown in Table 1. Genotyping with the Sequenom MassARRAY® system (iPLEX GOLD) (Sequenom, San Diego, CA, USA) was performed at the AGRF according to the manufacturer’s recommendations (Sequenom, San Diego, CA, USA). Genotype distributions were compared between patients and controls. Unconditional logistic regression analysis was used to estimate the association between the genotype frequency and the risk of developing HL.
Table 1

The SNP, SNP’s position and primer sequences for TLR9 gene.

SNP-IDGeneChr^bp*Primer ForwardPrimer Reverse
rs5743836TLR9352226766 ACGTTGGATGTTGGGATGTGCTGTTCCCTC ACGTTGGATGAGCAGAGACATAATGGAGGC

* bp: base pair (Genomic Position).

^ Chr: Chromosome.

* bp: base pair (Genomic Position). ^ Chr: Chromosome.

Statistical analysis

Overall survival (OS) was calculated from the date of diagnosis to the date of death or the last visit for those who were alive at the time of final data collection and analysis. The Statistical Package for Social Sciences IBM SPSS Statistics for Windows version 20.0 (IBM Corp., Armonk, NY, USA) was used to identify the genotypic and allelic associations. The clinical characteristics and response rate of the patients were compared using chi-square tests. The Hardy–Weinberg equilibrium (HWE) test was estimated by a goodness-of-fit χ2 test. The Kaplan–Meier method was used to construct survival curves, and the results were compared using a log-rank/Wilcoxon (Gehan) statistic. The association between polymorphism and the risk for HL was calculated using unconditional logistic regression. The survival curves were displayed using Graph Pad Prism 6 software. All significant variables (p < 0.05) were entered into a multivariate model to adjust for possible confounders.

Results

Demographic and clinical characteristics of the study population

A total of 374 subjects were included in the study and their DNA samples collected. Of these 374 subjects, 136 were cases (HL patients) and 238 were controls. The case group had a mean age (and range) of 30.7 years (3–78), and was comprised 87 males (64%) males and 49 females (36%). On the other hand, the control group had mean age (and range) of 43.2 years (6–89), and was contained 92 males (38.7%) and 146 females (61.3%). The case group had a lower age mean and a higher proportion of males. Of the 374 DNA samples, 10 (6 from case group and 4 from control group) didn’t yield sequencing results and were omitted from the statistical tests. Eventually 130 cases and 234 controls were statistically tested. The 130 HL cases were of the following histological subtypes: mixed cellularity (MC– 58 cases [45%]), nodular sclerosis (NS– 52 cases [40%]), lymphocyte rich (LR– 14 cases [11%]), lymphocyte depleted (LD– 3 [2%]), and finally the non-classical nodular lymphocyte predominant (NLPHL– 3 [2%]). The demographic and clinical data of all subjects is summarized in Table 2.
Table 2

Demographic and clinical data of the 136 cases and 238 controls enrolled in the study.

Demographic DataCases N (%)Controls N (%)
    Gender  
    Male87 (64)92 (38.7)
    Female49 (36)146 (61.3)
Age in Years *   
    0–1423 (16.9)3 (1.3)
    15–1919 (14)18 (7.6)
    20–4054 (39.7)89 (37.4)
    41–5526 (19.1))59 (24.8)
    >5514 (10.3)69 (28.9)
   
    Mean (Range)30.735 (3–78)43.2 (6–89)
    Median (IQR)28 (18–43)44 (24.2–57)
Clinical Data   
Survival Status   
    Alive118 (86.8)----
    Dead18 (13.2)----
Survival (Months)  ----
    MedianNot reached**----
Type of Lymphoma  ----
    LR15 (11)----
    MC61 (44.9)----
    NS55 (40.4)----
    LD2 (1.5)----
    NLPHL4 (2.2)----
B-Symptoms    
    Yes23 (16.9)----
    No67 (49.3)----
    No data found5 (3.7) 
    Missing41 (30.1) 
Serum Albumin (g/L)  ----
    Mean (Range)38.111 (15–54.2)----
    Median (IQR)39 (34–42.85)----
Serum LDH (IU/L)   
    Mean (Range)546.559 (207–1561)----
    Median (IQR)486 (374–677)----
ESR (mm/hr)   
    Mean (Range)63.714 (2–153)----
    Median (IQR)61.5 (30.5–100)----

LR: Lymphocyte rich; MC: Mixed cellularity; NS: Nodular Sclerosis; LD: Lymphocyte Depleted; NLPHL: Nodular lymphocyte-predominant Hodgkin’s lymphoma; ESR: Erythrocyte sedimentation rate.

*Age of controls vs age at diagnosis in cases

**More than half of the cases population was alive at time of analysis.

LR: Lymphocyte rich; MC: Mixed cellularity; NS: Nodular Sclerosis; LD: Lymphocyte Depleted; NLPHL: Nodular lymphocyte-predominant Hodgkin’s lymphoma; ESR: Erythrocyte sedimentation rate. *Age of controls vs age at diagnosis in cases **More than half of the cases population was alive at time of analysis.

Genotype distributions and association with risk of HL

The distribution of rs5743836 (TLR9-1237T>C) in both the HL patients and the control group was in Hardy-Weinberg Equilibrium (HWE), with a p-value > 0.05 (p = 0.34 for control group). This eliminates the chance of stratification error during genotyping. The results show how a statistically significant higher frequency of rs5743836 allele T among patients, with a p-value of 0.02 (<0.05). This distribution proved significant when studied in the codominant (only significant in the A/G genotype, p-value = 0.030), dominant (p-value = 0.025), and overdominant (p-value = 0.035) models. The odds ratio (OR) value was 1.78 (95% confidence interval [1.08, 2.93]), 1.77 (95% confidence interval [1.10, 2.86]), and 1.75 (95% confidence interval [1.07, 2.87]), respectively. These results support an almost two-fold increase in risk of developing HL associated with the rs5743836 (TLR9-1237T>C) SNP. Findings are summarized in Tables 3 and 4.
Table 3

Allele and genotype frequency in cases and controls.

SNP rs5743836 Case: N (%) Control: N (%) P-value
Allele T213 (82)412 (88)0.031
Allele C47 (18)56 (12)
Genotype T/T87 (66.9)183 (78.2)0.062
Genotype T/C39 (30)46 (19.7)
Genotype C/C4 (3.1)5 (2.1)
Table 4

Testing the association between risk of HL and SNP rs5743836 by finding odds ratio (OR) for different genetic models with confidence interval (CI) of 95%.

Genetic modelGenotypeCase: N (%)Control N (%)OR (95% CI)P-value
CodominantT/T87 (66.9)183 (78.2)1 
 T/C39 (30)46 (19.7)1.78 (1.08–2.93)0.03
 C/C4 (3.1)5 (2.1)1.68 (0.44–6.42)0.683
DominantT/T87 (66.9)183 (78.2)1
T/C-C/C43 (33.1)51 (21.8)1.77 (1.10–2.86)0.025
RecessiveT/T-T/C126 (96.9)229 (97.9)1 
 C/C4 (3.1)5 (2.1)1.45 (0.38–5.51)0.84
OverdominantT/T-C/C91 (70)188 (80.3)1
T/C39 (30)46 (19.7)1.75 (1.07–2.87)0.035

Genotype distributions and association with survival

None of the models showed any statistically significant difference in survival associated with the rs5743836 (TLR9-1237T>C) SNP (Fig 1).
Fig 1

Overall survival (OS) for 130 HL patients according to SNP rs5743836 in different genetic models.

Top row from left to right: (a) Comparison among CC, TT, and CC in the codominant model (p-value = 0.58). (b) Comparison among TC and CC/TT in the overdominant model (p-value = 0.42). Bottom row from left to right: (a) Comparison among TT and CC/TC in the dominant model (p-value = 0.66). (b) Comparison among CC and TT/TC in the recessive model (p-value = 0.32). All p-values indicated were Wilcoxon (Gehan) Statistic.

Overall survival (OS) for 130 HL patients according to SNP rs5743836 in different genetic models.

Top row from left to right: (a) Comparison among CC, TT, and CC in the codominant model (p-value = 0.58). (b) Comparison among TC and CC/TT in the overdominant model (p-value = 0.42). Bottom row from left to right: (a) Comparison among TT and CC/TC in the dominant model (p-value = 0.66). (b) Comparison among CC and TT/TC in the recessive model (p-value = 0.32). All p-values indicated were Wilcoxon (Gehan) Statistic.

Discussion

This study investigated a TLR9 SNP and its association with both the risk and prognosis of HL. When the SNP rs5743836 (TLR9-1237T>C) was examined among both the case and the control groups, our results showed an almost two-fold risk of HL associated with this genotype, statistically significant in the dominant and the overdominant models. However, statistical analysis showed no significant impact of this SNP on the prognosis of HL in patients enrolled in the study. Due to TLRs’ established role in both the immune response and the progression of cancers, as well as TLR9’s established role in some autoimmune inflammatory diseases, many studies have investigated the role of genetic polymorphisms in TLR9 and their corresponding effects on risk of cancer development [22, 23, 35]. Some of these studies have investigated this particular variable specifically in the context of the risk of developing HL and NHL [22, 23]. Fewer studies have investigated the associated risk of TLR9 polymorphism on lymphoma development in the Arab region [36]. However, there seems to be no studies examining the impact of TLR9 polymorphisms on both the risk and prognosis of HL patients, especially among an Arab population. SNP rs5743836 (TLR9-1237T>C) was the center of many studies investigating its association with the risk of developing both HL and NHL [22, 23]. A study demonstrated a population-dependent impact of this SNP on developing NHL, as the Italian and the Portuguese had a significant risk (odds ratio) of 1.84 and 1.85 respectively (p-values: 7.3E−9 and 7.3E−9 respectively), while no significant correlation was seen in the US cohort of NHL patients [22]. On the other hand, another study showed that this SNP had a significant odds ratio (p-value = 0.01) of 1.99 (95% confidence interval [1.18–3.36]) of developing HL in the Greek population [23]. Both of these studies support the clearly identifiable link between the TLR9 immunity component and lymphomagenesis. Although in the context of this paper, the study of HL among the Greek population provides more supportive value as it shows a two-fold risk associated with this SNP, as was found when statistically analyzing our results. TLRs are a family of receptors that function in the innate immune response and are part of the earliest surveillance methods that respond to infection. Humans are known to possess a family that consists of 10 different TLRs [37]. These early immune receptors are also given the name pattern-recognition receptors (PRRs) due to their specialized role in detecting pathogen-associated molecular patterns (PAMPs) as well as damage-associated molecular patterns (DAMPs). PAMPs are displayed by infectious organisms while DAMPs are self-derived molecules released from damaged cells. TLRs are expressed by phagocytic innate immune cells such as macrophages and dendritic cells (DCs), as well as non-immune cells which include epithelial cells and fibroblasts. This family of receptors is further divided into two subfamilies: intracellular TLRs and cells surface TLRs. Intracellular TLRs (3, 7, 8 and 9 in humans) primarily act on viral detection through the recognition of foreign nucleic acids. Recent studies have found that these actions can be misdirected towards self-derived nucleic acids in autoimmune diseases such as systemic lupus erythematosus (SLE) and psoriasis [17, 18]. TLR9 in particular is concerned with recognizing non-methylated CG dinucleotides (CpG DNA motifs), which are extremely more common in prokaryotic cells than in eukaryotic cells, hence this receptor chiefly controls responses to bacterial DNA as well as DNA of some viruses [38]. In general, TLRs’ role has been described as a double edged sword in the development of cancers; DAMPs alert the immune system to the presence of neoplastic cells while simultaneously inducing chronic inflammation that can escalate the cancer’s progression [39]. Furthermore, one of the main pathogenic features of HL is NF-kB activation, which is directly induced by EBV’s LMP1 and indirectly stimulated by TLR9’s response to EBV infection [23, 40]. This may provide solid ground for justifying the significant association of TLR9 with development of HL.

Conclusion

In this study, we demonstrated in our Jordanian Arab sample that the risk of HL was almost two-fold in those with the SNP rs5743836 (TLR9-1237T>C), when examined in the dominant, codominant and overdominant models (p-values are 0.025, 0.030 and 0.035 respectively). The study found no significant association between this SNP and the overall survival of HL patients in the sample studied. In spite of the significant associations between the SNP rs5743836 (TLR9-1237T>C) and the development HL that were discovered in our study and further supported by other studies as discussed previously, several weaknesses existed in the methodology of this study. Firstly, the loss of data–that was discussed previously–from both the control and case groups in unequal amounts, either due to invalid DNA sampling results or loss of sample, has potential to weaken the findings. Secondly, the small sample size of 374 subjects (of which 136 were cases and 238 were controls), which can make it questionable to infer the predicted association on the general population. To put this in context: to confidently (CI = 95%) detect a relatively small influence (OR = 1.2) of a genetic polymorphism present in 10% of the population, 15 000 case-control pairs at least are to be included in a single study [41]. This large number of patients is not comparable to the number included in the study, and is largely beyond the capabilities of the medical institution this research study was conducted at (and many others for that matter). A possible improvement to this is conducting meta-analyses in the future, where pooled data from collaborative studies would provide tremendous numbers of subjects that would enhance the significance of inferred findings [41]. (XLSX) Click here for additional data file. 23 May 2022
PONE-D-22-13603
The impact of SNP rs5743836 of TLR9 on the risk and prognosis of Hodgkin’s Lymphoma: a case-control study
 
PLOS ONE Dear Dr. Al Khatib, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Please submit your revised manuscript by Jul 07 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Alvaro Galli Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. You indicated that you had ethical approval for your study. In your Methods section, please ensure you have also stated whether you obtained consent from parents or guardians of the minors included in the study or whether the research ethics committee or IRB specifically waived the need for their consent. 3. Thank you for stating the following financial disclosure: The study was supported by the Jordan University of Science and Technology Grant number 20170225 Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript Al-Khatib et al. evaluated the frequency of TLR9 SNP rs5743836 in Hodgkin Lymphoma patients. Although scientifically sounds, the manuscript has several points that should be addressed: The title of the manuscript is misleading since no association of the evaluated SNP was observed concerning HL prognosis. Although authors claim that “particular single nucleotide polymorphism (SNP) on Toll-Like Receptor 9 (TLR9) has been the center of multiple studies that analyzed its relation to lymphoma formation; this SNP is rs5743836 (TLR9-1237T>C). In the aforementioned studies, results have demonstrated that this SNP significantly increased the risk of developing HL and NHL.” they forgot to mention references that find no association if this specific SNP and HL (see, for example, Martin et al. Leuk Lymphoma. 2017 Feb;58(2):438-444. doi: 10.1080/10428194.2016.1190972.) What should be the connection between rs5743836 and HL? Why to evaluate this and not other TLR9 variants (or any other gene variants)? The question is: What is the biological reason for choosing this gene variant? All these points were only superficially approached in the Discussion, but should be deeply presented in Introduction. I was quite puzzled by the nomenclature used. Why authors refer to SNP TLR9-1237T>C but A/G genotypes? Please, standardize the manuscript nomenclature. It is quite difficult to follow the results comparing allele versus genotype (in fact, there is some confusion between alleles and genotypes all along the manuscript, please revise this point). Please, revise the manuscript concerning the way results are described. For example, instead of saying “...a statistically significant higher distribution of the rs5743836”, I would suggest to say “how a statistically significant higher frequency of rs5743836 allele A among patients”. In fact, a qui-square testing with Yate’s correction resulted in a p = 0.031. Please, review calculations. Considering the acknowledged relation of EBV infection and HL development, I would expect data concerning EBV positivity in this cohort. As highlighted by the authors, sample size is extremely low. As comparison, the reported study from Carvalho et al, back in the 2012’s included three distinct cohorts encompassing respectively 797 Portuguese, 494 Italian and 868 US patients. In this context, besides significance, I wonder about the originality/novelty of the present study. Reviewer #2: Dear Author, Please mention the possible relationship between genotypes and clinical parameters. And also you should give information about how this base change affects the TLR-9 gene function. Best Regards ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 4 Jul 2022 June 26, 2022 Academic editor, RE: Manuscript PONE-D-22-13603 Dear Alvaro Galli. Academic Editor PLOS ONE Thank you for giving me the opportunity to submit a revised draft of my manuscript titled “The impact of SNP rs5743836 of TLR9 on the risk and prognosis of Hodgkin’s Lymphoma: a case-control study”. We greatly appreciate the reviewers for their complimentary, insightful comments and suggestions. We have carried out the changes that the reviewers suggested and revised the manuscript accordingly. Please find the attached point-by-point response to reviewers concerns. We hope that you find our responses satisfactory and that the manuscript is now acceptable for publication. Sincerely Sohaib M. Al-Khatib, M.D. Associate Professor Department of Pathology and Laboratory Medicine Jordan University of Science and Technology E-mail: smkhatib4@just.edu.jo Response to Journal Additional requirements We appreciate the respected comments. The following are our point-by- point responses. Point 1: Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. Response 1: Efforts taken to make sure that the manuscript meets PLOS ONE’s style requirements. Point 2: You indicated that you had ethical approval for your study. In your Methods section, please ensure you have also stated whether you obtained consent from parents or guardians of the minors included in the study or whether the research ethics committee or IRB specifically waived the need for their consent. Response 2: Formal written informed consent was not required with a waiver by the IRB. All control subjects were voluntarily involved and signed written informed consent. Cases’ and controls’ names were coded and blinded and treated confidentially. The Methods section included the above statement (I. 137-140 in revised version with track changes and l. 126-129 in corrected clean version). Point 3: Thank you for stating the following financial disclosure: The study was supported by the Jordan University of Science and Technology Grant number 20170225. Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Response 3: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Response to Reviewer 1 Comments We appreciate the respected reviewer comments. The following are our point-by- point responses. Point 1: The Title of the manuscript is misleading since no association of the evaluated SNP was observed concerning HL prognosis. Response 1: Agree with the respected reviewer. I have, accordingly, modified the Title into “Association of TLR9-1237T>C; rs5743836 polymorphism with increased risk of Hodgkin’s Lymphoma: a case-control study” (I. 1-2 in revised version with track changes and l. 1-2 in clean corrected version). Point 2: Although authors claim that “particular single nucleotide polymorphism (SNP) on Toll-Like Receptor 9 (TLR9) has been the centre of multiple studies that analysed its relation to lymphoma formation; this SNP is rs5743836 (TLR9-1237T>C). In the aforementioned studies, results have demonstrated that this SNP significantly increased the risk of developing HL and NHL.” they forgot to mention references that find no association of this specific SNP and HL (see, for example, Martin et al. Leuk Lymphoma. 2017 Feb;58(2):438-444. doi: 10.1080/10428194.2016.1190972.) Response 2: Thank you for pointing this out. I agree with this comment. Therefore, the following sentence about studies and corresponding references that find no association of SNP rs5743836 (TLR9-1237T>C) and HL has been included in the Introduction (I. 99-100 in revised version with track changes and l. 87-89 in clean corrected version) “In the aforementioned studies, results have demonstrated that this SNP either shows no association with the risk of HL development or significantly increased the risk of developing HL and NHL (22-24)” Point 3: What should be the connection between rs5743836 and HL? Why to evaluate this and not other TLR9 variants (or any other gene variants)? The question is: What is the biological reason for choosing this gene variant? All these points were only superficially approached in the Discussion, but should be deeply presented in Introduction. Response 3: Thank you for pointing this out. The following paragraph which answers the reviewer’s points has been included in the Introduction (I. 101-118 in revised version with track changes and l. 90-107 in clean corrected version). “Tumor development, growth and response to treatment is influenced by the surrounding proinflammatory microenvironment. TLR activation plays an important role in immune-response mediation (25, 26). Disruption of TLR function promotes cancer development by evading immune system, and over activation of TLR may play an important role in inhibition of cancer evolution(27). CPGs motifs are commonly found in bacterial DNA but not vertebrate DNA. Additionally, CpGs motifs in bacterial DNA are mostly un-methylated. The recognition of un-methylated foreign CPGs motifs in bacterial DNA and triggering an innate immune response occurs through TLR9 protein (28, 29). Normal B lymphocytes and neoplastic lymphoma cells of small lymphocytic lymphoma, mantle cell lymphoma, follicular lymphoma and diffuse large be cell lymphoma, all have been reported to express TLR9 (30, 31). CpG oligonucleotides are considered TLR9 agonist and stimulate TLR9 expression. Signaling through TLR9 stimulation by exogenous or endogenous ligands plays a fundamental role in host immune-response and subsequently lymphoma risk (32). Signaling of TLR pathways are basically NF-kB dependent (33). People carrying the variant “C” allele of rs5743836 TLR9 promoter polymorphism (TLR9-123C) show increased TLR9 mRNA expression, transcriptional activity and deregulated immunological response secondary to increased binding affinity of TLR9 to NF-κB by creation of a potential NF-κB binding site (34)”. Point 4: I was quite puzzled by the nomenclature used. Why authors refer to SNP TLR9-1237T>C but A/G genotypes? Please, standardize the manuscript nomenclature. It is quite difficult to follow the results comparing allele versus genotype (in fact, there is some confusion between alleles and genotypes all along the manuscript, please revise this point). Response 4: Agree with the respected reviewer. The manuscript nomenclature has been standardized. Point 5: Please, revise the manuscript concerning the way results are described. For example, instead of saying “...a statistically significant higher distribution of the rs5743836”, I would suggest to say “how a statistically significant higher frequency of rs5743836 allele A among patients. Response: Agree with the respected reviewer. The sentence has been rephrased into “how a statistically significant higher frequency of rs5743836 allele T among patients “(l. 204-205 in revised version with track changes and l. 193-194 in clean corrected version). Point 5: In fact, a qui-square testing with Yate’s correction resulted in a p = 0.031. Please, review calculations. Response: agree with the respected reviewer, the following is the edited Table 2 with corrected numbers Table 2. Allele and genotype frequency in cases and controls. SNP rs5743836 Case: N (%) Control: N (%) P-value Allele A 213 (82) 412 (88) 0.031 Allele G 47 (18) 56 (12) Genotype A/A 87 (66.9) 183 (78.2) 0.062 Genotype A/G 39 (30) 46 (19.7) Genotype G/G 4 (3.1) 5 (2.1) Point 6: Considering the acknowledged relation of EBV infection and HL development, I would expect data concerning EBV positivity in this cohort. Response: Unfortunately, the EBV status among our study patients’ group was not reported in patients’ medical records/pathology reports. Point 7: As highlighted by the authors, sample size is extremely low. As comparison, the reported study from Carvalho et al, back in the 2012’s included three distinct cohorts encompassing respectively 797 Portuguese, 494 Italian and 868 US patients. In this context, besides significance, I wonder about the originality/novelty of the present study. Response: We agree with the respected reviewer that the sample size is small. However; the respected reviewer comparison with the reported study from Carvalho et al is invalid as Carvalho et al study is dealing with non-Hodgkin lymphoma (NHL) cases and our study is dealing with Hodgkin lymphoma (HL) cases. By reviewing the reported studies of r5743836 polymorphism in TLR9 among HL patients, we found that the sample size of our study is among the largest. We think that the efficacy of the study is still statistically valid. Response to Reviewer 2 Comments We appreciate the respected reviewer comments. The following are our point-by- point responses. Point: Please mention the possible relationship between genotypes and clinical parameters. And also you should give information about how this base change affects the TLR-9 gene function. Response 1: Thank you for pointing this out. Regarding studying the possible relationship between genotypes and clinical parameters, unfortunately that was not statistically possible because all samples when sent to the Australian Genome Research Facility (AGRF, Melbourne Node, Melbourne, Australia) for genotyping of SNP rs5743836 (TLR9-1237T>C) were sent in anonymous order not linked to corresponding clinical data. For information about how base change affects the TLR-9 gene function, the following sentence has been added “ People carrying the variant “C” allele of rs5743836 TLR9 promoter polymorphism (TLR9-123C) show increased TLR9 mRNA expression, transcriptional activity and deregulated immunological response secondary to increased binding affinity of TLR9 to NF-κB by creation of a potential NF-κB binding site (34)” (l. 115-118 in in revised version with track changes and l. 104-107 in clean corrected version). 18 Jul 2022 Association of TLR9-1237T>C; rs5743836 polymorphism with increased risk of Hodgkin’s Lymphoma: a case-control study PONE-D-22-13603R1 Dear Dr. Al Khatib, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Alvaro Galli Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: All comments previously made by this reviewer were adequately approached in this new version. Specifically, the manuscript title was changed; a mention to studies who did not found association between the evaluated gene polymorphism and HD was added; the choice for this specific polymorphism was justified at Introduction with data from the literature; some misleading nomenclature were corrected; and some statistical data were also revised. Concerning the absence of data about EBV positivity in this cohort, I understand that authors are not able to come back to the original patients to include this point, and I also agree with authors concerning comparisons with the study from Carvalho et al. Minor points that I would suggest, would be the inclusion of data from Table 1 at the text (under the section Material and Methods), and a review of the English-language usage and grammar, although these two points should not hinder the publication, since all methodological and scientific aspects are adequate. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No ********** 21 Jul 2022 PONE-D-22-13603R1 Association of TLR9-1237T>C; rs5743836 polymorphism with increased risk of Hodgkin’s Lymphoma: a case-control study Dear Dr. Al-Khatib: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Alvaro Galli Academic Editor PLOS ONE
  41 in total

Review 1.  Hodgkin's disease and the Epstein-Barr virus.

Authors:  K J Flavell; P G Murray
Journal:  Mol Pathol       Date:  2000-10

Review 2.  Epidemiology and pathologic features of Hodgkin lymphoma.

Authors:  Shin-ichi Nakatsuka; Katsuyuki Aozasa
Journal:  Int J Hematol       Date:  2006-06       Impact factor: 2.490

3.  The rs5743836 polymorphism in TLR9 confers a population-based increased risk of non-Hodgkin lymphoma.

Authors:  A Carvalho; C Cunha; A J Almeida; N S Osório; M Saraiva; M Teixeira-Coelho; S Pedreiro; E Torrado; N Domingues; A G Gomes-Alves; A Marques; J F Lacerda; M G da Silva; M Gomes; A C Pinto; F Torres; P Rendeiro; P Tavares; M Di Ianni; R Medeiros; P Heutink; P M Bracci; L Conde; P Ludovico; J Pedrosa; P Maciel; L Pitzurra; F Aversa; H Marques; A Paiva; C F Skibola; L Romani; A G Castro; F Rodrigues
Journal:  Genes Immun       Date:  2011-08-25       Impact factor: 2.676

Review 4.  Reed-Sternberg cell: survival in a hostile sea.

Authors:  J Cossman; C Messineo; A Bagg
Journal:  Lab Invest       Date:  1998-03       Impact factor: 5.662

Review 5.  A lymphomagenic role for HIV beyond immune suppression?

Authors:  Riccardo Dolcetti; Annunziata Gloghini; Arnaldo Caruso; Antonino Carbone
Journal:  Blood       Date:  2016-01-14       Impact factor: 22.113

6.  Toll-like receptor signaling in anti-cancer immunity.

Authors:  Masato Okamoto; Mitsunobu Sato
Journal:  J Med Invest       Date:  2003-02

7.  Clinical, molecular, and environmental risk factors for hodgkin lymphoma.

Authors:  Alison Maggioncalda; Neha Malik; Pareen Shenoy; Melody Smith; Rajni Sinha; Christopher R Flowers
Journal:  Adv Hematol       Date:  2010-11-29

Review 8.  Epidemiological Overview of Hodgkin Lymphoma across the Mediterranean Basin.

Authors:  Massimiliano Salati; Marina Cesaretti; Matteo Macchia; Mufid El Mistiri; Massimo Federico
Journal:  Mediterr J Hematol Infect Dis       Date:  2014-07-01       Impact factor: 2.576

Review 9.  Epstein-Barr virus and the origin of Hodgkin lymphoma.

Authors:  Martina Vockerodt; Fathima Zumla Cader; Claire Shannon-Lowe; Paul Murray
Journal:  Chin J Cancer       Date:  2014-11-21

Review 10.  Toll-like receptors in systemic autoimmune disease.

Authors:  Ann Marshak-Rothstein
Journal:  Nat Rev Immunol       Date:  2006-11       Impact factor: 53.106

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.