Antibiotic Susceptibility and Resistance Genes in Oral Clinical Isolates of Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica.

The Prevotella genus is a normal constituent of the oral microbiota, and is commonly isolated from mechanically treated polymicrobial infections. However, antibiotic treatment is necessary for some patients. This study compared the antibiotic susceptibility and the presence of resistance genes in clinical oral isolates of P. intermedia, P. nigrescens, and P. melaninogenica. Antibiotic susceptibility was assessed using the agar dilution method. PCR confirmed the species and resistance gene frequency in the Prevotella species. The frequencies of species P. intermedia, P. nigrescens, and P. melaninogenica were 30.2%, 45.7%, and 24.1%, respectively. No isolates of P. intermedia were resistant to amoxicillin/clavulanic acid, tetracycline, or clindamycin. P. nigrescens and P. melaninogenica were resistant to amoxicillin/clavulanic acid and tetracycline at frequencies of 40% and 20%, respectively. P. intermedia was resistant to metronidazole at a frequency of 30%, P. nigrescens at 20%, and P. melaninogenica at 40%. P. nigrescens and P. melaninogenica were resistant to 50% and 10% clindamycin, respectively. The gene most frequently detected was tetQ, at 43.3%, followed by tetM at 36.6%, blaTEM at 26.6%, ermF at 20%, cfxA, cfxA2, and nimAB at 16.6%, and nimAEFI at 3.3%. P. nigrescens was the species with the highest resistance to antibiotics such as amoxicillin/clavulanic acid, amoxicillin, and clindamycin, in addition to being the species with the largest number of genes compared to P. intermedia and P. melaninogenica.

1. Introduction

Prevotella is a genus of Gram-negative, strictly anaerobic bacteria present in the normal oral microenvironment; in polymicrobial oral infections, Prevotella species can function as opportunistic pathogens [1]. In the oral cavity, this genus is associated with chronic periodontitis, pulpal infections, and abscesses of dental or periodontal origin [2,3]. Such infections are treated by eradicating the etiological factors (including the infectious component) through either mechanical instrumentation, the use of chemical elements, or the use of physical agents. Thus, as an adjunctive therapy to mechanical devices, antibiotic treatment plays an essential role in the management of oral infections. The availability of such treatments has led to the development of resistance in Prevotella to the main antibacterial drugs used in dental practice [4].

Antibiotics from the group of beta-lactams are the first choice for treating oral infections, and tetracyclines and macrolides are the second choices. These antibiotics can eradicate most bacteria, and the incidence of adverse reactions is low. Currently, the antimicrobial susceptibility patterns of Prevotella species are not well understood, and existing reports have focused primarily on evaluating resistance to the beta-lactam antibiotics, which are preferred in dental practice. However, the use of combination therapy is increasing over time, leading to resistance to other families of antibiotics. The resistance of Prevotella to beta-lactam antibiotics was reported in 33% of cases, and resistance to clindamycin (CC) was found in 3% of cases [4]. Furthermore, the frequency of amoxicillin (AMX) resistance increased from 30% to 60% between 2011 and 2013 [5,6].

Few researchers have investigated the prevalence of antibiotic resistance genes in Prevotella isolated from human clinical specimens. In 2000, the presence of the tetQ gene was reported in the genera Prevotella and Porphyromonas; this gene confers resistance to antibiotics such as tetracyclines. In infections with anaerobic or protozoal organisms, metronidazole the treatment of choice. Its mechanism of action involves the formation of nitrous radicals that are toxic to these microorganisms. The presence of the drug may cause the expression of the nim gene and its allelic variants, leading to the production of enzymes that prevent the drug from forming nitrous radicals, and contributing to resistance to the drug [7,8]. A 2019 study generated great interest by reporting the prevalence of cfxA (50.5%), tetQ (30.3%), ermF (9.1%), and nim (1.0%) in Prevotella [9].

No studies have linked the effects of antibiotic resistance genes and susceptibility in vitro in isolates from the oral environment. Therefore, it is of great clinical importance to evaluate the presence of genes associated with antibiotic resistance and to make a comparative analysis of their effects and expression patterns by evaluating antibiotic susceptibility in the Prevotella genus, considering its importance in the oral cavity. In addition to the limited published scientific literature on the presence of these genetic components and their relationship with antibiotic susceptibility in these microorganisms, it is essential to have up-to-date epidemiological data on the importance of antibiotic therapy in dental practice. This study aimed to compare the antibiotic susceptibility and presence of resistance genes in Prevotella intermedia, Prevotella nigrescens, and Prevotella melaninogenica.

2. Results

2.1. Frequency of P. intermedia, P. nigrescens, and P. melaninogenica

Five hundred pure and viable isolates of Prevotella spp. were recovered; these were the general sample units. These were used to identify P. intermedia, P. nigrescens, and P. melaninogenica. A sample unit of 162 isolates corresponding to the identified species was used for all analyses (n = 162). Species confirmation was performed using conventional PCR. The species were identified at the following frequencies: P. intermedia 30.2% (n = 49), P. nigrescens 45.7% (n = 74), and P. melaninogenica 24.1% (n = 39).

Isolates were classified by periodontal clinical diagnosis; P. nigrescens and P. melaninogenica were identified in all clinical diagnosis types, including healthy, gingivitis, and periodontitis. In total, 90% of the P. intermedia isolates were in the periodontitis group. The species most associated with healthy states was P. melaninogenica 40% (Table 1).

Table 1

Distribution of isolates by species and periodontal diagnosis.

	Healthy (%)	Gingivitis (%)	Periodontitis (%)
P. melaninogenica	40	30	30
P. nigrescens	10	40	50
P. intermedia	0	10	90

2.2. Evaluation of Antibiotic Susceptibility in Isolates of P. intermedia, P. nigrescens, and P. melaninogenica

Table 2 and Figure 1 show the global antimicrobial resistance to the antibiotics AMX, amoxicillin/clavulanic acid (AMC), metronidazole (MTZ), tetracycline (TE), and CC by agar dilution method, according to the Clinical and Laboratory Standards Institute (CLSI) 2016 [10] standards for the determination of antibiotic susceptibility.

Table 2

Global resistance and minimum inhibitory concentration (MIC) ranges, MIC50, and MIC90 against Prevotella nigrescens, P. intermedia, and P. melaninogenica.

Global Resistance
Antibiotics	n	Range 1 (µg/mL)	MIC 50 2 (µg/mL)	MIC 90 3 (µg/mL)	R
					n (%)
AMX	30	<0.25–>64	0.5	32	13 (43.3)
AMC	30	<0.25–>64	1	16	8 (26.6)
TE	30	<0.25–>64	2	16	4 (13.3)
CC	30	<0.25–>64	0.25	>64	6 (20)
MTZ	30	<0.25–>64	1	>64	9 (30)

AMX: amoxicillin; AMC: amoxicillin/clavulanic acid; TE: tetracycline; CC: clindamycin; MTZ: metronidazole. 1. Antimicrobial range in which inhibition was detected (µg/mL); 2. Minimum Inhibitory Concentration for 50% of isolates; 3. Minimum Inhibitory Concentration for 90% of isolates; S/R sensitivity and resistance range (µg/mL) according to the CLSI (Clinical & Laboratory Standards Institute, 2016) [10] for each antibiotic evaluated.

Figure 1

Frequency of resistance of Prevotella nigrescens, P. intermedia, and P. melaninogenica to the antibiotics evaluated.

Of the isolates of P. intermedia (n = 10), P. nigrescens (n = 10), and P. melaninogenica (n = 10), 20%, 80%, and 30%, respectively, were resistant to AMX. No isolate of P. intermedia was resistant to AMC, TE, or CC. P. nigrescens and P. melaninogenica were resistant to 40% AMC and 20% TE. For MTZ, P. intermedia was resistant to a concentration of 30%, P. nigrescens to a concentration of 20%, and P. melaninogenica to a concentration of 40%. Finally, P. nigrescens was resistant to 50% CC and P. melaninogenica to 10% CC (Figure 1).

Table 3 shows a total of 30 Prevotella isolates and 10 isolates of each species. Different patterns of antibiotic resistance were also observed. For all species, 43.3% (n = 13) were resistant to β-lactam antibiotics such as AMX, and 26.6% (n = 8) were resistant to AMC. Additionally, 13.3% (n = 4) of the isolates were resistant to TE and 30% (n = 9) of the isolates were resistant to MTZ. For lincosamides, 20% (n = 6) of isolates were resistant to CC.

Table 3

Minimum inhibitory concentration (MIC) ranges and MIC50 and MIC90 for the tested antimicrobial drugs against Prevotella nigrescens, P. intermedia, and P. melaninogenica in oral isolates.

Prevotella intermedia
Antibiotics	n	Range 1 (µg/mL)	MIC 50 2 (µg/mL)	MIC 90 3 (µg/mL)	R
					n (%)
AMX	10	<0.25–8	<0.25	4	2 (20)
AMC	10	<0.25–2	<0.25	1	0
TE	10	<0.25–4	<0.25	4	0
CC	10	<0.25–4	<0.25	1	0
MTZ	10	<0.25–>64	1	>64	3 (30)
Prevotella nigrescens
Antibiotics	n	Range 1 (µg/mL)	MIC 50 2 (µg/mL)	MIC 90 3 (µg/mL)	R
					n (%)
AMX	10	<0.25–>64	16	64	8 (80)
AMC	10	0.5–>64	4	64	4 (40)
TE	10	<0.25–16	2	16	2 (20)
CC	10	<0.25–>64	1	>64	5 (50)
MTZ	10	<0.25–64	1	32	2 (20)
Prevotella melaninogenica
Antibiotics	n	Range 1 (µg/mL)	MIC 50 2 (µg/mL)	MIC 90 3 (µg/mL)	R
					n (%)
AMX	10	<0.25–32	0.25	16	3 (30)
AMC	10	<0.25–64	2	32	4 (40)
TE	10	<0.5–>64	2	64	2 (20)
CC	10	<0.25-64	0.25	1	1 (10)
MTZ	10	<0.25–>64	2	>64	4 (40)

AMX: amoxicillin; AMC: amoxicillin/clavulanic acid; TE: tetracycline; CC: clindamycin; MTZ: metronidazole. 1 Antimicrobial range in which inhibition was detected (µg/mL); 2 Minimum Inhibitory Concentration for 50% of isolates; 3 Minimum Inhibitory Concentration for 90% of isolates; S/R sensitivity and resistance range in (µg/mL) according to the CLSI (Clinical & Laboratory Standards Institute, 2016) [10] for each antibiotic evaluated.

In the 30 Prevotella isolates evaluated, the inhibition range was 0.25–64 µg/mL for AMX; the minimum inhibitory concentration MIC50 was <0.5 µg/mL, while the MIC90 was 32 µg/mL. For AMC, the inhibition range was 0.25–64 µg/mL; the MIC50 was 1 µg/mL; and the MIC90 was 32 µg/mL. For TE, an inhibition range of 0.25–64 µg/mL was observed, the MIC50 was <2 µg/mL, and the MIC 90 was 16 µg/mL. For MTZ, the inhibition range was 0.25–64 µg/mL; the MIC50 was 1 µg/mL; and the MIC90 was >64 µg/mL. For CC, the inhibition range was 0.25–64 µg/mL; the MIC50 was 0.25 µg/mL; and the MIC90 > 64 µg/mL (Table 3).

2.3. Prevalence of Resistance Genes in P. intermedia, P. nigrescens, and P. melaninogenica

Table 4 shows the prevalence of resistance genes in the 30 isolates. Genes associated with resistance to β-lactam antibiotics (such as cfxA, cfxA, and bla), to tetracyclines (such as tetM and tetQ), to macrolides and CC (such as ermF), and to nitroimidazoles (such as nimAB and nimAEFI) were detected in isolates of P. intermedia, P. nigrescens, and P. melaninogenica. The most frequently detected genes were tetQ (in 43.3% of isolates), tetM (in 36.6% of isolates), bla (in 26.6% of isolates), ermF (in 20% of isolates), cfxA, cfxA, and nimAB (in 16.6% of isolates), and nimAEFI (in 3.3% of isolates).

Table 4

Frequency of genes cfxA, cfxA and nimAEFI in 30 oral isolates of Prevotella intermedia, P. nigrescens, and P. melaninogenica.

Bacteria	n	cfxA F (%)	cfxA2 F (%)	blaTEM F (%)	tetM F (%)	tetQ F (%)	nimAB F (%)	nimAEFI F (%)	ermF (%)
P. intermedia	10	0	0	2 (20)	4 (40)	4 (40)	1 (10)	0	0
P. nigrescens	10	4 (40)	1 (10)	4 (40)	3 (30)	7 (70)	3 (30)	1 (10)	4 (40)
P. melaninogenica	10	1 (10)	4 (40)	2 (20)	4 (40)	2 (20)	1 (10)	0	2 (20)
Total	30	5 (16, 6)	5 (16, 6)	8 (26, 6)	11 (36, 6)	13 (43, 3)	5 (16, 6)	1 (3, 3)	6 (20)

In P. intermedia, the TE resistance genes tetQ and tetM were detected most frequently (40%), followed by bla (20%) and nimAB (10%). However, cfxA, cfxA, and nimAEFI were not detected. For P. nigrescens, tetQ was detected in 70% of isolates, cfxA, bla and ermF in 40% of isolates, tetM and nimAB in 30% of isolates, and less frequently, cfxA in 10% of isolates. In P. melaninogenica, tetM and cfxA were detected most frequently (40%), followed by bla, tetQ, and ermF (20%), and cfxA and nimAB (10%). nimAEFI was not detected.

The general frequency of resistance genes in the 162 isolates was analyzed and is included in the supplementary materials (Table S1).

2.4. Genotype–Phenotype Relationship of P. intermedia, P. nigrescens, and P. melaninogenica Isolates

The heatmap shows the genotype–phenotype relationships of the 30 isolates of Prevotella, and genes grouped by antibiotic class demarcated by gene names: cfxA, cfxA, and bla (β-lactam); TetM and TetQ (tetracyclines); ermF (macrolide-lincosamide); nimAB and nimAEFI (nitroimidazole). The different colors indicate: gene present and phenotype observed (red), gene present but phenotype not observed (orange), gene absent and phenotype observed (yellow), and gene absent and phenotype not observed (green) (Figure 2).

Figure 2

Heat map of the summary of the genotype–phenotype relationships of the P. intermedia, P. nigrescens, and P. melaninogenica isolates.

In this study, approximately 43.3% (13 out of 30) of the Prevotella isolates were simultaneously resistant to more than two antibiotics. Of the thirty isolates of Prevotella analyzed, a total of nine isolates did not show resistance to any of the antibiotics evaluated (30%), eight isolates were resistant to at least one antibiotic (26.6%), ten isolates showed resistance to at least two antibiotics (33.3%) and three were resistant to three antibiotics (10%).

P. intermedia showed a sensitive phenotype without genes associated with resistance, except for isolates 4 and 8, which presented a phenotype and genotype associated with resistance to beta-lactams and nitroimidazoles, respectively. Although isolates 9 and 10 did not present any resistance genes, they presented resistance to β-lactams and nitroimidazole.

In P. nigrescens, six of the ten isolates have genes for resistance to beta-lactams, tetracyclines, and lincosamides and they were alsoresistant to these antibiotics. They are indicated by a yellow profile, where resistant isolates predominate without the observed genotype. None of these isolates presented a phenotype resistant to nitroimidazoles.

Finally, in the isolates of P. melaninogenica, isolate 2 was the only one that did not present a resistant genotype and phenotype. Five species isolates have a beta-lactam and nitroimidazole resistant phenotype and genotype. In contrast, most of the isolates have a resistant phenotype for one of the three families of antibiotics evaluated, but do not present a genotype.

3. Discussion

The most frequently prescribed antibiotics in dentistry are beta-lactams, like penicillin, and amoxicillin. These antibiotics remain the most practical option to prescribe to adults for odontogenic infections. It is estimated that more than 75% of antimicrobial prescriptions are made inappropriately, and only about 50% of the patients take their medicines correctly. The widespread use of antimicrobial therapy, which is often unnecessary and inaccurate, may affect the development of microbial resistance [11].

This study investigated the extent of antibiotic susceptibility in Prevotella species isolated from the oral cavity, and the frequency of resistance genes present in these species. Prevotella species, members of the oral microbiota, are anaerobic and difficult to culture. In the 500 isolates analyzed, P. nigrescens was the most prevalent species, supporting previous work which isolated this species more frequently, followed by P. intermedia and P. melaninogenica [12,13,14]. However, the present study also detected other species at low frequencies, such as P. buccae, P. denticola, and P. disiens. These species are generally a part of the normal oral microbiota, and frequently participate in oral infections. In periodontal abscesses, 70% of the isolates corresponded to the genus Prevotella, and ermF, cfxA, and nim were frequently detected [12].

The results of the present study confirm that Prevotella could be an important reservoir of antibiotic resistance genes, such as cfxA, cfxA2, bla, tetM, tetQ, ermF, and nim, which are associated with resistance to the antibiotics that are used as the first and second choices in dentistry, such as beta-lactams, macrolides, and lincosamides [4,15,16]. Additionally, the presence of these genes is related to the phenotypic results of antibiotic susceptibility.

Beta-lactamase production can be encoded by several genes, such as cfxA/cfxA2, cblA, cepA, cfiA, and bla [11]. Different isolates with a resistant phenotype were presented, but they did not carry the evaluated genes. This resistance is likely mediated by other genes or allelic variants of the cfx gene, such as cfxA3 or cfxA6 [17], or other mechanisms that were not evaluated here. The antimicrobial resistance (AMR) phenotypic profiles with identified AMR genes also have been reported between the presence of ermF, and decreased susceptibility to azithromycin and resistance to clindamycin [18]. Isolates 3, 6, and 9 of P. nigrescens, presented a direct genotype–phenotype relationship due to the presence of the ermF gene and phenotypic resistance to clindamycin. (Figure 2).

Isolates with the presence of the evaluated genes and a sensitive phenotype were observed. These are considered essential targets, as antibiotic exposure could be a risk factor for transcribing these resistance-associated genes. These genes can be transferred to other bacteria through conjugative transposons that are activated in the presence of antibiotics. The use of antibiotics in clinical dental practice has increased, favoring the environmental pressure exerted by this increase. Antibiotic resistance among periodontal bacteria, such as Prevotella spp., needs to be monitored [2].

Antibiotic susceptibility was determined and correlated with resistance genes, and P. nigrescens was the species with the highest resistance to antibiotics such as AMX, AMC, and CC, compared to P. intermedia and P. melaninogenica [19,20]. In Colombia, Ardila et al. [21] evaluated antibiotic susceptibility to AMX, MTZ, and CC and found resistance in 35.5%, 26.6%, and 22.22% of P. intermedia/nigrescens isolates, respectively. The isolates were 100% sensitive to amoxycillin/clavulanic acid. However, antibiotic resistance in isolates of the genus Prevotella has increased, resulting in resistance to AMC. These results may be related to the high frequency of the antibiotic-resistant genes cfxA, cfxA2, and bla, which have been detected in these species; these results are consistent with those reported in previous studies [22,23].

Only two isolates (heat map P.i-8 and P.m-7) of the thirty evaluated presented a phenotype and genotype resistant to metronidazole, which may be a good indicator of efficacy in current therapy. However, it is important to monitor those isolates with the genotype present and no resistance, and those that do not have the genotype present and are resistant to metronidazole, because this is the antibiotic of choice for infections involving anaerobic microorganisms.

Current evidence regarding antibiotic prescription for oral infectious processes is still scarce, limiting its management and favoring empirical prescription. Antibiotic resistance continues to be a public health problem [24]; it has increased in oral microorganisms to the extent that selective pressure is exerted at the genomic level in these species. Both in Colombia and worldwide, there are no epidemiological surveillance programs for antibiotic resistance in oral bacteria, and resistance continues to increase at an alarming rate.

This work constitutes one of the first advances in the current state of antibiotic resistance and gene frequency in species of the Prevotella genus in Colombia. It could serve as a basis for the future development of antibiotic management guidelines in dental practice for infections of odontogenic origin.

4. Materials and Methods

4.1. Population and Samples

In this study, we obtained 500 in vitro isolates of Prevotella spp; of these, 162 isolates correspond to P. intermedia, P. nigrescens, and P. melaninogenica. However, only 30 isolates were evaluated, 10 of each of the most frequent species in the oral cavity, since this genus is strictly anaerobic and, due to the rigor of the phenotypic method, it was not possible to include all of the isolates. All isolates come from the strain collection of the Oral Microbiology Laboratory of the Institute Unit of Oral Basic Investigation (UIBO). These were obtained from subgingival and other oral samples from patients who attended a consultation at the dental clinics of El Bosque University (Bogotá, Colombia).

4.2. Microbiological Cultures and Species Identification

Each isolate was grown in supplemented Brucella agar (0.3% Bacto agar, 0.2% yeast extract, 5% defibrinated sheep blood, 0.2% hemolyzed blood, 0.0005% hemin, and 0.00005% menadione (BBL Microbiology Systems, Cockeysville, MD, USA)) and incubated at 37 °C for 7 days under anaerobic conditions for the recovery of Prevotella spp. (Anaerogen, Oxoid, Hampshire, UK) [25].

4.3. Species Identification and Detection of Resistance Genes

P. intermedia, P. nigrescens, and P. melaninogenica were detected using a conventional PCR according to the recommendations of Ashimoto et al. [26]; the sequences of the primers are shown in Table 5.

Table 5

Primer sequences for detecting species and resistance genes.

Gen	Sequence (5′→3′)	Amplicon Size (bp)	Reference
16S—P. intermedia *	TTTGTTGGGGAGTAAAGCGGGTCAACATCTCTGTATCCTGCGT	575	[26]
16S—P. nigrescens *	ATGAAACAAAGGTTTTCCGGTAAGCCCACGTCTCTGTGGGCTGCGA	804	[26]
16S—P. melaninogenica *	TACAATGGAGAGTTTGATCCCGATCCTTGCGGTCACGGAC	1453	This study
cfxA **	GCAAGTGCAGTTTAAGATTGCTTTAGTTTGCATTTTCATC	934	[27]
cfxA2 **	CAAAGYGACAAYAATGCCTGCGTSACGAAGRCGGCWAT	426	[27]
BlaTEM †	ATGAGTATTCAACATTTCCGCCAATGCTTAATCAGTGAGG	858	[28]
tetM ††	GACACGCCAGGACATATGGTGCTTTCCTCTTGTTCGAG	397	[29]
tetQ **	GGCTTCTACGACATCTATTACATCAACATTTATCTCTCTG	755	[30]
ermF	TTTCGGGTCAGCACTTTACTAACTTTCAGGACCTACCTCATA	476	[31]
nimAB ††	GGCTACAAGCAGCATGTCTGCATACTTTGCTCTTC	377	This study
nimAEFI ††	TGCATACTTTGCTCTTCATGTTCAGAGAAATGCGGCG	455	This study

* Species positive control: DNA of P. intermedia ATCC 25611, P. nigrescens ATCC 33561, and P. melaninogenica ATCC 25845. Positive gene controls: ** Bacteroides fragilis ATCC 25285 (cfxA, cfxA), † Escherichia coli ATCC 25922 (bla), †† Fusobacterium nucleatum ATCC 25586 tetM, nimAB/AEFI; negative control: molecular grade water.

The identification of each microorganism was confirmed by the presence of its amplification products on agarose gel electrophoresis at a concentration of 1.5% in Tris-acetate-EDTA (TAE) with 0.5 μg/mL of ethidium bromide. The bands were visualized using a transilluminator (Gel Doc XR+, BioRad) with ultraviolet light at 300 nm.

4.4. In Vitro Antibiotic Susceptibility Testing

For the determination of antibiotic susceptibility, the agar dilution method was used in this study, following the standards of the CLSI [10].

Supplemented Brucella agar (0.3% Bacto agar, 0.2% yeast extract, 5% defibrinated sheep blood, 0.2% hemolyzed blood, 0.0005% hemin, and 0.00005% menadione (BBB Microbiology Systems, Cockeysville, MD, USA)) was prepared with concentrations of antibiotics from 0.25, 0.5, 1, 2, 4, 8, 16, and 32 µg/mL up to 64 µg/mL. Antibiotics CC, TE, gentamicin, AMX, AMC, and MTZ were evaluated.

Isolates of P. intermedia, P. nigrescens, and P. melaninogenica were spectrophotometrically adjusted (λ = 620 nm) to a concentration of 1 × 108 bacteria/mL (optical density). These inocula were used to determine the MIC of each antibiotic evaluated in this study. Subsequently, the culture plates inoculated with each isolate in each of the different antibiotic concentrations were incubated at 37 °C for 7 days in anaerobiosis (Thermo Scientific: AnaeroGen Oxiod Ltd., Basingstoke, UK; Anaerobic indicator BR0055B, Oxiod Ltd., Basingstoke, UK). After incubation, MIC values for each antibiotic were evaluated in the P. intermedia, P. nigrescens, and P. melaninogenica isolates, with their respective dilutions. The first agar box with an antibiotic concentration at which no bacterial growth was observed was determined as the MIC. The reference strains B. fragilis ATCC 25285, P. intermedia ATCC 25611, P. nigrescens ATCC 33561, and P. melaninogenica ATCC 25845 were used as the internal controls.

4.5. Gene Detection

The presence of cfxA and cfxA was determined by conventional PCR, as previously described by Fosse et al. [27]. The bla gene was detected according to the protocol specified by Ioannidis et al. [28]. To determine the presence of tetM and tetQ genes, the protocol specified by Lacroix et al. was used with some modifications [29,30]; the nimAB/AEFI gene was also identified using this method. The reaction occurred in a final volume of 25 µL, of which 5 µL corresponded to the sample and 20 µL to the reaction mixture containing 1X PCR buffer (1.0 mM KCl, 10 mM Tris-HCl (pH 9, 0 to 25 °C), 2.0 mM MgCl2, and 0.1% Triton® X-100); 0.04 IU Taq DNA polymerase (Promega, Madison, WI, USA); 1.5 mM MgCl2; 0.02 mM of each deoxyribonucleotide and 2 µM of each primer. To determine the presence of the ermF gene, the protocol described by Reig et al. [31] was implemented.

4.6. Statistical Analysis

Databases were built in Microsoft Office Professional Plus Excel 2013 and were used to calculate the frequencies of P. intermedia, P. nigrescens, and P. melaninogenica, the frequency of resistance genes, and antibiotic resistance (MIC 50 and MIC 90) to perform a descriptive analysis and express results in percentage data.

5. Conclusions

P. nigrescens was the species with the highest level of resistance to antibiotics such as AMC, AMX, and CC; it also possessed resistance genes at a higher frequency compared to P. intermedia and P. melaninogenica. AMX was the antibiotic to which the species were least susceptible; it was followed by AMC, CC, and MTZ. This information may be relevant for the management and treatment of oral infections caused by Prevotella.