Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice.

Coronavirus disease (COVID-19), caused by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), is currently spreading globally. To overcome the COVID-19 pandemic, preclinical evaluations of vaccines and therapeutics using K18-hACE2 and CAG-hACE2 transgenic mice are ongoing. However, a comparative study on SARS-CoV-2 infection between K18-hACE2 and CAG-hACE2 mice has not been published. In this study, we compared the susceptibility and resistance to SARS-CoV-2 infection between two strains of transgenic mice, which were generated in FVB background mice. K18-hACE2 mice exhibited severe weight loss with definitive lethality, but CAG-hACE2 mice survived; and differences were observed in the lung, spleen, cerebrum, cerebellum, and small intestine. A higher viral titer was detected in the lungs, cerebrums, and cerebellums of K18-hACE2 mice than in the lungs of CAG-hACE2 mice. Severe pneumonia was observed in histopathological findings in K18-hACE2, and mild pneumonia was observed in CAG-hACE2. Atrophy of the splenic white pulp and reduction of spleen weight was observed, and hyperplasia of goblet cells with villi atrophy of the small intestine was observed in K18-hACE2 mice compared to CAG-hACE2 mice. These results indicate that K18-hACE2 mice are relatively susceptible to SARS-CoV-2 and that CAG-hACE2 mice are resistant to SARS-CoV-2. Based on these lineage-specific sensitivities, we suggest that K18-hACE2 mouse is suitable for highly susceptible model of SARS-CoV-2, and CAG-hACE2 mouse is suitable for mild susceptible model of SARS-CoV-2 infection.

Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), first reported in December 2019, is a highly contagious pathogen. SARS-CoV-2, which belongs to the genus Betacoronavirus, is the causative agent of the COVID-19 pandemic [1, 2]. Symptoms of COVID-19 include fever, dry cough, fatigue, body aches, sore throat, and loss of taste or smell [3, 4]. According to the World Health Organization’s situation report, from the date of the first report to December 2021, the cumulative number of reported cases and deaths was 273 million and 5.3 million, respectively [5].

To respond to the rapid spread of SARS-CoV-2, basic research on SARS-CoV-2, research and development, and preclinical evaluations of vaccines and therapeutics are being actively conducted. To support these studies, COVID-19 preclinical animal models are essential. Numerous animal models, including Syrian hamster [6-8], ferret [9-11], and several species of non-human primates [12, 13], have been used in preclinical trials and research on SARS-CoV-2 since the severe acute respiratory syndrome (SARS) outbreak in 2002. However, these animal models cannot reproduce equivalent clinical symptoms, pathological changes, or mortality observed in COVID-19 patients [14].

Transgenic mice exhibit the most similar clinical symptoms and pathological changes to SARS and COVID-19 as those seen in humans [15-21]. In particular, transgenic mice genetically engineered to express human angiotensin-converting enzyme 2 (hACE2), a functional receptor of SARS-CoV and SARS-CoV-2 [22], are the most commonly used. Due to low SARS-CoV-2 susceptibility, wild-type mice are unsuitable for SARS-CoV-2 study [23]. However, hACE2 transgenic mice exhibit mild to severe pathological lung changes with clinical symptoms similar to those of COVID-19 patients. K18-hACE2 [16, 19, 21] and CAG-hACE2 [15, 18, 20] are commonly used hACE2 transgenic mice.

Although many studies have used K18-hACE2 and CAG-hACE2 transgenic mice, a comparative study of SARS-CoV-2 infection in these transgenic mouse lineages has not been published. In this study, we infected an equal amount of SARS-CoV-2 to two different lineages of FVB background mice, K18-hACE2 and CAG-hACE2. Here, we present detailed data on the distribution of SARS-CoV-2, clinical manifestations, and histopathology to compare SARS-CoV-2 susceptibility and resistance between two different lineages of transgenic mice driven by different promoters.

Materials & methods

1. Generation of hACE2 transgenic mice

Two different lineages of human ACE2 gene transgenic mice, FVB-Tg (K18-ACE2)K [K18-hACE2] and FVB-Tg (CAG-ACE2) [CAG-hACE2], were produced and provided by the National Cancer Center of the Republic of Korea. The human ACE2 gene (HG10108-UT, Sino Biological Inc., China) was cloned behind the Krt18 (#44580, Addgene, USA) or CAGGs (#127346, Addgene) promoter. Pronuclear injections to generate transgenic mice were performed as previously described [24]. Two founders were used to identify clones in which the hACE2 protein was expressed in lung tissue. Human ACE2 expression was detected by western blotting or immunohistochemistry and PCR using an anti-hACE2 antibody (#108209, Abcam, UK) and hACE2 specific primers (Table 1), respectively.

Table 1

PCR primers for identifying hACE2 transgenic mouse.

Gene		Sequence	PCR product size
CAG-hACE2	Forward	5’- CGCAGCCATTGCCTTTTATGG– 3’	609 bp
	Reverse	5’- CCAGCATTATTCATGTTTTGG– 3’
K18-hACE2	Forward	5’- CACTCTGCGATATAACTCGGG– 3’	295 bp
	Reverse	5’- CCAGCATTATTCATGTTTTGG -3’

2. SARS-CoV-2 virus infection

The original viral stock of SARS-CoV-2 (NCCP 43326) was obtained from the National Culture Collection for Pathogens (NCCP), which is managed by the Korea Disease Control and Prevention Agency (KDCA). The viral stock was amplified by passaging in Vero E6 cells (CRL 1586, ATCC, USA), and the viral titer was confirmed using the TCID50 assay. Amplified stocks were diluted and aliquoted to working stocks of the virus (1.0 x 102 TCID50/20 μl and 1.0 x 105 TCID50/20 μl). All experiments involving infectious SARS-CoV-2, including animal infection, were handled at the biosafety level 3 facility at Konkuk University by trained researchers. All procedures were approved conducted under the guidelines of the Institutional Biosafety Committee of Konkuk University (KUIBC-2021-06) and the Konkuk University Animal Care and Use Committee (KU20142-4).

3. Viral infection of two different lineage mice

Two different lineages of male mice, ranging from 9 to 12 weeks of age, were grouped into a high dose (VH group), low dose of virus group (VL group), and negative control group (NC group). Mice were anesthetized with a Zoletil-xylazine cocktail and infected with 20ul of the indicated SARS-CoV-2 virus stock via intranasal route. After infection of SARS-CoV-2 virus, environmental enrichment including wood chew block and pulp house (Woojung Bio, Republic of Korea) were provided to diminish distress. The infected mice were observed daily for signs of illness and weighed to assess the progression of SARS-CoV-2 infection. In addition, illness severity was evaluated using the activity score and survival rate. The activity score was independently classified based on the following criteria: 100%, healthy; 75%, ruffled fur but active; 50%, ruffled fur, lethargy, and hunched posture; 25%, moribund; 0%, dead. Infected mice were sacrificed by exsanguination at 1, 2, 5, and 7-days post-infection (dpi). Humane euthanasia performed on the day reaching 25% of activity score. Mice dead before reaching the humane euthanasia criteria were immediately necropsied after confirmation of death. These procedures were performed under 2.5% isoflurane anesthesia using an isoflurane vaporizer (VetEquip, USA). After euthanasia, organs, including the lung, spleen, liver, kidney, heart, and small intestine, were harvested. The weights of the lungs, spleen, liver, kidneys, and heart were measured to compare the organ-to-body weight ratio. Lung tissue specimens were isolated and frozen at -80°C.

4. Standard curve of SARS-Cov-2

Viral RNA was isolated from the SARS-CoV-2 virus stock, which was quantified with the TCID50 assay, using the MagNA Pure 96 system (Roche, Switzerland). cDNA was synthesized from eluted viral RNA samples using Maxime™ RT PreMix (Random Primer, iNtRon Biotechnology, Republic of Korea), followed by serial dilution. Each diluted cDNA sample (1 μl) was used for quantitative real-time PCR (qRT-PCR). qRT-PCR was conducted using AccuPower® 2X GreenStar™ qPCR Master Mix (Bioneer, Republic of Korea) with primers targeting the ORF1ab gene of SARS-CoV-2 virus. (ORF1ab-F: 5’-CCCTGTGGGTTTTACACTTAAAAA-3’; ORF1ab-R: 5’-GATTGTGCATCAGCTGACTG -3’). The cycling procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 10 s, and annealing/extension at 51°C for 30 s. A total of 40 cycles were performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The standard curve and equation were derived based on the TCID50 values and quantification cycles (cq) of each serially diluted sample.

5. Virus titer in the tissue specimens of infected mice

Lung, cerebrum, cerebellum, and duodenum specimens of infected and uninfected mice were manually emulsified with phosphate-buffered saline (Bioneer) using a 3-way stop-cock and syringe. SARS-CoV-2 in specimens was inactivated using MagNA Pure 96 External Lysis buffer (Roche) after emulsification. After inactivation of the virus, viral RNA was isolated from each sample using a MagNA Pure 96 system (Roche). cDNA synthesis and real-time PCR were performed as described above. The viral load of each mouse was calculated using the cq value of each sample. Based on the standard curve, below limit of detection (1.0 x 102 TCID50/sample) considered as zero.

6. Western blot

Tissues were lysed in RIPA buffer (R4100-010, Gendepot, Barker, USA) supplemented with protease inhibitor cocktail (P3300-001, Gendepot) on ice and homogenized with stainless steel beads (Qiagen, USA) in TissueLyser II (Qiagen). The lysates were added to sample loading dye NuPAGE™ LDS sample buffer, heated to 95°C for 10 min and were separated on precast polyacrylamide gels (Bolt 4–12% Bis-Tris Plus, Thermo Fisher Scientific Inc., USA). After separation, proteins were transferred to a nitrocellulose membrane. After blocking the nonspecific site with 3% bovine serum albumin (BSA), the membrane was then incubated with anti-hACE2 antibody (1:2000, ab108209, Abcam) in 3% BSA at 4°C for overnight. The membrane was further incubated for 1 h with a peroxidase-conjugated secondary antibody (1:5000, Santa Cruz, USA) at room temperature. Immunoactivity proteins were detected with WESTSAVE Gold detection reagents (LF-QC0103, AbFrontier, Republic of Korea).

7. Histopathological evaluation

Organs, including the lungs, spleen, and small intestine, were harvested from euthanized mice and fixed with 10% neutral buffered formalin. After routine processing and paraffin embedding, sections were stained with hematoxylin and eosin. The sections were examined under a BX51 light microscope (Olympus, Japan), and images of each section were captured using DP74 software (Olympus). The histopathological severity of each organ was scored according to the criteria listed in Table 2.

Table 2

Histopathological scoring for quantify the states of the lung and small intestine.

Parameter		0	1	2	3	4	5
Lung scoring	Pneumonia	None	< 10% of entire lung	< 25% of entire lung	< 50% of entire lung	< 75% of entire lung	≥ 75% of entire lung
	Perivascular edema	None	Mild	Moderate	Severe
	Bronchitis and bronchiolitis	None	Mild	Moderate	Severe
Small intestine scoring	Goblet cell hyperplasia	Average of goblet cells from at least 10 villi of jejunum.

8. Immunohistochemistry

After deparaffinization in xylene and rehydration in graded alcohol, the tissue sections were quenched with 3% H2O2 for 30 min and incubated in 10 mM citrate buffer solution (pH 6.0) at 90°C for 10 min for antigen retrieval. After washing with PBS, the sections were incubated with anti-hACE2 antibody (1:2000, ab108209, Abcam) at 4°C for overnight. The sections incubated for 1h at room temperature with biotinylated goat anti-rabbit secondary antibody (Vector Laboratories, USA), followed by incubation with an avidin-biotin complex (Vector Laboratories) for 1h at room temperature and stained with DAB Chromogen (ScyTek Laboratory, West Logan, USA) for 5 min at room temperature, washed with PBS and deionized water and counterstained with hematoxylin.

9. Statistical analysis

Body weight, organ weight, survival analysis, histopathological scoring, and pulmonary viral titer were compared between the different groups of each transgenic lineage. Unpaired two-tailed t-tests and log-rank tests were used to calculate p-values using GraphPad Prism 7.04 (GraphPad Software, USA). Statistical significance was set at P < 0.05.

Results

1. Different characterization between K18-hACE2 and CAG-hACE2 mice

hACE2 was cloned using Krt18 and CAGGs promoters, and pronuclear injection was performed to obtain K18-hACE2 and CAG-hACE2 transgenic lineages. Western blotting and immunohistochemistry were performed to confirm protein levels of hACE2 in each transgenic lineage (Fig 1). In CAG-hACE2, the expression level of hACE2 protein in the kidney, lung, heart, and large intestine was similar to or higher than that of beta-actin, a housekeeping gene (Fig 1A). In K18-hACE2, the expression level of hACE2 protein in the lung was higher than that of beta-actin, but the rest of the organs were lower or undetectable (Fig 1B). The expression of hACE2 in lung tissue was confirmed by immunochemistry. hACE2 protein was expressed at high levels in the respiratory epithelium (Fig 1C).

Fig 1

hACE2 expression profile in multiple organs of K18-hACE2 and CAG-hACE2 transgenic lineage.

Elevated levels of hACE2 were detected in the lungs of both K18-hACE2 and CAG-hACE2 transgenic lineages. (A) Western blot analysis of hACE2 expression in multiple organs of CAG-h ACE2; (B) Western blot analysis of hACE2 expression in multiple organs of K18-hACE2; (C) Immunohistochemistry analysis of hACE2 expression in the lungs of K18-hACE2; (D) Immunohistochemistry analysis of hACE2 expression in the lungs of mock control.

2. Morbidity and mortality difference induced by SARS-CoV-2 in K18-hACE2 and CAG-hACE2 mice

To minimize factors that could affect SARS-CoV-2 infection, 40 and 33 age-matched K18-hACE2 and CAG-hACE2 transgenic mice were grouped into the high dose virus group (VH), low dose virus group (VL), and negative control group (NC). These groups of mice were inoculated with working stocks of SARS-CoV-2 (1.0 x 102 TCID50/20 μl and 1.0 x 105 TCID50/20 μl) via the intranasal route. Morbidity and mortality of the infected mice were observed daily. Four to five K18-hACE2 mice in the VL and VH groups and three to four CAG-hACE2 mice in the VL and VH groups were sacrificed at 1, 2, 5, and 7 dpi. However, all K18-hACE2 mice in the VH group died at 6 dpi and were necropsied (n = 3). The NC group of each lineage of mice was sacrificed on the final day of the study at 7 dpi.

As shown in Fig 2, the body weight of VH group of K18-hACE2 decreased by 22% at 6 dpi compared to the initial body weight. The VL group of K18-hACE2 exhibit minor body weight recovery at 7 dpi, after an 11% decrease at 6 dpi. At the endpoint, the body weight of both the VH and VL groups of K18-hACE2 was significantly different from that of the NC group (Fig 2A) (P < 0.01). However, both the VH and VL groups of CAG-hACE2 exhibited only a slight decrease compared with the initial body weight (5.9% in the VH group and 1.5% in the VL group). The VL group of CAG-hACE2 mice gradually regained weight after 3 dpi. At 7 dpi, the body weight of both the VH and VL groups of CAG-hACE2 significantly differed from that of the NC group (Fig 2B) (P < 0.001, P < 0.01). The activity score of the K18-hACE2 VH group continued to decrease after the first decline at 4 dpi, exhibiting moribund traits at 5 dpi. The activity score of the K18-hACE2 VL group started to decline from 4 dpi, dropping to 64% at 7 dpi. The VH group of the K18-hACE2 exhibited significant differences compared to the NC and VL groups (Fig 2C) (P < 0.05). The CAG-hACE2 lineage, in marked contrast to the K18-hACE2 lineage, did not exhibit clinical manifestations until 7 dpi (Fig 2D). The VH group of K18-hACE2 showed significantly lower activity score than VH group of CAG-hACE2 (P<0.05). Death of the VH and VL groups of K18-hACE2 began at 5 dpi (n = 5 in the VH group and n = 1 in the VL group), with the VH and VL groups exhibiting 100% and 64% mortality by 6 dpi (n = 3 in the VH group and n = 1 in the VL group) and 7 dpi (n = 2 in the VL group), respectively. Mortality in the VH group significant differed in the log-rank test compared to that in the NC and VL groups (Fig 2E) (P < 0.01). Similar to the activity score, VH and VL groups of CAG-hACE2 mice did not die during the entire study period (Fig 2F). Mortality rate in VL and VH groups were significantly higher in K18-hACE2 than in CAG-hACE2 (P < 0.05, P < 0.001).

Fig 2

Differences in morbidity and mortality due to SARS-CoV-2 infection in K18-hACE2 (n = 40) and CAG-hACE2 (n = 33) lineages.

(A) shows weight loss of K18-hACE2; (B) shows weight loss of CAG-hACE2; (C) shows activity score of K18-hACE2; (D) shows activity score of CAG-hACE2. (E) shows survival rate of K18-hACE2; (F) shows survival rate of CAG-hACE2. Data is represented as mean ± SE at indicated day post-infection (dpi). *P < 0.05; **P < 0.01; ***P < 0.001 as assessed using unpaired two-tailed t-test and log-rank test.

3. Kinetics of SARS-CoV-2 replication

Based on the remarkable differences in clinical manifestations between K18-hACE2 and CAG-hACE2, we compared the pulmonary, cerebral, cerebellar, and intestinal distribution of SARS-CoV-2 and the virus kinetics of the two different lineages (Fig 3). Pulmonary viral replication in the VL group of K18-hACE2 (Fig 3A) and CAG-hACE2 (Fig 3B) reached maxima at 7 and 5 dpi, respectively, with median values of 3.9 x 104 and 1.6 x 104 TCID50 SARS-CoV-2/lung, respectively. Virus titers in the VH group of K18-hACE2 and CAG-hACE2 reached maximum titers at 5 dpi and 2 dpi, respectively, with median values of 1.1 x 107 and 8.6 x 105 TCID50 SARS-CoV-2/lung. Viral titer gradually decreased after reaching the maxima. During the entire study, in VL groups of both lineages, the titers of SARS-CoV-2 were approximately 104 TCID50 SARS-CoV-2/lung. However, in the VH group, the viral titer of CAG-hACE2 appeared to be 105–106 TCID50 SARS-CoV-2/lung, whereas K18-hACE2 appeared to be relatively high at 106–107 TCID50 SARS-CoV-2/lung. Comparing the VL and VH groups in each lineage, a significant difference was observed in the virus titer of each group at 2 and 7 dpi for K18-hACE2 and 7 dpi for CAG-hACE2 (P < 0.05). At 2dpi, the VH group of K18-hACE showed significantly higher pulmonary viral replication than VH group of CAG-hACE2. (P < 0.05).

Fig 3

Kinetics of SARS-CoV-2 replication in organs of K18-hACE2 and CAG-hACE2 transgenic mice.

Kinetics of SARS-CoV-2 replication in lungs of K18-hACE2 (A) and CAG-hACE2 (B); kinetics of SARS-CoV-2 replication in cerebrum of K18-hACE2 (C) and CAG-hACE2 (D); kinetics of SARS-CoV-2 replication in cerebellum of K18-hACE2 (E) and CAG-hACE2 (F); kinetics of SARS-CoV-2 replication in duodenum of K18-hACE2 (G) and CAG-hACE2 (H). Titers of SARS-CoV-2 were measured with quantitative PCR and expressed as TCID50 SARS-CoV-2/organ. Data are represented as mean ± SE at indicated day post-infection (dpi). The VH group of K18-hACE2 transgenic mice died at 6 dpi, marked as 7 dpi. *P < 0.05 as assessed using unpaired two-tailed t-test.

Viral replication in the cerebrum of K18-hACE2 appeared at 5 dpi and 7 dpi for both the VL and VH groups (Fig 3C). A significant difference appeared between the VL and VH groups at 7 dpi (P < 0.05). Contrary to the results of K18-hACE2, in CAG-hACE2, viral replication was not detected in the cerebrum of both the VL and VH groups (Fig 3D). Comparing between K18-hACE2 and CAG-hACE2, K18-hACE2 showed significantly higher viral replication in 5 and 7 dpi of VL (P <0.05, P <0.001) and VH groups (P < 0.001, P < 0.05).

Viral replication in the cerebellum of K18-hACE2 was slightly lower than that in the cerebrum (Fig 3E). As in the cerebrum of CAG-hACE2, no viral replication was detected in the cerebellum of CAG-hACE2 (Fig 3F). Comparing the viral replication of the cerebellum of K18-hACE2 and CAG-hACE2, the VH group of K18-hACE2 showed significantly higher viral replication at 2, 5, and 7 dpi (P < 0.01, P < 0.05, P < 0.01). And viral replication of the small intestine was inspected. However, no viral replication was observed in both the VL and VH groups of K18-hACE2 (Fig 3G) and CAG-hACE2 (Fig 3H).

4. Organ to body weight ratio

To compare the lineage-dependent difference in sensitivity to SARS-CoV-2, we compared the average value of organ weight to the body weight of necropsied mice on each dpi. The lungs (Fig 4A and 4B) and spleen (Fig 4C and 4D) of infected mice from the VH and VL groups were compared for both lineages. Significant differences were observed at 5 dpi and 7 dpi in the lungs of the K18-hACE2 lineage. At 5 dpi, the lung-to-body weight ratio of the VH group of the K18-hACE2 was 53% higher than that of the VL group (P < 0.001). At 7 dpi, the relative lung ratios of the VH and VL groups of K18-hACE2 were 173.6% and 159.9% higher than those of the NC group, respectively (Fig 4A) (P < 0.001). In the CAG-hACE2 lineage, at 7 dpi, the relative lung ratios of the VH and VL groups were 65.4% and 44.5% higher than those of the NC group, respectively (P < 0.001), and the VH group was 14.5% higher than that of the VL group (Fig 4B) (P < 0.01). Comparing the lung-to-body weight ratios of the two different transgenic lineages, CAG-hACE2 was lower than K18-hACE2. Comparing between K18-hACE2 and CAG-hACE2, K18-hACE2 showed significantly higher lung-to-body weight ratio at 1, 5 and 7 dpi of VL (P <0.05, P <0.01, P <0.01) and 5 and 7 dpi of VH groups (P < 0.001, P < 0.05).

Fig 4

Organ to body weight ratio of SARS-CoV-2 infected K18-hACE2 and CAG-hACE2 transgenic mice.

Relative weight of lungs of K18-hACE2 (A) and CAG-hACE2 (B); relative weight of spleens of K18-hACE2 (C) and CAG-hACE2 (D). Data are represented as mean ± SE at indicated day post-infection (dpi). The VH group of K18-hACE2 transgenic mice died at 6 dpi, marked as 7 dpi. *P < 0.05; **P < 0.01; ***P < 0.001 as assessed using unpaired two-tailed t-test.

In the K18-hACE2 lineage, significant differences were observed in the spleen-to-body weight ratio between the NC, VH, and VL groups at 7 dpi. The spleen-to-body weight ratio of the NC group of K18-hACE2 was 66.5% and 76.3% higher than that of the VH and VL groups, respectively (P < 0.05, P < 0.001), and that of the VH group was 5.9% higher than that of the VL group (Fig 4C) (P < 0.05). Furthermore, significant differences were found at all dpi except at 1 dpi in the spleen-to-body weight ratio of CAG-hACE2 (P < 0.05, P < 0.01, P < 0.05). At 2, 5, and 7 dpi, the ratios of the VH group of the CAG-hACE2 were 20%, 48.8%, and 58.9% higher than those in the VL group, respectively. The ratio of the VH group of the CAG-hACE2 at 7 dpi was 81.1% higher than that in the NC group (Fig 4D) (P < 0.05). Comparing between K18-hACE2 and CAG-hACE2, K18-hACE2 showed significantly lower spleen-to-body weight ratio at 1, 5 and 7 dpi of VL (P <0.05, P <0.01, P <0.05) and 5 and 7 dpi of VH groups (P < 0.01, P < 0.05).

Comparing the lung-to-body weight ratio of the two lineages, K18-hACE2 reached its highest point at 5 and 7 dpi, and CAG-hACE2 at 7 dpi. The lung ratio of K18-hACE2 increased dramatically between 2 and 5 dpi, but that of CAG-hACE2 did not increase as much as K18-hACE2.

5. Histopathological scoring and analysis

Based on the differences in SARS-CoV-2 titer and organ-to-body weight ratio between K18-hACE2 and CAG-hACE2, we performed histopathological examination and scoring of the lungs, spleen, and small intestine. For histopathological evaluation of the lungs, infection severity was assessed according to the following parameters: pneumonia, perivascular edema, and bronchitis/bronchiolitis (Fig 5). Each parameter was scored and summed according to the criteria (Table 2). Histopathological analysis of the lungs of both lineages revealed the development of interstitial pneumonia in the early stage of infection, followed by alveolitis, perivascular edema, and bronchitis/bronchiolitis in the last stage (Fig 5). In the histopathological scoring analysis of the K18-hACE2 lineage, no significant difference was observed in the total lung score between the VH and VL groups. However, the total score of the lungs gradually increased in both groups (Fig 6A). In the CAG-hACE2 lineage, significant differences were observed at all dpi (1 and 7 dpi: P < 0.05; 2 and 5 dpi: P < 0.01). Unlike the K18-hACE2 lineage, which worsened over time, the VH and VL groups of CAG-hACE2 exhibited a gradual decrease from 1 dpi to 5 dpi and increased at 7 dpi (Fig 6B). Comparing K18-hACE2 and CAG-hACE2, the VH group of CAG-hACE2 showed significantly higher total lung score at 1 dpi (P <0.05). Atrophy of the white pulp in the spleen due to COVID-19 infection has been reported in a few case reports [25-27]. Therefore, we performed a histopathological evaluation of the spleen. For histopathological evaluation of the spleen, the area of white pulp was measured relative to the area of the entire spleen. White pulp atrophy was observed in both strains. As the severity of the disease progressed, atrophy of the splenic follicle occurred (Fig 7). A significant difference in the percentage of white pulp area between the VH and VL groups of K18-hACE2 mice at 5 dpi (P < 0.01), and the white pulp ratio of both the VH and VL groups was significantly (P < 0.001) lower than that of the NC group at 7 dpi (Fig 8A). In the CAG-hACE2 lineage, a significant difference was only observed between the VH and VL groups at 7 dpi (P < 0.05) (Fig 8B). The ratio of white pulp in the spleen gradually decreased over time in both lineages. However, it decreased more rapidly in the K18-hACE2 lineage. At 7 dpi, the white pulp ratio of the K18-hACE2 lineage was 45.5% and 51% lower in the VH and VL groups, respectively, than in the NC group; however, the white pulp ratio of the CAG-hACE2 lineage was 36.4% and 13.3% lower in the VH and VL groups, respectively, than in the NC group. The white pulp ratios were significantly lower in K18-hACE2 than in CAG-hACE2 at 7dpi in VL group and 5 dpi in VH group (P<0.05). As with the severity of SARS-CoV-2 infection, hyperplasia of goblet cells occurs in the small intestine. We hypothesized that an increasing number of goblet cells indicates the severity of SARS-CoV-2 infection. Therefore, the average number of goblet cells was calculated and quantified (Table 2). Hyperplasia of the goblet cells in the villi with villi atrophy of the small intestine appeared in both lineages and was more prominent in the K18-hACE2 lineage than in the CAG-hACE2 lineage (Fig 7). The K18-hACE2 lineage exhibited significant differences between the VH and VL groups at 1 dpi (p < 0.01) and between the NC and VL groups at 7 dpi (p < 0.001). The VH group mice of the K18-hACE2 lineage, which died at 5–6 dpi, were excluded from the data due to autolysis (Fig 8C). Hyperplasia of the goblet cells and villi atrophy was not noticeable in the CAG-hACE2 lineage (Fig 8D). Comparing between K18-hACE2 and CAG-hACE2, K18-hACE2 showed a significantly higher number of goblet cells in the intestinal villi at 7 dpi of the VL group (P <0.01).

Fig 5

Histopathological analysis of lungs of SARS-CoV-2 infected K18-hACE2 and CAG-hACE2 transgenic mice.

Lung section of a K18-hACE2 mouse of the NC group (A), VL group (C, D), VH group (G, H) and a CAG-hACE2 mouse of the NC group (B), VL group (E, F), VH group (I, J) on 2 dpi or 6 to 7 dpi. Interstitial pneumonia (black star); bronchiolitis (white star); perivascular edema (arrowhead); (magnification x100).

Fig 6

Histopathological scoring of lungs of SARS-CoV-2 infected K18-hACE2 and CAG-hACE2 transgenic mice.

The lung of each group was scored as indicated in Table 2. (A) Total lung score of K18-hACE2 mice; (B) Total lung score of CAG-hACE2 mice. Data is represented as mean ± SE at indicated day post-infection (dpi). The VH group of K18-hACE2 transgenic mice died at 6 dpi, marked as 7 dpi. *P < 0.05; **P < 0.01 as assessed using unpaired two-tailed t-test.

Fig 7

Histopathological analysis of spleens, and small intestines of SARS-CoV-2 infected K18-hACE2 and CAG-hACE2 transgenic mice.

Spleen and small intestine sections of a K18-hACE2 mouse of the NC group (A, B), VL group (E, F), VH group (I, J) and a CAG-hACE2 mouse of the NC group (C, D), VL group (G, H), VH group (K, L) on 5 dpi. White pulp in spleen (star); goblet cell in small intestine (arrowhead); (magnification x200, inset x400).

Fig 8

Histopathological scoring of spleens and small intestines of SARS-CoV-2 infected K18-hACE2 and CAG-hACE2 transgenic mice.

Atrophy of white pulp was calculated as the area of white pulp relative to a total area of the spleen. The small intestine of each group was scored as indicated in Table 2. (A) Area of white pulp of K18-hACE2 mice; (B) Area of white pulp of CAG-hACE2 mice; (C) Number of goblet cell in small intestine of K18-hACE2 mice; (D) Number of goblet cell in small intestine of K18-hACE2 mice. Data is represented as mean ± SE at indicated day post-infection (dpi). The VH group of K18-hACE2 transgenic mice died at 6 dpi, marked as 7 dpi. *P < 0.05; **P < 0.01; ***P < 0.001 as assessed using unpaired two-tailed t-test.

Discussion

Ever since the SARS-CoV-2 pandemic in 2019, animal research for preclinical evaluation of therapeutics and vaccines has been ongoing worldwide. Currently, K18-hACE2 mice are primarily used for SARS-CoV-2 research and preclinical trials [28-32]. CAG-hACE2 mice are used less frequently than K18-hACE2 mice [20]. In most SARS-CoV-2 studies in mice, the transgenic lineages used for infection had a C57BL/6 background. FVB inbred strain was studied vulnerable to several viruses such as Theiler’s murine encephalomyelitis virus and Hepatitis B virus than other strains, including C57BL/6 [33-35]. Considering these characteristics of the FVB strain, we expressed hACE2 in FVB background using K18 promoter and CAG promoter to infect SARS-CoV-2. The present study was conducted to compare SARS-CoV-2 susceptibility between two different hACE2 transgenic mice with an FVB background and suggests a new model for SARS-CoV-2 research. Our results suggest that susceptibility to SARS-CoV-2 infection varies depending on the promoter used for transgenic mouse production.

The clinical symptoms varied between the different transgenic lineages. K18-hACE2 exhibited a rapid decline in weight loss, survival rate, and behavior score as viral infection progressed, whereas CAG-hACE2 recovered from the disease and exhibited non-lethal clinical symptoms and resistance to infection. The clinical manifestation and lethality of K18-hACE2 that appeared in the present study correspond well with the results of an earlier study, which inoculated mice with the same viral titer, although the genetic background of the mouse was different [21]. A study investigating CAG-hACE2 in a C57BL/6 background, where mice critically infected with SARS-CoV-2, has been published [20]. However, the results regarding CAG-hACE2 mice obtained in this study were less severe than those of the previous study. These contrary results suggest the viral susceptibility may vary by the line produced even though the same vector was used. Previous study, which produced K18-hACE2 on the C57BL/6 background, showed different mortality to SARS-CoV depending on the produced line, despite the same K18 promoter being used [15].

Differences in the degree of pneumonia were observed between the two lineages. In high-titer viral infection, a higher viral load was detected in the lungs of K18-hACE2 than in CAG-hACE2. There was no difference in the viral load in the low-titer viral infection group. However, clinical symptoms observed in K18-hACE2 mice were more severe than that in CAG-hACE2 mice.

Histopathological scoring of K18-hACE2, including alveolitis, perivascular edema and bronchiolitis, was higher than that of CAG-hACE2, as in SARS-CoV-2 patients [36-39]. These results indicate that pneumonia in K18-hACE2 was more severe and K18-hACE2 mice were more susceptible to SARS-CoV-2 infection than CAG-hACE2 mice. Furthermore, CAG-hACE2 did not exhibit perivascular edema until 7 dpi, which is thought to indicate slower disease progression than K18-hACE2. The degree of viral replication in the cerebrum and cerebellum of K18-hACE2 mice was not dependent on the viral dose administered. Unlike K18-hACE2, in which the virus was detected in the cerebrum and cerebellum, the virus was not detected in CAG-hACE2. This difference seems to affect the activity score and survival rate, which decreased in K18-hACE2, whereas the CAG-hACE2 did not. This result is consistent with the previous study that virus replication in CNS affected the fatality rate [40].

Different pathological findings were observed in the spleen and the small intestine. The weight of the spleen increased at 2 dpi in all groups, except for the VL group of CAG-hACE2. After 2 dpi, the weight of the spleen and the area of the white pulp decreased rapidly. The increase in spleen weight can be attributed to immune response during early viral infection [41]. As viral infection progresses, depletion of B and T cells causes a decrease in spleen weight [25, 27, 41]. The pathological changes in all groups, except for the VL group of the CAG-hACE2, differed depending on the time elapsed. The rapid decrease in white pulp was faster in K18-hACE2 than in CAG-hACE2, indicating that K18-hACE2 is more susceptible to SARS-CoV-2. The VL group of CAG-hACE2 exhibited reduced white pulp atrophy at 7dpi compared with the other groups. This result indicated that CAG-hACE2 is more resistant to SARS-CoV-2 infection than the K18-hACE2 lineage. Hyperplasia of goblet cells with villi atrophy was observed in the small intestine of both lineages. This result is consistent with results of previous studies showing that the increasing number of goblet cells in COPD patients reproduced severe SARS-CoV-2 infection. Upregulation of ACE2 in goblet cells is associated with a severe infection of SARS-CoV-2 in COPD patients [42-44]. Based on these studies, hyperplasia of goblet cells can be judged as an indicator of SARS-CoV-2 infection. However, SARS-CoV-2 virus replication in the small intestine wasn’t detected in the qPCR assay. For this reason, further research is needed on the effect of SARS-CoV-2 on the small intestine. Taken these results together, our study indicates that K18-hACE2 is more susceptible to SARS-CoV-2 than CAG-hACE2. These results suggest that the response to SARS-CoV-2 infection differs depending on the transgenic mouse lineage.

Based on these results, differences in the promoter used caused variations in susceptibilities of the two transgenic mouse lineages to SARS-CoV-2. However, according to a study comparing the difference in promoter expression, the expression level of the transgene under the CAG promoter was higher than that under the K18 promoter in both cells and animals [45, 46]. Contrary to the results of these previous studies, high expression of hACE2 protein was confirmed in multiple organs by western blotting in both lineages used in this study, independent of clinical symptoms. K18-hACE2 mice may be more susceptible to SARS-CoV-2 than CAG-hACE2 because the K18 promoter is an epithelial cell-derived promoter, whereas the CAG promoter is a synthetic promoter that combines cytomegalovirus enhancer with chicken beta-actin gene promoter. As an epithelial cell-derived promoter, the K18 promoter is thought to affect hACE2 expression and SARS-CoV-2 infection mechanisms. Little is known about the correlation between the K18 promoter and SARS-CoV-2 infection mechanism. Therefore, further studies are needed to identify the correlation between the K18 promoter and SARs-CoV-2 infection mechanism.

Conclusion

In this study, we demonstrated that two different lineages of FVB background transgenic mice expressing hACE2 exhibit different clinical manifestations of SARS-CoV-2 infection, depending on the promoter used. Based on these lineage-specific sensitivities, we offer that K18-hACE2 mouse, which shows high mortality to SARS-CoV-2 infection, is suitable for highly susceptible model of SARS-CoV-2 infection, and CAG-hACE2 mice, which shows morbidity to SARS-CoV-2 without lethality, is suitable for mild susceptible model of SARS-CoV-2 infection.

(PDF)

Click here for additional data file.

18 Apr 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Kui Li

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. Please remove your figures from within your manuscript file, leaving only the individual TIFF/EPS image files, uploaded separately.  These will be automatically included in the reviewers’ PDF.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, Seo et al. compared two transgenic mouse models for their susceptibility to SARS-CoV-2 infection. These two transgenic mice models are FVB background and express human ACE2 driven by two different promoters (K18 and CAG). They found that K18-hACE2 FVB mice were more susceptible to SARS-CoV-2 infection than the CAG-hACE2 FVB mice. Overall, the subject of this research is interesting as hACE2-transgenic mice have been broadly used in SARS-CoV and SARS-CoV-2 research, but no clear comparative data has been published regarding the mice expressing hACE2 driven by different promoters. This study tried to fill this gap and found different results compared to a previous model (Masamitsu et al., 2021, JCI insight). Nonetheless, this study lacks rigorous analyses of the two models and does not comprehensively discuss them with previous models.

General comments:

1. As we’ve already known, the genetic background of mice is very important for the susceptibility to many virus infections, including SARS-CoV and SARS-CoV-2. Early studies have shown the utility of K18 and CAG mice (B6 background) for SARS-CoV-2 research, this study shows that the CAG-hACE2 transgenic FVB mice may not be a good model for SARS-CoV-2. The authors created the FVB transgenic mice but did not say what FVB mice were and why to use FVB mice.

2. Masamitsu et al. (2021, JCI insight) reported the CAG promoter-driven hACE2 mouse model was highly susceptible to SARS-CoV-2. These mice, infected via intranasal or intratracheal route, exhibited severe disease. Since the K18-hACE2 FVB mice were highly susceptible to SARS-CoV-2, what would be the potential reasons for the low susceptibility of the CAG-hACE2 mice?

3. The authors briefly describe what the K18 promotor is but do not say anything about the CAG promotor. If the authors want to compare the utility of two transgenic mice, they should discuss the differences between the two promotors and the potential expression distribution of the targeted protein (human ACE2), and what effects would be resulted from the different protein distribution.

4. If the authors want to compare the susceptibility of two transgenic mouse models, they should compare these mice infected with the same dose of virus. It is not very meaningful to compare the low- and high-dose groups within the same transgenic mice as the differences would be expected.

5. If the spleen and intestine respond to SARS-CoV-2 infection, viral titers or RNA levels in these organs should be investigated as well as the inflammatory response (e.g. cytokine levels).

Specific comments:

1. Fig 1: First, according to the beta-actin levels, would be the undetectable ACE2 in the liver due to inadequate total protein loaded? The same amount of total protein should be analyzed. An alternative approach is to detect by qPCR. Second, the brain and spleen should be included as 1) early studies showed that the brain of the K18-hACE2 mice is targeted by SARS-CoV-2, and 2) later data include the spleen. Third, later data no mock control for the IHC data.

2. Fig 2: Specify the statistical tests in this and other figure legends.

3. Fig 3: The viral RNA levels in the lungs, spleens, and intestines should be determined as later data include these organs. For the low-dose group, any explanation for no viral propagation during the course of infection? Is it meaningful to calculate the p values between the low and high-dose groups?

4. Fig 7: First, what is the white pulp percentage, the number of pulp per tissue slide, or the area of the pulp? If it was the number, how many slides were counted? If it was the area, how many pulps were counted? Second, for the number of goblet cells, how many villi were counted? Third, goblet cells cannot be seen in the current images. Enlarged images should be provided. Fourth, the viral loads in the spleen and intestine should be determined.

Reviewer #2: In the manuscript titled “Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice,” Seo SM and colleagues compare host response and pathology of K18-hACE2 mouse model of SARS-CoV-2 infection to another transgenic line CAG-hACE2 mice both on FVB background. The authors find similarities and differences in SARS-CoV-2 replication and pathology in these strains. Specifically, SARS-CoV-2 replicated to high titers and caused severe clinical illness, fatal pneumonia, and mortality in K18 mice compared to CAG-hACE2 mice. Based on these results, the authors conclude that the K18-hACE2 mice are useful for vaccine testing while CAG-hACE2 mice for therapeutic evaluation. Specific comments are listed below.

Major comments:

1) Given the availability of K18-hACE2 mice on B6 background for COVID19 studies, which is a robust model, it is unclear why the authors chose to develop K18-hACE2 and CAG-hACE2 mice on an FVB background.

2) K18-hACE2 mice on B6 background develop fatal brain infection, which largely contributes to morbidity and mortality observed in these mice. However, the authors did not assess brain infection in mice on FVB background. If mice on FVB background do not show brain infection, then perhaps these mice would be better models to study SARS-CoV-2 infection and lung pathology.

3) The authors conclude that K18-hACE2 mice are better for vaccine testing and CAG-hACE2 mice for therapeutic evaluation. However, no rationale or basis is provided to support these conclusions.

4) CAG-hACE2 mice infected with a high dose of the virus show similar or high lung titers compared to low dose virus infection in K18 mice (Figs 2 and 3). Yet, high dose CAG-hACE2 mice do not show signs of morbidity or pathology observed in low dose K18 mice. The authors should discuss the basis for these differences.

5) K18-hACE2 mice have high ACE2 expression in other tissues compared to CAG-hACE2. In correlation, increased pathology is observed in the spleen and intestines in K18 mice. Do these changes correlate with virus infection these tissues, or the changes observed in non-lung tissues are due to inflammation?

6) Discussion should include the implications of the changes observed in mouse lung and non-lung tissues and how these changes correlate with changes in lungs and other tissues of patients with severe and mild-moderate covid19.

Minor comments:

1) Line 65: Change the sentence to mean “spread of SARS-CoV-2,” not “spread of COVID19,” as it is the virus that spreads.

2) Line 206: The virus dose provided here is different from the methods section. Please correct.

3) Line 371-372: Unclear what and how these studies suggest a new line of research.

4) The authros make several claims not supported by the results. This reviewer suggests authors to carefully read the manuscript and modify the statements to reflect the results.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

1 Jun 2022

Kui Li, Ph.D

Academic Editor

PLOS ONE

Dear Dr. Li

Subject: Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice [PONE-D-22-06945]

Thank you for inviting us to submit a revised draft of our manuscript entitled, "Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice" to PLOS ONE. We also appreciate the time and effort you and each of the reviewers have dedicated to providing insightful feedback on ways to strengthen our paper. Thus, it is with great pleasure that we resubmit our article for further consideration. We have incorporated changes that reflect the detailed suggestions you have graciously provided. We also hope that our edits and the responses we provide below satisfactorily address all the issues and concerns you and the reviewers have noted.

To facilitate your review of our revisions, the following is a point-by-point response to the questions and comments.

Proposals from Academic Editor

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Answer: We revised our manuscript based on the PLOS ONE style template.

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Answer: We added original blot image in our manuscript based on the PLOS ONE policy.

3. Please remove your figures from within your manuscript file, leaving only the individual TIFF/EPS image files, uploaded separately. These will be automatically included in the reviewers’ PDF.

Answer: We revised our manuscript by removing the figure image from the manuscript and uploading it individually.

General comments from Reviewer #1:

In this study, Seo et al. compared two transgenic mouse models for their susceptibility to SARS-CoV-2 infection. These two transgenic mice models are FVB background and express human ACE2 driven by two different promoters (K18 and CAG). They found that K18-hACE2 FVB mice were more susceptible to SARS-CoV-2 infection than the CAG-hACE2 FVB mice. Overall, the subject of this research is interesting as hACE2-transgenic mice have been broadly used in SARS-CoV and SARS-CoV-2 research, but no clear comparative data has been published regarding the mice expressing hACE2 driven by different promoters. This study tried to fill this gap and found different results compared to a previous model (Masamitsu et al., 2021, JCI insight). Nonetheless, this study lacks rigorous analyses of the two models and does not comprehensively discuss them with previous models.

1. As we’ve already known, the genetic background of mice is very important for the susceptibility to many virus infections, including SARS-CoV and SARS-CoV-2. Early studies have shown the utility of K18 and CAG mice (B6 background) for SARS-CoV-2 research, this study shows that the CAG-hACE2 transgenic FVB mice may not be a good model for SARS-CoV-2. The authors created the FVB transgenic mice but did not say what FVB mice were and why to use FVB mice.

Answer: Thank you for providing these insights. You have raised an important point; however, we believe that CAG-hACE2 transgenic FVB mouse is a good model for SARS-CoV-2 because CAG-hACE2 transgenic FVB mouse showed morbidity without lethality. We confirmed through additional research that these results in CAG-hACE2 due to the absence of viral replication in CNS, unlike K18-hACE2. For this reason, CAG-hACE2 transgenic FVB mice can be considered as a SARS-CoV-2 model for research on lung pathology. For this statement we have included revised Fig. 3 (p. 11), additional results in (p. 11, line 258-269), and discussion in (p. 17, line 417-422 with reference [40]) and marked it with red color.

Also, we added (p. 16, lines 390-393) with reference [33-35] and marked it with red color.

2. Masamitsu et al. (2021, JCI insight) reported the CAG promoter-driven hACE2 mouse model was highly susceptible to SARS-CoV-2. These mice, infected via intranasal or intratracheal route, exhibited severe disease. Since the K18-hACE2 FVB mice were highly susceptible to SARS-CoV-2, what would be the potential reasons for the low susceptibility of the CAG-hACE2 mice?

Answer: We revised (p. 16, lines 405-408) and added reference [15] using red color.

3. The authors briefly describe what the K18 promotor is but do not say anything about the CAG promotor. If the authors want to compare the utility of two transgenic mice, they should discuss the differences between the two promotors and the potential expression distribution of the targeted protein (human ACE2), and what effects would be resulted from the different protein distribution.

Answer: We have supplemented the brief describe on the CAG promoter in (p. 16, lines 405-408) and (p.18, lines 449-450) and marked in red color.

In both K18-hACE2 and CAG-hACE2, the hACE2 expression level in the lung, the main target organ of the SARs-CoV-2, was good. However, the K18 promoter, epithelial cell derived promoter, was intensively expressed in the lung, and the CAG promoter, a synthetic promoter that combines cytomegalovirus enhancer with chicken beta-actin gene promoter, was evenly expressed in all organs. These results exhibit a similar pattern to the C57BL/6 background hACE2 TG, described in the reference [15,16]. Cause the K18-hACE2 was generated with epithelial cell derived promoter, the expression of hACE2 in the respiratory epithelium was biased, and this is expected to result in severe pneumonia compared to CAG-hACE2.

4. If the authors want to compare the susceptibility of two transgenic mouse models, they should compare these mice infected with the same dose of virus. It is not very meaningful to compare the low- and high-dose groups within the same transgenic mice as the differences would be expected.

Answer: We agree with your suggestion that comparing with the same dose of virus is needed. So, we have added statistical analysis results in (p. 10, lines 226-227), (p. 10, lines 233-234), (p. 11, lines 256-257), (p. 11, lines 261-263), (p. 11, lines 266-267), (p. 12, lines 291-293), (p. 12-13, lines 302-304), (p. 13, lines 328-329), (p. 14, lines 342-343), and (p. 14, lines 352-354). Added sentences marked with red color. However, we have retained some of our arguments because, in establishing the novel model for SARS-CoV-2 infection, we thought it was important to compare the differences in pathogenicity depending on administered dose.

5. If the spleen and intestine respond to SARS-CoV-2 infection, viral titers or RNA levels in these organs should be investigated as well as the inflammatory response (e.g. cytokine levels).

Answer: We performed qPCR assay for duodenum and these results and discussion added in Fig. 3(p. 11), additional results in (p. 11, lines 267-269), and revised discussion in (p. 17-18, lines 433-439) (Added and revised sentences marked with red color). However, we couldn’t perform qPCR assay for spleen because entire spleen was formalin fixed for histopathological analysis to analysis white pulp atrophy.

Specific comments from Reviewer #1:

1. Fig 1: First, according to the beta-actin levels, would be the undetectable ACE2 in the liver due to inadequate total protein loaded? The same amount of total protein should be analyzed. An alternative approach is to detect by qPCR. Second, the brain and spleen should be included as 1) early studies showed that the brain of the K18-hACE2 mice is targeted by SARS-CoV-2, and 2) later data include the spleen. Third, later data no mock control for the IHC data.

Answer: Thank you for your suggestion. As you see in the original blot image of the supplemental figure, the CAG-hACE2 blot image used in Fig 1 was mouse #4. In the original blot image of mouse #3, hACE2 was expressed in all organs including the liver. However, we presented the blot image of mouse #4 by focusing on hACE2 expression in the lung, the main target of SARS-CoV-2. In the case of K18-hACE2, hACE2 expression level in the organs including the liver, heart, and intestine was very weak or absent, compared to CAG-hACE2, despite loading the same amount of total protein.

We agree with that brain and spleen is important target for the SARS-CoV-2. We have included additional research on the brain. Those results are available in revised Fig. 3 (p. 11), additional results in (p. 11, line 258-267), and discussion in (p. 17, line 417-422 with reference [40]) (Added and revised sentences marked with red color). However, additional research of the spleen was not possible, please see general comments 5 above.

We agree with mock control for the IHC data is necessary. We added mock control in Fig 1 and marked with red color.

2. Fig 2: Specify the statistical tests in this and other figure legends.

Answer: We revised Fig 2 (p. 10, lines 240-241), Fig 3 (p. 12, line 278), Fig 4 (p. 13, line 313), Fig 6 (p. 15, line 366), and Fig 8 (p. 15, line 381) and marked it with red color.

3. Fig 3: The viral RNA levels in the lungs, spleens, and intestines should be determined as later data include these organs. For the low-dose group, any explanation for no viral propagation during the course of infection? Is it meaningful to calculate the p values between the low and high-dose groups?

Answer: Thank you for your suggestion. In low-dose group, although the viral load maintained similar level from 2 dpi to 7 dpi (Fig 3), histopathological findings showed more severe lesions depending on the time passed (Fig 5). Based on these results, we thought that virus propagation appeared in the low-dose group.

For the viral RNA levels in spleens and intestines, please see general comments 5 above. Also, the meaning of p values between the low- and high-dose group, please see general comments 4 above

4. Fig 7: First, what is the white pulp percentage, the number of pulp per tissue slide, or the area of the pulp? If it was the number, how many slides were counted? If it was the area, how many pulps were counted? Second, for the number of goblet cells, how many villi were counted? Third, goblet cells cannot be seen in the current images. Enlarged images should be provided. Fourth, the viral loads in the spleen and intestine should be determined.

Answer: We calculated white pulp percentage by the area of white pulp relative to the area of the entire spleen with (magnification x100). The criteria for the goblet cells are the average of goblet cells from at least 10 villi of jejunum (Table 2). Also, we revised Fig 7 and input the enlarged image of the small intestine. The viral loads of the spleen and intestine, please see general comments 5 above.

Major comments from Reviewer #2:

In the manuscript titled “Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice,” Seo SM and colleagues compare host response and pathology of K18-hACE2 mouse model of SARS-CoV-2 infection to another transgenic line CAG-hACE2 mice both on FVB background. The authors find similarities and differences in SARS-CoV-2 replication and pathology in these strains. Specifically, SARS-CoV-2 replicated to high titers and caused severe clinical illness, fatal pneumonia, and mortality in K18 mice compared to CAG-hACE2 mice. Based on these results, the authors conclude that the K18-hACE2 mice are useful for vaccine testing while CAG-hACE2 mice for therapeutic evaluation. Specific comments are listed below.

1. Given the availability of K18-hACE2 mice on B6 background for COVID19 studies, which is a robust model, it is unclear why the authors chose to develop K18-hACE2 and CAG-hACE2 mice on an FVB background.

Answer: Thank you for your suggestion. We have reflected this comment by (p. 16, lines 390-393) with reference [33-35] and marked it with red color.

2. K18-hACE2 mice on B6 background develop fatal brain infection, which largely contributes to morbidity and mortality observed in these mice. However, the authors did not assess brain infection in mice on FVB background. If mice on FVB background do not show brain infection, then perhaps these mice would be better models to study SARS-CoV-2 infection and lung pathology.

Answer: You have raised an important question. We agree with you and have incorporated this suggestion throughout our paper. We have included revised Fig. 3 (p. 11), additional results in (p. 11, line 258-269), and discussion in (p. 17, line 417-422 with reference [40]) and marked it with red color.

3. The authors conclude that K18-hACE2 mice are better for vaccine testing and CAG-hACE2 mice for therapeutic evaluation. However, no rationale or basis is provided to support these conclusions.

Answer: We agree that our conclusions were lack of rationale. So, we have clarified our conclusion with revised sentence in (p. 18, lines 459-462) and marked with red color.

4. CAG-hACE2 mice infected with a high dose of the virus show similar or high lung titers compared to low dose virus infection in K18 mice (Figs 2 and 3). Yet, high dose CAG-hACE2 mice do not show signs of morbidity or pathology observed in low dose K18 mice. The authors should discuss the basis for these differences.

Answer: Thank you for your suggestion. We have incorporated your comments by (p. 17, line 417-422 with reference [40]) and marked it with red color.

5. K18-hACE2 mice have high ACE2 expression in other tissues compared to CAG-hACE2. In correlation, increased pathology is observed in the spleen and intestines in K18 mice. Do these changes correlate with virus infection these tissues, or the changes observed in non-lung tissues are due to inflammation?

Answer: Thank you for you suggestion. White pulp atrophy in the spleen due to SARS-CoV-2 infection has been reported in few case reports in human. We mentioned white pulp atrophy in (p. 13, lines 329-330 with references [25-27]) marked with red color. The hyperplasia of goblet cells in the small intestine was first reported in our study. Contrary to previous studies, which detected the virus in the small intestine, the virus was undetected in our qPCR assay. We considered that a very little amount of the virus couldn't be detected because below the limit of detection of the standard curve we drew.

6. Discussion should include the implications of the changes observed in mouse lung and non-lung tissues and how these changes correlate with changes in lungs and other tissues of patients with severe and mild-moderate covid19.

Answer: We have incorporated your comments by (p. 17, lines 413-414, with references [36-39]), and (p. 13, lines 329-330 with references [25-27]) and marked with red color. SARS-CoV-2 infection in patient’s small intestine was previously reported, however, the goblet cell hyperplasia in the small intestine is first reported in our research.

Minor comments from Reviewer #2:

1. Line 65: Change the sentence to mean “spread of SARS-CoV-2,” not “spread of COVID19,” as it is the virus that spreads.

Answer: We revised word COVID19 to SARS-CoV-2 in (p. 3, line 63) and marked it with red color.

2. Line 206: The virus dose provided here is different from the methods section. Please correct.

Answer: We revised (p. 9, line 209) and marked it with red color.

3. Line 371-372: Unclear what and how these studies suggest a new line of research.

Answer: We agree with you. We revised word research to model in (p. 16, line 395) and marked it with red color.

4. The authors make several claims not supported by the results. This reviewer suggests authors to carefully read the manuscript and modify the statements to reflect the results.

Answer: We have corrected and supplemented the insufficient statements by referring to the revisions sent by two reviewers.

Again, thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries. We have worked hard to incorporate your feedback and hope that these revisions persuade you to accept our submission.

Sincerely yours,

Yang-Kyu Choi

Submitted filename: Response to Reviewers_220601.docx

Click here for additional data file.

21 Jun 2022

4 Jul 2022

Dear Dr. Li

Subject: Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice [PONE-D-22-06945R1]

Thank you for inviting us to submit a revised draft of our manuscript entitled, "Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice" to PLOS ONE. We also appreciate the time and effort you and each of the reviewers have dedicated to providing insightful feedback on ways to strengthen our paper. Thus, it is with great pleasure that we resubmit our article for further consideration. We have incorporated changes that reflect the detailed suggestions you have graciously provided. We also hope that our edits and the responses we provide below satisfactorily address all the issues and concerns you and the reviewers have noted.

Proposals from Academic Editor

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

While the manuscript is substantially improved, some minor issues remain. As the reviewers pointed out, some corrections and additional clarifications are needed

1. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Answer: We revised our references based on “Vancouver” style in (p. 20, lines 497, 504, 507, and 509), (p. 21, lines 519, and 537), (p. 22, lines 545, 547, 549-550, 556, 558, and 564), (p. 23, lines 571), and (p. 24, line 599). We marked the revised sentences with red color.

2. While the revised manuscript is substantially improved, some minor issues remain. As you see from the reviewers' comments, some corrections and additional clarifications are needed.

Answer: We revised our manuscript based on reviewers’ comments.

Review comments from Reviewer #1:

1. Overall, the authors properly addressed the reviewers’ comments. But oddly, the authors revised figure 1 and switched the labeling of Fig1a and 1b. The revised fig.1 indicated that CAG-hACE2 mice organs (kidney, lung, heart, intestine) expressed high levels of hACE2, whereas the lungs of the k18-hACE2 mice were the primary organ expressing hACE2. This contradicts the rest of the data (fig3, 7, 8) and statement (lines 265-276) as well as previous studies. Please examine.

Answer: Thank you for providing these insights. In our original manuscript, there was an error in the labeling of Fig1a and 1b. So, we switched the labeling in the revised manuscript. In contrast to qPCR and histopathology performed in the small intestine, Western blot was performed in the large intestine. For this reason, it is considered that a contradiction appeared between the expression level of hACE2 and pathological scoring. We revised our manuscript (p. 8, line 190, marked with red color.), Fig 1. (from intestine to large intestine), and supplemental figure 1. (from intestine to large intestine).

Review comments from Reviewer #2:

The authors have made significant revision and addressed majority of the concerns. There are several minor errors that need to be corrected. Comments are listed below.

1. At several instances where a new text is added, the authors mention " a significant difference was observed" or used similar language throughout the text. This should be corrected to clearly mention what differences were observed, and whether the difference was increased or decreased between the groups. Also- include the significance of these differences.

Answer: Thank you for your suggestion. We have reflected this comment by (p. 10, lines 226-227), (p. 10, lines 233-234), (p. 11, lines 256-257), (p. 11, lines 262-263), (p. 11, lines 266-268), (p. 12, lines 291-293), (p. 13, lines 302-304), (p. 14, lines 328-329), (p. 14, lines 342-343), and (p. 14, lines 352-354). Revised and added sentences marked with red color.

2. The authors use the word " virus propagation" in certain tissue on numerous occasions. This should be corrected to virus titers or virus replication or virus load.

Answer: We agree with your assessment. We revised the word “virus propagation” to “viral replication” and marked it with red color in (p. 11, line 258, 264, and 268), and (p.17, line 416).

3. In the earlier iteration, this reviewer asked authors to provide justification for recommending use of K18-hACE2 mice for vaccine evaluation versus CAG-hACE2 mice for therapeutic assessment. However, this statement is still not well justified. Therefore, should be removed from the text or provide better explanation.

Answer: We agree that our conclusions lack proper explanation. So, we have clarified our conclusion with a revised sentence (p. 2, lines 46-47) (p. 18, lines 457-460) and marked it with red color.

Again, thank you for giving us the opportunity to strengthen our manuscript with your valuable comments and queries. We have worked hard to incorporate your feedback and hope that these revisions persuade you to accept our submission.

Sincerely yours,

Submitted filename: Response to Reviewers_220704.docx

Click here for additional data file.

12 Jul 2022

Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice

PONE-D-22-06945R2

Dear Dr. Choi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Kui Li

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The authors have addressed all the remaining concerns and the manuscript is acceptable for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

15 Jul 2022

PONE-D-22-06945R2

Development of transgenic models susceptible and resistant to SARS-CoV-2 infection in FVB background mice

Dear Dr. Choi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Kui Li

Academic Editor

PLOS ONE