Toxoplasma gondii and Rickettsia spp. in ticks collected from migratory birds in the Republic of Korea.

Migratory birds disperse ticks and associated tick-borne pathogens along their migratory routes. Four selected pathogens of medical importance (Coxiella burnetii, Rickettsia spp., Francisella tularensis, and Toxoplasma gondii) were targeted for detection in 804 ticks (365 pools) collected from migratory birds at Hong and Heuksan Islands in the Republic of Korea (ROK) from 2010 to 2011 and 2016. Toxoplasma gondii and Rickettsia spp., were detected in 1/365 (0.27%) and 34/365 (9.32%) pools of ticks, respectively. T. gondii and five rickettsial species were recorded in ticks collected from migratory birds for the first time in ROK. The five rickettsial species (R. monacensis, Candidatus Rickettsia longicornii, R. japonica, R. raoultii, and R. tamurae) were identified using sequence and phylogenetic analysis using ompA and gltA gene fragments. Rickettsia spp. are important pathogens that cause rickettsiosis in humans, with cases recorded in the ROK. These results provide important evidence for the potential role of migratory birds in the introduction and dispersal of T. gondii and Rickettsia spp. along their migratory routes and raise awareness of potential transmission of zoonotic tick-borne pathogens associated with migratory birds in the ROK.

Introduction

Migratory birds may play an important role in the potential spread of ticks and associated tick-borne pathogens. Ticks that feed on birds are transported across geographical barriers to new habitats along their migratory routes[1-3]. In addition, ticks harboring tick-borne pathogens are likely dispersed to different regions during the annual migration of birds[2,4,5]. Tick infestation levels are dependent upon ground-feeding behavior and movement characteristics of birds[6]. While resident ground feeding birds may be more heavily infested with ticks, migratory birds may play a more significant role in the long-distance dispersal of tick species and associated pathogens[1]. Environmental and climate changes may provide unexpected opportunities for the potential introduction of ticks and associated pathogens[7-9]. Therefore, information on migration routes of birds is important to understand the potential influence of migratory birds in the future distribution of ticks and tick-borne pathogens along their migration routes, and to raise awareness for the potential transmission of tick-borne pathogens of medical importance in the Republic of Korea (ROK).

Birds are natural reservoirs of selected tick-borne pathogens that are of veterinary and medical importance[10,11]. Evidence of various tick-borne pathogens harbored by ticks infesting migratory and resident birds has been shown worldwide. Borrelia and Rickettsia spp. were the most prevalent tick-borne microorganisms detected in Ixodes spp. collected from migratory birds from European countries[12-14], USA[15,16], and Asia[17,18]. Rickettsia spp. were also detected from Hyalomma spp. that originated from African countries and were transported by migratory birds to Italy[5]. Meanwhile, Haemaphysalis spp. that infested birds were identified that harbor Rickettsia spp., Borrelia burgdorferi, Anaplasma spp., and Ehrlichia spp.[16,18], and also possibly contributed to the dispersal of Severe Fever with Thrombocytopenia Syndrome (SFTS) virus present in China, Japan, and Korea[19]. Consequently, identification of tick species and associated tick-borne pathogens and host migratory birds are important to assess the potential risk of tick-borne disease introductions in each region where there are suitable habitats for migratory birds.

In the ROK, Heuksan-do (do = island), Hong-do, and Nan-do are stopover habitats of migratory birds that are located in the Yellow Sea. Ticks collected from migratory birds were identified to species, that included eight species (Haemaphysalis flava, H. formosensis, H. longicornis, H. concinna, H. ornithophila, Ixodes nipponensis, I. turdus, and Amblyomma testudinarium) belonging to three genera. Of the eight species, I. turdus and H. flava were the most prevalent species collected[20-22]. Only three tick-borne microorganisms (Borrelia spp., A. phagocytophilum, and Bartonella grahamii) were detected in these ticks. Borrelia spp. were the most prevalent microorganisms detected in I. turdus and H. flava, while A. phagocytophilum and B. grahamii were detected only in I. nipponensis and I. turdus, respectively[21,22]. However, information for other tick-borne microorganisms such as Coxiella burnetii, Rickettsia spp., Toxoplasma gondii, and Francisella tularensis in ticks collected from migratory birds remain unknown. Infections of these pathogens in humans in the ROK were recorded and potentially influence public health[23-28].

Accordingly, this study aimed to extend our previous work[22] to survey for the presence of four tick-borne pathogens, C. burnetii, T. gondii, F. tularensis, and Rickettsia spp., in ticks collected from migratory birds at two islands, Hong-do and Heuksan-do, ROK. Sequencing and phylogenetic analysis were done for species identification of Rickettsia spp.

Results

Tick-borne microorganisms in bird ticks

A total of 804 ticks belonging to three genera and seven species were placed in 365 pools according to bird host, date and location of collection, and stage of development (Table 1). I. turdus was the most commonly collected species and accounted for 72.89% of all collected ticks, followed by H. flava with 16.17%, I. nipponensis 5.85%, H. longicornis 4.23%, H. phasiana 0.50%, H. formosensis 0.25%, and A. testudinarium 0.12% (Table 1).

Table 1

Detection of tick-borne pathogens from ticks collected from migratory birds in the Republic of Korea.

Tick species	Living stage (Tick No.; pool No.)	Pathogens (positive pool (MIR))
		Rickettsia spp.	Toxoplasma gondii	Francisella tularensis	Coxiella burnetii
Ixodes turdus	Larva (409; 109)	0	0	0	0
	Nymph (151; 103)	1 (0.66%)	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (26; 25)	0	1 (3.85%)	0	0
Subtotal	586; 237	1 (0.17%)	1 (0.17%)	0	0
Haemaphysalis flava	Larva (52; 19)	2 (3.85%)	0	0	0
	Nymph (78; 50)	3 (3.85%)	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	130; 69	5 (3.85%)	0	0	0
Haemaphysalis longicornis	Larva (27; 13)	7 (25.93%)	0	0	0
	Nymph (7; 6)	0	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	34; 19	7 (20.59%)	0	0	0
Ixodes nipponensis	Larva (28; 15)	8 (28.57%)	0	0	0
	Nymph (19; 19)	11 (57.89%)	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	47; 34	19 (40.43%)	0	0	0
Haemaphysalis phasiana	Larva (2; 1)	0	0	0	0
	Nymph (2; 2)	0	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	4; 3	0	0	0	0
Haemaphysalis formosensis	Larva (0; 0)	0	0	0	0
	Nymph (2; 2)	1 (50.00%)	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	2; 2	1 (50.00%)	0	0	0
Amblyomma testudinarium	Larva (0; 0)	0	0	0	0
	Nymph (1; 1)	1 (100.00%)	0	0	0
	Male adult (0; 0)	0	0	0	0
	Female adult (0; 0)	0	0	0	0
Subtotal	1; 1	1 (100.00%)	0	0	0
Total	804; 365	34 (4.23%)	1 (0.12%)	0	0

MIR = [(number of positive pools)/(total number of ticks)] × 100.

Ticks were assayed for selected pathogens, Rickettsia spp., T. gondii, F. tularensis, and C. burnetii. A total of one and 34 pools of ticks were positive for T. gondii (Suppl. Fig. S1) and Rickettsia spp. (Suppl. Fig. S2), respectively. T. gondii was detected only in one adult female I. turdus tick collected from the pale thrush, Turdus pallidus.

Although I. nipponensis was less commonly collected, a higher proportion was positive for Rickettsia spp. (55.88%; 19/34 pools), followed by H. longicornis (20.59%; 7/34 pools), and H. flava (14.71%; 5/34 pools), while one pool each of I. turdus (2.94%; 1/34 pools), H. formosensis (2.94%; 1/34 pools), and A. testudinarium was positive (2.94%; 1/34 pools). Rickettsia spp. were not detected in H. phasiana. The overall minimum infection rate (MIR) for Rickettsia spp. was 4.23%, but was 100%, 50.0%, 40.43%, 20.59%, 3.85%, and 0.17% for A. testudinarium, H. formosensis, I. nipponensis, H. longicornis, H. flava, and I. turdus, respectively (Table 1).

Sequencing and phylogenetic analysis

Toxoplasma gondii was confirmed by sequence analysis of repetitive DNA fragments from nested conventional PCR (504 bp). Comparison of generated sequences (Suppl. Table S1) with deposited sequences on NCBI databank showed 100% identity with T. gondii sequences detected from mice in India (NCBI accession No.: KC607824) and cattle and goats in Iraq (NCBI accession No.: KX963353 and KX963355).

Detection of Rickettsia spp. targeting ompA and gltA gene fragments from 34 Rickettsia spp. positive tick pools showed that 30 and 34 pools were positive, respectively. The sequences of ompA and gltA genes were deposited on NCBI with an accession number of each sequence as shown in Table 2 and Suppl. Tables S2 and S3. Variations among the sequences of ompA and gltA gene fragments were observed. The percent sequence identity among sequences of ompA and gltA was 78.7% and 93.7%, respectively. Sequences of the gltA gene were divided into five Rickettsia spp. groups, while the ompA gene was separated into four Rickettsia spp. The percent identity among the generated sequences for each group ranged from 97.2 to 100.0%. Comparison of generated sequences of the ompA and gltA gene fragments to the deposited sequences of Rickettsia species on NCBI and phylogenetic analysis showed that the detected Rickettsia spp. belong to five species (R. monacensis, Candidatus Rickettsia longicornii, R. japonica, R. raoultii, and R. tamurae) with the sequence similarity ranging from 98.80 to 100.00%, while 3 specimens could not be identified to species (Fig. 1; Table 2). Although phylogenetic analysis of ompA gene showed that the detected strains (HS40, HS46, HS63, HS76, HS81, HS129, H78, and H179) were in the same clade with Ca. R. longicornii and Ca. R. jingxinensis (Fig. 1), the sequence analysis showed a higher similarity (100%) of detected strains to Ca. R. longicornii than Ca. R. jingxinensis (99.2%) (Suppl. Table S2). Therefore, the detected strains were identified as Ca. R. longicornii.

Table 2

The identified species of Rickettsia in bird ticks collected from 2010 to 2011 and in 2016.

No	Group	Rickettsia spp.	Tick species	Migratory bird species	Tick pool (GenBank Accession No., ompA; gltA)
1	I	R. monacensis	Ixodes nipponensis	Turdus pallidus**	H18 (OL687176; OL687206)
2					H56 (OL687177; OL687207)
3					H57 (OL687178; OL687208)
4				Emberiza aureola	H75 (OL687179; OL687209)
5				Acrocephalus orientalis	H167 (OL687210*)
6				E. chrysophrys	H171 (OL687180; OL687211)
7				E. spodocephala	H173 (OL687181; OL687212)
8					H188 (OL687182; OL687213)
9					HS59 (OL687183; OL687214)
10					HS128 (OL687184; OL687215)
11				Locustella pleskei	HS38 (OL687185; OL687216)
12					HS39 (OL687186; OL687217)
13					H166 (OL687187; OL687218)
14				Bradypterus davidi	HS44 (OL687219*)
15				L. ochotensis	HS45 (OL687188; OL687220)
16				E. rutila	HS69 (OL687189; OL687221)
17					H177 (OL687190; OL687222)
18				E. elegans**	HS77 (OL687191; OL687223)
19					HS122 (OL687192; OL687224)
20			I. turdus		H53 (OL687193; OL687225)
21	II	Candidatus Rickettsia longicornii	Haemaphysalis longicornis	E. pallasi	H179 (OL687168; OL687198)
22				A. orientalis	HS40 (OL687169; OL687199)
23					HS46 (OL687170; OL687200)
24				E. rutila	HS63 (OL687171; OL687201)
25				E. chrysophrys	HS76 (OL687172; OL687202)
26				E. tristrami	HS81 (OL687173; OL687203)
27				E. spodocephala	HS129 (OL687174; OL687204)
28			H. flava	Phylloscopus inornatus	H78 (OL687175; OL687205)
29	III	R. japonica	H. flava	Tarsiger cyanurus	HS28 (OL687165; OL687195)
30				E. chrysophrys	HS73 (OL687166; OL687196)
31			H. formosensis	Tarsiger cyanurus	HS29 (OL687167; OL687197)
32	IV	R. raoultii	H. flava	E. tristrami	HS83 (OL687226*)
33				E. elegans**	H194 (OL687227*)
34	V	R. tamurae	Amblyomma testudinarium	Zoothera aurea**	H20 (OL687194; OL687228)

*Only gltA gene was amplified. **These species may be also regarded as residents or partial migrants in Korea, but the birds in this study were all true migrants that were crossing the national borders and ecological barriers like the Yellow Sea.

Figure 1

Phylogenetic tree of Rickettsia spp. detected from bird ticks. (a) Phylogenetic tree based on ompA gene fragment sequences (b) gltA gene fragments showed that Rickettsia spp. belonged to five species: R. monacensis, Candidatus R. longicornii, R. japonica, R. raoultii, and R. tamurae. The number of pooled samples for each species is in parentheses. The unique collection/assay number for each tick pool positive for Rickettsia spp. and NCBI accession numbers are shown.

Rickettsial infected ticks and migratory bird species

Based on the analysis of the ompA and gltA gene fragment sequences, R. monacensis (58.82%; 20/34 pools) was the most prevalent rickettsial species, followed by Ca. R. longicornii (23.53%; 8/34 pools), R. japonica (8.82%; 3/34 pools), R. raoultii (5.88%; 2/34 pools), and R. tamurae (2.94%; 1/34 pool) (Table 2).

R. monacensis was detected primarily in I. nipponensis (19/20 pools), and one pool of I. turdus (1/20). Ca. R. longicornii was detected in H. longicornis. R. raoultii and R. japonica were detected in pools of H. flava. R. tamurae was detected in A. testudinarium. Wild bird species that were hosts of Rickettsia infected ticks are shown in Table 2.

Discussion

Rickettsia spp. and T. gondii were detected in pools of ticks collected from migratory birds. The results provide additional information about microorganisms harbored by ticks infesting migratory birds in the ROK. A total of five tick-borne microorganisms, including Borrelia spp., A. phagocytophilum, B. grahamii, T. gondii, and Rickettsia spp., have been recorded in ticks collected from migratory birds in the ROK[21,22]. Rickettsia spp. and Borrelia spp. were the most prevalent tick-borne microorganisms detected from Ixodes spp., and the results are consistent with previous reports from other countries[12-16,18]. However, there was a high infection rate and greater species diversity of Rickettsia species observed among ticks collected from migratory birds in the ROK compared to reports from other countries. Human infections of R. monacensis, R. japonica, and R. raoultii have been documented in the ROK[27-29], and R. tamurae in Japan[30]. Therefore, ticks from migratory birds likely play a certain role in the transportation of ticks and associated rickettsial pathogens to these islands and the Korean mainland.

Toxoplasma gondii has been detected in birds in other areas of the world[31,32], and the potential role of ticks and migratory birds in dispersing T. gondii was suggested[33,34]. However, no evidence of T. gondii carried by bird ticks had been previously provided. In this study, one female I. turdus tick collected from a pale thrush was positive for T. gondii, this is the first report of T. gondii detected in I. turdus in the ROK. Therefore, the T. pallidus and associated ticks may have contributed to the spread of T. gondii along its migratory routes. Further studies on the presence of T. gondii in T. pallidus bird and direct transmission of T. gondii by I. turdus need to be conducted.

Various tick-borne microorganisms (Rickettsia spp., Borrelia spp., Anaplasma spp., B. grahamii, and T. gondii) were detected in ticks collected from migratory birds in the ROK, of which Rickettsia spp. were the most abundant group[20-22]. However, infections of these pathogens in related bird species has not been characterized in the ROK. There are stopover habitats in the ROK for migratory birds on their migration routes between the northeastern Palearctic region, including Russia and eastern China, and southeast Asia[21]. The presence of tick-borne pathogens (B. garinii, A. phagocytophilum, and E. chaffeensis) in migratory birds was confirmed in China[35]. These results suggest that the migratory birds collected in the ROK may be infected and become important natural reservoirs of these tick-borne pathogens. Therefore, it is necessary to conduct further studies on the surveillance of tick-borne pathogens in migratory and resident birds and local tick and animal/bird reservoirs to better understand the role of migratory birds in the potential introduction and spread of tick-borne pathogens.

Wild birds are known to be reservoir hosts of C. burnetii and F. tularensis and associated ticks might transmit the pathogens to human[36,37]. Ixodes ricinus infesting birds were suggested to be the vectors of C. burnetii[37,38]. In the ROK, C. burnetii and F. tularensis were detected more frequently in H. longicornis and H. flava ticks collected from the environmental habitats and domestic or wild animals[39-41]. However, the two pathogens were not detected in ticks infesting wild birds in this study, and the presence of these two pathogens in ticks feeding on birds in China and other southeast Asian countries located along their migration routes[21] has not been recorded.

Surveillance of C. burnetii, F. tularensis, Rickettsia spp., and T. gondii in this study demonstrated the presence of T. gondii in ticks collected from migratory birds. Rickettsia spp., including R. monacensis, Ca. R. longicornii, R. japonica, R. raoultii, and R. tamurae, were the most commonly detected microorganisms in ticks collected from migratory birds. The results provide important information for further studies on the role of migratory birds in dispersion of T. gondii and Rickettsia spp. and raise awareness of tick-borne disease transmission related to migratory birds and associated ticks in the ROK.

Materials and methods

Tick collection

Bird and tick surveys were conducted as part of the constant-effort bird banding program of the Migratory Birds Research Center under the National Park Research Institute, Korea National Park Service on islands with access only by government and wildlife capture permits. Ticks were collected from migratory birds at two islands, Hong-do (34° 41′ N, 125° 11′ E) and Heuksan-do (34° 41′ N, 125° 25′ E), Jeollanam Province, ROK, during 2010–2011 and in 2016. These two islands are located in the southwestern tip of the Korean Peninsula, most birds captured in this study were true migrants that were crossing a national border and an ecological barrier, the Yellow Sea.

Tick collected from 2010 to 2011, pooled by species and stage of development, were designated as H1-H195 and in 2016 they were designated as HS1-HS184. Samples in this study were shared with those in the analysis of Anaplasma and Borrelia species in a previous study[22], while a few ticks were supplemented to replace destroyed samples for the analysis. Detailed information on collection sites, bird collections, and tick collections were reported in Seo et al.[22]. Ticks were identified using standard morphological keys[43-45], and then placed in pools according to collection location and date, stage of development, sex, and, host species. Nymphs and larvae were placed in pools of 1–6 and 1–9 ticks, by species and stage of development, respectively, while adult ticks were assayed individually[22]. The pooled samples were placed in 1.5 ml cryovials containing 70% ethanol and stored at – 80 °C until analysis.

DNA extraction

After washing three times using UltraPure™ DNase/RNase-Free distilled water (Thermo Fisher Scientific, USA), the tick samples were placed in a tissue grinding tube (SNC, Hanam, Korea) containing 0.6 mL phosphate-buffered saline and 2.3 mm stainless-steel beads and then homogenized using Precellys 24 Tissue Homogeniser (Bertin Instruments, Montigny-le-Bretonneux, France). The homogenate was centrifuged at 300×g for 1 min and the supernatant was collected for total nucleic acid extraction using Maxwell® RSC Viral Total Nucleic Acid Purification Kits (Promega, USA) and an automated Maxwell RSC Instrument (Promega). The procedure of isolation was done according to the manufacturer’s instructions. Extracted nucleic acids were stored at − 80 °C until further used.

PCR analysis

Primers and PCR conditions for detection of the selected four targets are shown in Table 3. DNA used for positive control in PCR detection of C. burnetii from Nine Mile strain, and of T. gondii was from the strain G-P-14-7 that was isolated and stored in Animal and Plant Quarantine Agency, South Korea. Positive control DNA of F. tularensis and Rickettsia spp. was chemically synthesized according to the sequence information on NCBI with accession No. was CP073128 (F. tularensis) and CP047359 (R. japonica). Recombinant DNA carrying standard fragments were constructed using the pGEM®-T vector system (Promega, Madison, WI, USA) and PCR products amplified by each detection primer pair. Detection of C. burnetii was done by two successive PCRs, conventional PCR was performed using primer pair Trans1/2 (Table 3), followed by nested real-time PCR (qPCR) using primer pair Cox111-F/R (Table 3). AccuPower ProFi Taq PCR PreMix (Bioneer, Daejeon, Korea) was used for conventional PCR, each 20 µL reaction mix included: 3 µL DNA template, 1 µL (10 pmol) of each primer, and 15 µL of double-distilled water (ddH2O). PCR products obtained by conventional PCR was 250 × diluted and used for nested qPCR. Each 20 µL reaction mixture was composed of 1 µL (10 pmol) of each primer, 1 µL (5 pmol) of probe, 10 µL of PCR premix (IQ supermix, Bio-Rad Laboratories), 2 µL of diluted DNA template, and 5 µL of ddH2O. Nested qPCR was performed using the CFX96 Touch Real-time PCR Detection System (Bio-Rad Laboratories, USA). Assays for F. tularensis and T. gondii were conducted using qPCR. Each 20 µL reaction mix consisted of 3 µL DNA template, 1 µL (10 pmol) of each primer, 1 µL (5 pmol) of probe, 4 µL of ddH2O, and 10 µL of PCR premix (IQ supermix, Bio-Rad Laboratories). The sample positive for T. gondii using qPCR was used for nested PCR to amplify the repetitive DNA gene fragments (Table 3). After confirming the expected band in electrophoresis agarose gel (1.5%), the PCR product was purified for sequence analysis.

Table 3

Primers and PCR conditions for the detection of tick-borne pathogens.

No	Target	Primer name	Sequence (5’-3’)	Target gene	PCR condition	References
1	Coxiella burnetii	Cox1111-F	GTC TTA AGG TGG GCT GCG TG	IS1111, 295 bp	50 °C (2 min), 95 °C (5 min), 45 cycles of 95 °C (15 s)—60 °C (30 s)	[52]
		Cox1111-R	CCC CGA ATC TCA TTG ATC AGC
		Probe	FAM-AGC GAA CCA TTG GTA TCG GAC GTT-TAMRA
		Trans 1	TATGTATCCACCGTAGCCAGTC	IS1111, 687 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 57 °C (30 s), 72 °C (1 min)	[53]
		Trans 2	CCCAACAACACCTCCTTATTC
2	Francisella tularensis	Tula4-F	TTACAATGGCAGGCTCCAGA	Tul4, 138 bp	95 °C (3 min), 45 cycles 95 °C (15 s)- 60 °C (30 s)	This study
		Tula4-R	TGTCCACTTACCGCTACAGA
		Tula4-Probe	FAM-TTCTAAGTGCCATGATACAAGCTTCCCA-BHQ-1
3	Rickettsia spp.	ITS-F	GATAGGTCGGGTGTGGAAG	ITS, 388 bp	95 °C (3 min), 45 cycles of 95 °C (15 s)–64 °C (15 s)–72 °C (15 s)	[54]
		ITS-R	TCGGGATGGGATCGTGTG
		RpCS.877p	GGGGGCCTGCTCACGGCGG	gltA, 382 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 55 °C (30 s), 72 °C (30 s)	[55]
		RpCS.1258n	ATTGCAAAAAGTACAGTGAACA
		RpCS.896p	GGCTAATGAAGCAGTGATAA	gltA, 338 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 53 °C (30 s), 72 °C (30 s)
		RpCS.1233n	GCGACGGTATACCCATAGC
		Rr190k. 71p	TGGCGAATATTTCTCCAAAA	OmpA, 650 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 49 °C (30 s), 72 °C (1 min)	[56]
		Rr190k. 720n	TGCATTTGTATTACCTATTGT
		Rr190k. 71p	TGGCGAATATTTCTCCAAAA	OmpA, 532 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 52 °C (30 s), 72 °C (1 min)
		Rr190k. 602n	AGTGCAGCATTCGCTCCCCCT			[57]
4	Toxoplasma gondii	TOXO-F	TCCCCTCTGCTGGCGAAAAGT	B1, 98 bp	95 °C (3 min), 40 cycles 95 °C (15 s), 60 °C (30 s)	[58]
		TOXO-R	AGCGTTCGTGGTCAACTATC GATTG
		Probe	FAM-TCTGTGCAACTTTGGTGTATTCGCAG-TAMRA
		TOXO4	CGCTGCAGGGAGGAAGACGAAAGTTG	Repeated DNA, 529 bp	95 °C (5 min), 40 cycles 95 °C (30 s), 60 °C (30 s), 72 °C (1 min)	[59]
		TOXO5	CGCTGCAGACACAGTGCATCTGGATT
		TOXO4	CGCTGCAGGGAGGAAGACGAAAGTTG	Repeated DNA, 504 bp
		TOXO5-R1	TCTCCTACGCCTCCTCCTCCCTT			This study

For Rickettsia spp. detection, qPCR was performed using 2 × Rapi: Detect™ Master mix with dye (SYBR green, Cat. No.: 9799100100; Genesystem, Korea). Each 20 µL reaction mix consisted of 3 µL of DNA template, 1 µL (10 pmol) of each primer, 5 µL of ddH2O, and 10 µL of Detect™ Master mix. The positive samples were used for conventional nested PCR targeting two gene fragments (gltA, ompA) (Table 3). After confirming the expected band in 1.5% agarose gel by electrophoresis, the nested PCR products were purified and sequenced by Macrogen Inc. (Seoul, Korea).

The Minimum infection rate (MIR) was calculated for each species: MIR = [(number of positive pools)/(total number of tested ticks)] × 100. Each positive pool was estimated to contain only one infected tick[46,47].

Sequence and phylogenetic analysis

The generated sequences were compared to the NCBI database using nucleotide Basis Local Alignment Search Tool (BLAST)[48] for species identification. For analysis of Rickettsia spp. the generated sequences of each gene were grouped after alignment using AlignX, a component of Vector NTI Advance v. 10.3 (Invitrogen Co.). Representative sequences of each positive pooled sample were compared to the NCBI database using nucleotide Basis Local Alignment Search Tool (BLAST)[48]. Identical sequences of Rickettsia acquired from the NCBI were used for alignment together with generated sequences using Clustal X version 2.0[49], and Maximum likelihood phylogenetic trees were created using the Kimura 2-parameter model that estimate evolutionary distance based on the nucleotide substitutions[50], gamma distribution, and bootstrapping 1000 times with MEGA7 software[51].

Ethics approval

All field procedures including bird capture, handling, and sampling were under the bird banding station licenses (#501000085200500002, 2011-8, 2016-1, and 2016-2) issued by the local government (Shinan Country), the Korean Ministry of Environment (Yeongsan River Environmental Office), and the Cultural Heritage Administration. This study was approved by The Korea National Park Service (KNPS). Captured birds were safely and ethically examined, sampled, and released safely following the institutional guideline (National Park Research Institute, KNPS) for constant-effort bird banding surveys in Korean National Parks[42].

Supplementary Information.