Literature DB >> 35877678

Using DNA metabarcoding and a novel canid-specific blocking oligonucleotide to investigate the composition of animal diets of raccoon dogs (Nyctereutes procyonoides) inhabiting the waterside area in Korea.

Cheolwoon Woo1, Priyanka Kumari1,2, Kyung Yeon Eo3, Woo-Shin Lee4, Junpei Kimura5, Naomichi Yamamoto1,2.   

Abstract

The raccoon dog (Nyctereutes procyonoides) is known to be an opportunistic generalist who feeds on a wide variety of foods. Historically, their diet has been investigated by morphological observation of undigested remains in feces, requiring specialized knowledge such as osteology, zoology, and phytology. Here, we used DNA metabarcoding of vertebrate 12S rRNA gene and invertebrate 16S rRNA gene to investigate their fecal contents. Additionally, we developed a blocking oligonucleotide that specifically inhibits the amplification of the canid 12S rRNA gene. We confirmed that the blocking oligonucleotide selectively inhibit the amplification of raccoon dog's DNA without significantly changing the composition of the preys' DNA. We found that the main foods of raccoon dogs in our study area, the waterside of paddy fields in Korea, were fishes such as Cyprinidae and insects such as mole crickets, which makes sense given the Korean fauna and their well-known opportunistic feeding behaviors. As a method to conveniently and objectively investigate feeding habits of raccoon dogs, this study provided baseline information on DNA metabarcoding. By using DNA metabarcoding, it is expected that the diet habits and ecology of raccoon dogs will be better understood by future research.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35877678      PMCID: PMC9312373          DOI: 10.1371/journal.pone.0271118

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


1. Introduction

The raccoon dog (Nyctereutes procyonoides) is a medium-size canid native to East Asia including Korea [1], and was introduced to European countries in the first half of the 20th century [2]. In Korea, the raccoon dog is among one of extant carnivoran species, including the leopard cat, Eurasian otter, yellow-throated marten, and least weasel [3]. While many of these carnivorans are endangered in Korea [3] and classified in a vulnerable category according to the Korean Red List of Threatened Species [4], the raccoon dog maintains a decent population [5] due to its high genetic diversity, adaptability, versatility in feeding habits, and reduction in the population of its predators and competitors [6-9]. Its high adaptability has also been reported in other countries. For example, in Japan, raccoon dogs are known to inhabit urban forests, such as the Imperial Palace [10], in the middle of Tokyo, a crowded megacity. In order to elucidate the origin of its high environmental adaptability, it is necessary to further investigate into the details of its ecology and food habits. The raccoon dog is opportunistically feeding on plants, invertebrates, fishes, amphibians, reptiles, birds, and small mammals [10-17]. Through such predation and feeding, the raccoon dog is thought to directly and indirectly affect the ecosystem [18, 19], and by investigating their predation and feeding behavior, we can gain better understandings of their involvement in ecosystem functions. To investigate their predation and feeding habits, the fecal contents are often surveyed. To date, many studies have been reported on the fecal analysis of raccoon dogs in countries such as Belarus [11], Denmark [12], Finland [13, 14], Germany [15, 16], and Japan [10, 17, 20–22]. However, all of these studies rely on morphological observations of undigested remains of fruits, seeds, hair, skin, feathers, bones, and so on. Furthermore, the morphological observation is laborious and requires expertise in morphology and osteology of a broad range of organisms eaten by raccoon dogs. In addition, the morphological observation can be difficult if species or genus level identification is warranted due to the limited taxonomic resolution. Recently, studies on fecal analysis for dietary investigations of wildlife using DNA barcoding have been reported (e.g., [23-29]). The method using DNA barcoding has the advantage that identification is objective and does not require morphological and osteological expertise. The dietary analysis using DNA barcoding is usually performed by extracting DNA from the collected fecal samples and analyzing the sequences of the extracted DNA. For carnivores, DNA markers such as vertebrate 12S rRNA gene [30] and invertebrate 16S rRNA gene [26] are targeted and sequenced. In addition, high-throughput sequencing (HTS) technologies have also been introduced for diet analyses of wildlife, such as bats in Finland [25], brown bears in Italy [26], Eurasian otters in Korea [27], and leopard cats in China [28] and Pakistan [29]. Due to its high sensitivity and ability to generate large amounts of genetic information, HTS can provide taxonomically more detailed information on dietary profiles of wildlife. A caveat to the DNA barcoding-based method is that if the predator under investigation is a vertebrate and universal vertebrate primers are used for PCR amplification (for preparation of DNA libraries), the predator’s DNA will also be amplified. This is problematic because, with the limited sequencing resource, the inclusion of DNA reads of the predator reduces the number of DNA reads of prey animals, resulting in the reduction in sensitivity in the detection of prey animals. Therefore, it is better to suppress the PCR amplification of the predator’s DNA. To selectively prevent the amplification of the unwanted predator’s DNA, the method using blocking oligonucleotides was invented [31]. The blocking oligonucleotide is designed to anneal at the template site between the forward and reverse primers, and it can block amplification by modification by a hydrocarbon at its 3’-end (called C3 spacer) [32, 33]. The method using blocking oligonucleotides has been widely applied to dietary surveys of wildlife, such as brown bear [26], leopard cat [28, 29], and Eurasian otter [27]. However, as far as we notice, the blocking oligonucleotide for the raccoon dog has not been reported yet. In this study, we aimed to 1) develop the blocking oligonucleotide for the raccoon dog, and 2) investigate diet profiles of raccoon dogs in Korea using HTS-based DNA metabarcoding. For DNA metabarcoding, we sequenced vertebrate 12S rRNA gene and invertebrate 16S rRNA gene. For sequencing vertebrate 12S rRNA gene, the developed blocking oligonucleotide was used. The use of DNA barcoding is expected to facilitate dietary research of wildlife, elucidate their roles and functions in ecosystems, and help protect them.

2. Materials and methods

2.1. Fecal samples

This study analyzed fecal samples of raccoon dogs, which were analyzed for zoonotic pathogens in our previous study [34]. Briefly, the samples were collected in a waterside area with reclaimed paddy fields in Seosan city in Chungcheongnam-do in Korea on May 21, 2017. The sampling area is close to an artificial freshwater lake named Ganwol-ho and surrounded by agricultural landscape. A total of 15 samples presumed to be raccoon dog feces were collected (S1 Fig and S1 Table in S1 File). Of them, 11 samples were confirmed to be those of raccoon dogs by the raccoon dog-specific PCR assay [35] performed in our previous study [34]. The remaining four samples were excluded from subsequent analysis. The samples were stored at −80°C until DNA extraction. The samples were collected in a public area. Therefore, it was not necessary to obtain permission to collect samples.

2.2. DNA extraction

DNA was extracted from collected fecal samples by a PowerMax® Soil DNA Isolation Kit (Mobio Laboratory, Inc., Carlsbad, CA, USA). Each fecal sample was preliminary homogenized in 5 ml of ultra-pure water using a sterile wooden spatula [27]. About 0.2 g of each homogenized sample was added into a 2 ml tube of the DNA isolation kit with additional 300 mg of 0.1 mm diameter glass beads and 100 mg of 0.5 mm diameter glass beads [36]. The samples were further homogenized by a bead beater (BioSpec Products, Inc., Bartlesville, OK, USA) for 3 min. After homogenization, DNA from each fecal sample was extracted and purified by the kit’s protocol and finally eluted into 50 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0). The eluted DNA was kept at −80°C until subsequent analysis.

2.3. Design of the blocking oligonucleotide RacBlk

To block unwanted amplification of the raccoon dog’s DNA by universal vertebrate primers targeting 12S rRNA gene [30], we designed a canid-specific blocking oligonucleotide called RacBlk according to the method of designing blocking oligonucleotides reported by Vestheim and Jarman [31]. RacBlk has a 3-carbon spacer at its 3’-end and is designed to bind to the raccoon dog’s 12S rRNA gene and block its amplification (Table 1). Specifically, RacBlk is comprised of 27 nucleotides and the first to sixth nucleotides of the RacBlk overlap with the 12SV5F, which is the forward primer for amplification of 12S rRNA gene. In addition, it was designed to avoid binding to the DNA of prey of raccoon dogs. However, since the target region of RacBlk is complementary to the sequences of other Canidae species such as Canis lupus familiaris (domestic dog) (Table 1), RacBlk also blocks amplification of their DNA. This was unavoidable due to the high sequence similarity of the target region of the 12S rRNA gene among species of Canidae. In Korea, four wild Canidae species have been documented: Nyctereutes procyonoides (raccoon dog), Vulpes vulpes (red fox), Cuon alpinus (dhole), and Canis lupus (Eurasian wolf) [3]. However, with the exception of the raccoon dog, these animals are highly endangered or perhaps extinct in South Korea [3]. Therefore, the chance of interaction between raccoon dogs and these canids is low. The interaction between raccoon dogs and domestic dogs may not be impossible, but due to size relationships and lifestyle differences, it is highly unlikely that raccoon dogs prey on domestic dogs.
Table 1

Sequence of the blocking oligonucleotide RacBlk.

The 12S rRNA gene sequences of raccoon dog (Nyctereutes procyonoides) and its related species and potential prey were aligned with RacBlk.

Accession numberSpecies (common name)Starting positionSequence (5′–3′) aEnd position
RacBlk b C T C T A G AGGGATATAAAGCACCGCCAA
KF709435.1Nyctereutes procyonoides koreensis (raccoon dog)617···························591
NC_002008.4Canis lupus familiaris (domestic dog)617···························591
NC_008434.1Vulpes vulpes (red fox)617···························591
NC_013445.1Cuon alpinus (dhole)617······C····················591
NC_012374.1Rattus rattus (black rat)619·······A··········A········593
NC_027932.1Micromys minutus (harvest mouse)614······CA··········A········588
NC_016428.1Apodemus agrarius (striped field mouse)616······CA··········A········590
NC_007236.1Gallus gallus gallus (chicken)1868······CA··C·A·CCC··········1842
NC_006291.1Carassius carassius (crucian carp)1543······C·····G·C·CT·····A··C1517
NC_015806.1Silurus asotus (Amur catfish)616······CA··C·G·C·CT·········590
KM590550.1Rana coreana (Korean brown frog)603······A···C·CCC·GT·GCAGTT·A577
KT878718.1Pelophylax nigromaculatus (dark-spotted frog)3009······CA··C·CCC·GT·GCAGTTCA2983

a The dots represent the complementary base types of the corresponding RacBlk bases.

b The 1st to 6th nucleotides (underlined) of RacBlk are designed to overlap the forward primer 12SV5F, which targets the 12S rRNA gene of vertebrates.

Sequence of the blocking oligonucleotide RacBlk.

The 12S rRNA gene sequences of raccoon dog (Nyctereutes procyonoides) and its related species and potential prey were aligned with RacBlk. a The dots represent the complementary base types of the corresponding RacBlk bases. b The 1st to 6th nucleotides (underlined) of RacBlk are designed to overlap the forward primer 12SV5F, which targets the 12S rRNA gene of vertebrates.

2.4. High-throughput DNA sequencing

For each sample, three libraries were constructed and meta-genetically analyzed. The three libraries are: (1) a library prepared with primers that target the vertebrate 12S rRNA gene with RacBlk, (2) a library prepared with primers that target the vertebrate 12S rRNA gene without RacBlk, and (3) a library prepared with primers that targets the invertebrate 16S rRNA gene. For vertebrates, 12S rRNA gene was amplified with primers 12SV5F and 12SV5R [30]. The vertebrate 12S rRNA libraries were constructed with and without the blocking oligonucleotide RacBlk. Technical duplicates were also prepared for six libraries constructed with RacBlk to test for reproducibility. For invertebrates, 16S rRNA gene was amplified with primers 16SMAV-F and 16SMAV-R [26]. Furthermore, MamMAVB1 was also included in PCR targeting the 16S rRNA gene for blocking amplification of mammal’s DNA [26]. DNA sequencing was performed on an Illumina MiSeq system (Illumina, Inc., San Diego, CA, USA). For vertebrate-specific PCR, 50 μl of each PCR reaction mixture consisted of 25 μl of Premix TaqTM (Takara Bio Inc., Otsu, Shiga, Japan), 0.1 μM of each of universal vertebrate primers attached to Illumina adapter sequences, 5 μM of RacBlk, 12 μl of molecular-graded water, and 1 μl of the DNA extract. PCR thermal condition was comprised of initial denaturation for 15 min at 95°C, followed by 45 cycles of 30 s at 95°C and 30 s at 60°C. There was no elongation step [29]. Four concentrations of RacBlk at 2, 3, 4, and 5 μM were pretested and PCR amplification of raccoon DNA was inhibited at all of these tested concentrations (S2 Fig in S1 File). To maximize the inhibition efficiency, 5 μM was chosen as a RacBlk concentration. For invertebrate-specific PCR, 50 μl of PCR reaction mixture consisted of 25 μl of Premix TaqTM (Takara Bio), 0.2 μM of each of universal invertebrate primers attached to Illumina adapter sequences, 2 μM of MamMAVB1, 12 μl of molecular-graded water, and 1 μl of the DNA extract. PCR thermal condition was comprised of initial denaturation for 15 min at 95°C, followed by 55 cycles of 30 s at 95°C and 30 s at 55°C. There was no elongation step [26]. The resulting PCR products were purified by AMPure XP beads (Beckman Coulter, Inc., Brea, CA, USA). Next, index PCR was performed with Nextera XT Index kit (Illumina) to tag DNA libraries. The thermal cycle of index PCR comprised of 3 min at 95°C, followed by 8 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C, and final extension for 5 min at 72°C. The tagged libraries were purified again with AMPure XP beads (Beckman Coulter). The tagged and purified libraries were quantified and normalized by Quant-iT PicoGreen dsDNA reagent kit (Life Technologies, Carlsbad, CA, USA). The normalized libraries were loaded with 30% PhiX to a v3 600 cycle-kit reagent cartridge (Illumina) for 2 × 300 bp paired-end sequencing on an Illumina MiSeq system.

2.5. Sequencing processing and analysis

The adapter and tagging sequences for MiSeq were trimmed and the reads with quality scores below 20 were removed by MiSeq Reporter version 2.5 (Illumina). Then, ambiguous bases were trimmed by Trimmomatic v 0.33 [37]. Next, OBITools [38] was used for finding unique sequences and taxonomic assignment. The illuminapairedend command of OBITools was used to concatenate the paired-end forward and reverse reads. The obiuniq command was executed to group and dereplicate the resultant reads. The cut-off for read length was set to 80 bp for the 12S rRNA gene reads and 20 bp for the 16S rRNA gene reads by the obigrep command. The erroneous reads were further excluded by the obiclean command. After quality control of sequencing reads, the resultant sequencing reads were taxonomically assigned by the ecotag command against the custom 12S and 16S rRNA gene reference databases. Specifically, the taxonomic annotation was performed against 12S (vertebrate) and 16S (invertebrate) rRNA genes databases generated from the latest snapshot (updated on March 13, 2022) of EMBL nucleotide sequences (http://ftp.ebi.ac.uk/pub/databases/ena/sequence/snapshot_latest/std/).

2.6. Statistical analysis

The statistical analysis was performed to evaluate the blocking efficacy of RacBlk on R version 4.1.0 with the phyloseq package [39] and vegan package [40]. First, we compared the number of sequence reads identified as the family Canidae (to which the raccoon dog belong) with and without RacBlk for each sample. Second, we evaluated about unintended inhibition by RacBlk. The use of blocking oligonucleotide may inhibit amplification of DNA of prey animals, resulting in change in dietary proportion measured. Therefore, we evaluated the change in dietary proportion due to the use of RacBlk. Specifically, the differences in composition of unique sequences from prey animals were compared with and without RacBlk. To analyze the composition of prey animals, the reads that were identified as Canidae were excluded. The remaining reads were rarefied into 120 reads per library, which was the smallest number of sequence reads from prey animals (excluding reads from Canidae) found in the library prepared without RacBlk. Rarefaction was necessary because the number of sequence reads from prey animals (excluding reads from Canidae) was much smaller in libraries prepared without RacBlk than those with RacBlk, and the comparison had to be done under the same condition, i.e., the same number of sequences. Note that rarefaction was performed only for the purpose to compare the sequencing results with and without RacBlk. No rarefaction was performed in other analyses. Based on the rarefied libraries, the difference in composition of unique sequences from prey animals were analyzed. The differences were characterized based on the Bray–Curtis dissimilarity (community structure) and Jaccard index (community membership). To compare the difference in composition of unique sequences from prey animals detected with and without RacBlk, the adonis2 function in vegan package was used for performing permutational multivariate analysis of variance (PERMANOVA). The intra-sample and inter-sample variances of composition of unique sequences from prey animals were compared based on the beta dispersion calculated by the betadisper function in vegan package. The intra-sample variance was defined as the variance of the composition measured with and without RacBlk for the same sample, while the inter-sample variance was defined as the variance of composition between samples measured with (or without) RacBlk. Kruskal-Wallis rank sum tests and post hoc Wilcoxon rank-sum tests were used to compare the differences between the intra- and inter-sample variances.

3. Results

3.1. Sequencing statistics

From a total of 11 raccoon dog’s fecal samples, 11 pairs of vertebrate libraries with and without RacBlk were obtained. Additionally, six vertebrate libraries prepared with RacBlk were technically duplicated. For invertebrates, one sample was not PCR amplified, resulting in a total of 10 libraries (S2 Table in S1 File). From 38 libraries including duplicates, a total of 4,676,053 high-quality sequence reads were obtained, consisting of 1,367,071 reads of vertebrates without RacBlk, 2,513,355 reads of vertebrates with RacBlk, and 795,627 reads of invertebrates.

3.2. Performance of the blocking oligonucleotide RacBlk

Fig 1A shows relative abundance of vertebrates identified at the family level. Without RacBlk, the median relative abundance of Canidae was 99.0%, ranging from 51.6% to 99.9%, suggesting that most of the sequence reads were of DNA from the host animal (i.e., raccoon dog). With RacBlk, the median relative abundance of Canidae read was 55.8%, ranging from 5.3% to 72.9%, indicating that RacBlk inhibited amplification of DNA of the host animal. The reduction was statistically significant (p < 0.001; Wilcoxon rank-sum tests; Fig 1B). It was also confirmed that there was no significant difference in the community structure of prey animals detected with and without RacBlk (p > 0.05; PERMANOVA; Fig 1C), and that the variance of the prey structure measured with and without RacBlk for the same sample (intra-sample variance) was significantly smaller than the variance of the structure between samples measured with (or without) RacBlk (inter-sample variance) (p < 0.0001; Wilcoxon rank-sum test; Fig 1D). The similar results were obtained for the community membership (Fig 1E and 1F). These suggest that the addition of RacBlk did not significantly change the composition of the detected prey animals. In addition, we compared the relative abundance of specific prey genera measured with and without RacBlk (Fig 1G). The differences measured with and without RacBlk were within an order of magnitude for all genera (Fig 1H). The result of reproducibility of sequencing with RacBlk based on technical duplicates is shown in S3 Fig in S1 File. The result shows high reproducibility of sequencing since the intra-sample variability was significantly smaller than the inter-sample variability.
Fig 1

Performance of blocking oligonucleotide RacBlk.

The 12S rRNA gene libraries prepared with the universal vertebrate primer pair 12SV5 are compared with and without RacBlk. (A) Relative abundance of vertebrates identified at the family level. (B) Relative abundance of Canidae to which the raccoon dog belongs. (C) Non-metric multidimensional scaling (NMDS) plot showing the Bray–Curtis dissimilarity of community structure of prey animals with and without RacBlk. (D) Boxplot showing the intra- and inter-sample variances of the Bray–Curtis dissimilarity of prey composition. (E) NMDS plot showing the Jaccard index of community membership of prey animals with and without RacBlk. (F) Boxplot showing the intra- and inter-sample variances of the Jaccard index of prey membership. (G) Mean relative abundances of the top 10 vertebrate genera detected with and without RacBlk. The reads identified as sequences of Canidae were excluded from the calculation of relative abundance. (H) Ratio of mean relative abundances measured with and without RacBlk. In the panels (C) and (E), the data from the same sample were connected by a line. In the panels (D) and (F), the four asterisks (****) represent p < 0.0001 by the post hoc Wilcoxon rank-sum test. The abbreviation “n.s.” represents that there is no significant difference.

Performance of blocking oligonucleotide RacBlk.

The 12S rRNA gene libraries prepared with the universal vertebrate primer pair 12SV5 are compared with and without RacBlk. (A) Relative abundance of vertebrates identified at the family level. (B) Relative abundance of Canidae to which the raccoon dog belongs. (C) Non-metric multidimensional scaling (NMDS) plot showing the Bray–Curtis dissimilarity of community structure of prey animals with and without RacBlk. (D) Boxplot showing the intra- and inter-sample variances of the Bray–Curtis dissimilarity of prey composition. (E) NMDS plot showing the Jaccard index of community membership of prey animals with and without RacBlk. (F) Boxplot showing the intra- and inter-sample variances of the Jaccard index of prey membership. (G) Mean relative abundances of the top 10 vertebrate genera detected with and without RacBlk. The reads identified as sequences of Canidae were excluded from the calculation of relative abundance. (H) Ratio of mean relative abundances measured with and without RacBlk. In the panels (C) and (E), the data from the same sample were connected by a line. In the panels (D) and (F), the four asterisks (****) represent p < 0.0001 by the post hoc Wilcoxon rank-sum test. The abbreviation “n.s.” represents that there is no significant difference.

3.3. Vertebrate composition

Fig 2A shows mean relative abundance of vertebrates at the family level as measured by 12S rRNA gene sequencing. The majority of vertebrate diets that were eaten by raccoon dogs in our sampling site was found to be freshwater fishes, with the families such as Cyprinidae (carp or minnows) (50.2%), Cobitidae (true loaches) (17.0%), and Siluridae (catfishes) (13.0%). Additionally, the families Ranidae (true frogs) (5.5%), Suidae (pigs or boars) (9.0%), and Muridae (rodents) (1.2%) were identified. Although most of the sequence reads identified as Cyprinidae and Cobitidae were ambiguous at the genus level, Spinibarbus (cyprinid fishes), Misgurnus (true loaches), and Paramisgurnus (large-scale loaches) were identified (Fig 2B). Additionally, Silurus (catfishes) and Micropterus (black bass) were identified from other fish families. Most of the sequence reads of Ranidae were classified into Pelophylax (green frogs) or Lithobates (true frogs). The mammalian genera such as Sus (domestic pig or wild boar) and Micromys (harvest mouse) were also identified.
Fig 2

Dietary composition of raccoon dogs.

(A) Mean relative abundance of vertebrates at the family level as measured by 12S rRNA gene sequencing. The data obtained using the blocking oligonucleotide RacBlk are shown. The sequence reads identified as the family Canidae were excluded from the calculation for relative abundance. (B) Relative abundance of the 10 most abundant vertebrate genera detected by 12S rRNA gene sequencing with RacBlk. The unidentified reads at the genus level and genera belong to the family Canidae were excluded from the calculation for relative abundance. (C) Mean relative abundance of invertebrates at the family level as measured by 16S rRNA gene sequencing. The sequence reads assigned to non-targeted organisms such as bacteria and vertebrates were excluded from the calculation for relative abundance. (D) Relative abundance of the 10 most abundant invertebrate genera detected by 16S rRNA gene sequencing. The unidentified reads at the genus level and reads assigned to non-targeted organisms such as bacteria and vertebrates were excluded from the calculation for relative abundance. The abbreviation “n.a.” represents the ambiguous reads were not classified into specific family. The detection of Spinibarbus and Eurycotis (with *) may be misidentification (see text for details).

Dietary composition of raccoon dogs.

(A) Mean relative abundance of vertebrates at the family level as measured by 12S rRNA gene sequencing. The data obtained using the blocking oligonucleotide RacBlk are shown. The sequence reads identified as the family Canidae were excluded from the calculation for relative abundance. (B) Relative abundance of the 10 most abundant vertebrate genera detected by 12S rRNA gene sequencing with RacBlk. The unidentified reads at the genus level and genera belong to the family Canidae were excluded from the calculation for relative abundance. (C) Mean relative abundance of invertebrates at the family level as measured by 16S rRNA gene sequencing. The sequence reads assigned to non-targeted organisms such as bacteria and vertebrates were excluded from the calculation for relative abundance. (D) Relative abundance of the 10 most abundant invertebrate genera detected by 16S rRNA gene sequencing. The unidentified reads at the genus level and reads assigned to non-targeted organisms such as bacteria and vertebrates were excluded from the calculation for relative abundance. The abbreviation “n.a.” represents the ambiguous reads were not classified into specific family. The detection of Spinibarbus and Eurycotis (with *) may be misidentification (see text for details).

3.4. Invertebrate composition

Fig 2C shows mean relative abundance of invertebrates at the family level as measured by 16S rRNA gene sequencing. More than half of the sequence reads were identified at the family level. Some of the detected families were aquatic, such as Cyprididae (freshwater ostracods) (12.6%), Plumatellidae (freshwater bryozoans) (9.5%), and Moinidae (water fleas) (3.2%). Others included terrestrial organisms such as Drosophilidae (flies) (15.5%), Gryllotalpidae (mole crickets) (10.2%) and Tenebrionidae (darkling beetles) (5.1%). The sequence reads identified as Tenebrionidae and Plumatellidae were ambiguous at the genus level. However, the sequence reads identified as other families were identified down to the genus level (Fig 2D). For instance, aquatic genera such as Heterocypris (freshwater ostracods) and Moina (water fleas) were identified. The genera of insects such as Gryllotalpa (mole crickets), Orthetrum (dragonflies), Micronecta (water boatmen), Eurycotis (Florida woods cockroach), and Labidura (earwigs) were also identified. Drosophila (flies) was also abundantly detected in many samples.

4. Discussion

In this study, we used DNA metabarcoding of the invertebrate 16S rRNA gene and vertebrate 12S rRNA gene with the newly developed blocking oligonucleotide RacBlk to study dietary composition of raccoon dogs inhabiting a coastal area with paddy fields in Korea in late spring. We found that vertebrate diets of raccoon dogs mainly consisted of aquatic species such as freshwater fishes, frogs, and aquatic arthropods and fossorial and terrestrial insects in our study area. The results seem reasonable given the geographical characteristics of the study area. In addition, the results seem to be consistent with previous studies showing that raccoon dogs are generalists who eat a wide range of diets available in their habitat [11, 12, 15–17, 41].

4.1. Fishes are dominant prey for raccoon dogs inhabiting waterside areas

The organisms identified from fecal samples of raccoon dogs in this study were in congruence with the fauna reported in South Korea. For example, vertebrate 12S rRNA gene sequencing identified freshwater fishes, such as Silurus, Micropterus, Misgurnus, and Paramisgurnus, and frogs, such as Pelophylax and Lithobates, at the genus level (Fig 2B). Notably, fishes represented 80.2% of vertebrate DNA at the familly level if combining Cyprinidae (50.2%), Cobitidae (17.0%), and Siluridae (13.0%). In Korea, two species of Silurus, i.e., Silurus asotus (Amur catfish) and Silurus microdorsalis (slender catfish), are known to inhabit rivers and lakes [42-45]. Similarly, Misgurnus species, such as Misgurnus anguillicaudatus (pond loach) and Misgurnus mizolepis (mud loach), and Paramisgurnus species, such as Paramisgurnus dabryanus, a senior synonym of M. mizolepis, are common in Korea [46]. Additionally, Micropterus salmoides (largemouth bass) is known to be widely distributed in freshwater systems of South Korea [43, 45, 47]. Previous studies reported [11–16, 20] that fishes are regarded as one of important food sources for raccoon dogs especially in waterside areas (i.e., coast and/or lake areas) although these studies did not identify fish taxa due to morphological observations. Our result obtained in the coastal area in Korea is in line with the tendency reported by the existing studies conducted in other countries. Species of frogs such as Pelophylax nigromaculatus (dark-spotted frog) and Lithobates catesbeianus (= Rana catesbeiana) (American bullfrog) are also commonly observed in Korea [48, 49]. For instance, the dark-spotted frog inhabits freshwater such as ponds around rivers, lakes, swamps and rice paddies [50]. Studies in Finland [13, 14] and Germany [16] reported Rana spp. as prey for raccoon dogs. Moreover, it has been recently reported that raccoon dogs are hunting the American bullfrog [51]. Mammals such as Sus (wild boar) and Micromys (harvest mouse) were also detected by vertebrate 12S rRNA gene sequencing (Fig 2B). These mammalian species are known to inhabit South Korea [52-54]. For instance, the population of wild boar (Sus scrofa) is known to be rapidly increased from the 2010s even threatening urban livings in Korea [52, 53]. Although the raccoon dog is thought to be unable to directly hunt animals larger than themselves, such as wild boars and deer, they have been reported to consume their carcasses. [11, 15, 16]. The scavenging behavior of raccoon dogs is known to be especially noticeable in winter [11]. Meanwhile, this study was conducted in late spring. The smaller proportion of the family Suidae (9.0%) than those of fish families Cyprinidae (50.2%), Cobitidae (17.0%), and Siluridae (13.0%) (Fig 2A) may reflect this seasonal trend. The family Muridae represents 1.2% of vertebrate DNA (Fig 2A), and Micromys was identified at the genus level (Fig 2B). Some of murid species are reported as dietary items of raccoon dogs in Denmark [12] and Finland [13]. Invertebrate 16S rRNA gene sequencing identified Gryllotalpa as one of the most abundant invertebrate genera (Fig 2D). In Korea, Gryllotalpa orientalis (mole cricket) is known to inhabit [55]. The mole cricket is known to inhabit wetlands and paddy fields by burrowing [56], and was reported to be predated by raccoon dogs by morphological observation of fecal contents in a Japanese study [22]. Furthermore, Tenebrionidae that belong to the order Coleoptera (beetles) was identified at the family level (Fig 2C). In line with the result of previous studies, the order Coleoptera were reported as one of main prey for raccoon dogs [11, 15, 16, 22, 57] and inhabited in diverse environments [58, 59]. Tenebrionidae is regarded as one of diverse groups in the order Coleoptera. In Korea, 129 species of Coleoptera are known to inhabit [60-62]. We also identified Orthetrum, Micronecta, and Labidura (Fig 2D). Several species belonging to those genera were reported to inhabit Korea [63-65]; however, knowledge about whether raccoon dogs feed on them is limited. Additionally, 16S rRNA gene sequencing detected small-size invertebrates such as Heterocypris and Moina. Due to their small size, these organisms are unlikely to be directly preyed on by raccoon dogs. Perhaps it was due to secondary predation, and they are thought to be accidentally swallowed or attached to larger aquatic organisms that were preyed on by raccoon dogs. Overall, we found that the most dominant food for raccoon dogs is fishes at our sampling site located in the coastal area of Korea, representing 80.2% of vertebrate DNA. The family Ranidae was also abundant (5.5%) (Fig 2A). These results indicate that readily available freshwater fishes and frogs, rather than small mammals such as mice, are preferentially consumed by raccoon dogs in our study area and season. This seems to be in line with existing knowledge. For example, previous studies reported that raccoon dogs eat other animals, such as birds and amphibians, when small mammals are not readily available [13, 15]. Among the fishes detected, the family Cyprinidae was the most abundant and accounted for 50.2% of vertebrate DNA (Fig 2A), suggesting that they are main prey for raccoon dogs in our survey area. In Korea, Cyprinidae species, such as Cyprinus carpio (common carp) and Carassius auratus (crucian carp), abundantly exist [43-45]. We speculate that the detection of Spinibarbus at the genus level (Fig 2B) may be misidentification of Cyprinus and Carassius because Spinibarbus is known to inhabit East Asia [66] but has not been reported in South Korea. Indeed, the sequence of target region of Spinibarbus is identical or similar to the sequences of other Cyprinidae species (S4 Fig in S1 File), indicating the possibility of misidentification between species of Cyprinidae. Similarly, we identified Eurycotis by invertebrate 16S rRNA gene sequencing (Fig 2D). However, there have been no reports that Eurycotis inhabit Korea. Therefore, we surmise that sequence similarity caused a misidentification between Eurycotis and the indigenous cockroach Periplaneta (S5 Fig in S1 File).

4.2. Blocking oligonucleotide RacBlk reduces PCR amplification of the raccoon dog’s DNA

In wildlife dietary surveys using PCR, not only preys’ DNA but also the predator’s DNA can be possibly amplified, which is problematic because it can reduce the detection sensitivity of the preys’ DNA. To alleviate this problem, the idea of using the blocking oligonucleotide, which selectively inhibits PCR amplification of a predator’s DNA, was invented [31]. Blocking oligonucleotides have been widely used in dietary studies of wildlife such as the leopard cat [29], Eurasian otter [27], Antarctic krill [31], brown bear [26], penguin [67], and seal [68]. In this study, we designed the blocking oligonucleotide RacBlk for the raccoon dog. RacBlk has successfully reduced the amplification of the canid DNA in PCR that targeted the vertebrate 12S rRNA gene (Fig 1A and 1B). Furthermore, we could confirm that there was no significant change in dietary composition with and without RacBlk (Fig 1C and 1E), indicating that unintended inhibition of the amplification of preys’ DNA was insignificant. The blocking oligonucleotide RacBlk significantly reduced PCR amplification of DNA of Canidae, but the inhibition was not complete. In fact, 5.3%–72.9% sequence reads were those of Canidae even with RacBlk (Fig 1A and 1B). The reduction seems to be lower than the reduction with blocking oligonucleotides reported by previous studies. For example, blocking oligonucleotides for the leopard cat and Eurasian otter developed by previous studies reported reducing the predators’ DNA down to 0% and 0.21%, respectively [27, 29]. The lower reduction efficiency may be due to the shorter length of RacBlk (27 nt) than other blocking oligonucleotides (40–50 nt). In fact, the fact that longer blocking oligonucleotides are associated with higher blocking efficiencies has been reported by previous studies [69, 70]. We do not know the mechanism behind, but one possible explanation is that a short-length blocking oligonucleotide allows annealing and extension of the universal primer to the target region of the blocking oligonucleotide before the blocking oligonucleotide is annealed to it, resulting in amplification of the target organism (which should be blocked) by the universal primers. The short length of RacBlk was unavoidable due to the limited 12S rRNA gene site with sequence specific to the raccoon dog. In addition, due to the limited targeting site, the selection of the region whose sequence is identical or similar to those of other species of Canidae was unavoidable (Table 1). However, we don’t expect this to be a problem. As mentioned above, three other species of Canidae have been reported in Korea, i.e., Vulpes vulpes, Cuon alpinus, and Canis lupus (Eurasian wolf) [3]. However, it is highly unlikely that they inhabit the study area because they are highly endangered or extinct in South Korea [3]. We also anticipate that the interaction between raccoon dogs and domestic dogs (Canis lupus familiaris) is unlikely because of difference in lifestyle. However, it may not be impossible. Future research needs to elucidate their relationships.

4.3. Limitations of DNA metabarcoding in dietary surveys for omnivore animals

DNA barcoding is a useful tool for wildlife dietary research. However, it is not without problems, as pointed out elsewhere (e.g., [27, 71]). We recognize that this study also has such limitations. In particular, we would like to acknowledge that there is ongoing argument over whether DNA-based methods can accurately quantify the proportion of dietary content [72-74]. This study reported relative abundance rather than detected or undetected since the information of relative abundance also includes the information of detected or undetected and may provide some insights such as detection specificity and sensitivity (or insensitivity) of the sequencing method used. In addition, there may be limitations specific to dietary analysis of omnivorous animals such as raccoon dogs. First, the raccoon dog is an omnivorous carnivore that also eats plants [11, 12, 15–17, 41]. However, this study focused on the animal diets and does not report the plant diets. In our preliminary analysis, large amounts of Pinaceae DNA (~80% of total reads) was detected in fecal samples (S6 Fig in S1 File). We suspect that the detection of Pinaceae plants is due to the contamination by pollen since it is known that massive amounts of pine pollen are dispersed in spring in Korea [75]. Similarly, the detection of large amount of Drosophila might be due to their infestation on feces after defecation. Further validation is required for these issues of post-defecation contamination. Second, DNA metabarcoding does not allow inter-phylum comparison of abundance of vertebrates and invertebrates. Similarly, it does not allow inter-kingdom comparison of abundance of animals and plants. The comparison has to be limited to within the phylum or kingdom. For the comparison on the same scale between phyla or between kingdoms, methods such as metagenomic sequencing are required. Lastly, there may be the lack of taxonomic resolution of the selected DNA marker, primer pair, and/or reference database depending on the detected organisms. In our study, large amounts of fishes belonging to Cyprinidae and Cobitidae were detected (Fig 2A); however, many of them were ambiguous at the genus level. In this study, we used the primer pair 12SV5F and 12SV5R targeting 12S rRNA gene of vertebrates, which is widely used to identify common vertebrate species [30, 76]. For omnivorous opportunists such as the raccoon dog, it is difficult to predict the type of foods in advance, making it difficult to preselect the most appropriate sequencing strategy (e.g., target gene and primer pair). One way to alleviate this problem is to target multiple DNA markers and/or use multiple primer pairs for a single group of organisms. However, this should be decided according to the taxonomic resolution required and the sequencing resources available.

5. Conclusion

Using DNA metabarcoding and a canid-specific blocking oligonucleotide developed in this study, we identified that the main foods of raccoon dogs inhabiting the waterside of paddy fields in Korea were fishes such as Cyprinidae and insects such as mole crickets. The results seem reasonable in light of the Korean fauna and their well-known opportunistic feeding behaviors. The raccoon dog, which is relatively abundant in Korea, is known not only to play a role in the ecosystem, but also to be a reservoir of zoonotic pathogens [77]. Therefore, understanding their ecology is essential not only for conservation biology but also for public health. Understanding their feeding habits helps to understand their ecology. As a method to investigate their feeding habits, this study presented the baseline information on DNA metabarcoding, which does not require specialized knowledge such as osteology. By using convenient and objective DNA barcoding, the dietary habits and ecology of raccoon dogs are expected to be better understood by future research.

Supporting information.

(PDF) Click here for additional data file. 7 Apr 2022
PONE-D-22-06464
Using DNA metabarcoding to investigate the composition of animal diets of raccoon dogs (Nyctereutes procyonoides) inhabiting the waterside area in Korea
PLOS ONE Dear Dr. Yamamoto, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by May 22 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Bi-Song Yue, Ph.D Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: [This work was supported by the General Researcher Program of the National Research Foundation of Korea (2021R1F1A1060259) (NY).] We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [This work was supported by the General Researcher Program of the National Research Foundation of Korea (2021R1F1A1060259) (NY) (https://www.nrf.re.kr/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.] Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright. We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission: a) You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license. We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text: “I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.” Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission. In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].” b) If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only. The following resources for replacing copyrighted map figures may be helpful: USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/ The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/ Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/ Landsat: http://landsat.visibleearth.nasa.gov/ USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/# Natural Earth (public domain): http://www.naturalearthdata.com/ 4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript provides data on the dietary habits of raccoon dogs in Korea using HTS-based DNA metabarcoding. Additionaly presents interesting data with and without using newly developed blocking oligonucleotide RacBlk to block unnwanted amplification of the raccoon dog's DNA. The autors presented material and methods as wellas results in a clear and very precised way. The section Statistical analysis explains what statistical test has been used and why, additionaly authors prerformed PERMANOVA,Ktuskal-wallis rank sum test and post hoc Wilcoxon rank sum test . Authors also provided raw sequencing data -available in NCBI under the project number. The manuscript is written in standard english, no additional corrections are needed. Summarizng, the manuscript provides valiuable information on racoon dog's died by using advanced molecular tehniques, and thus more reliable than morphological and osteological expertise. Inventing RacBlock blocking oligonucleotide for 12S rRNA gene significantly increased the value of the paper. Comment for the authors: Once the latin names have been given in the Results section there is no need to repaeat them in the discussion, there are somme repetitions eg.line 266: Suidae (pigs or boars) is repeated in line 348, in this case the bracket should be dropped. Reviewer #2: This paper investigates the diet of the raccoon dog using only a very limited number of samples, but the authors have successfully generated a blocking primer which is another achievement of this work. Perhaps the title could be modified so this is more explicit. Line 125- Please state clearly if these other canids coexist with raccoon dogs at sampled localities. This is mentioned in discussion but I think it is important for readers have this clarified earlier in the text Line 144-146: this information is repeated and more complete in following sections Line 150- How was the concentration of blocking primer optimized? PCR conditions are incomplete (extension?). Did the blocking primer anneal at the same temperature as the 12S universal primers? What are the sizes of the 12S and 16S libraries? Line 156- again, PCR conditions look incomplete. Line 168- Please state whether PhiX was used in the run Line 176- I am not that familiar with this software but it seems minimum size of sequences considered was 80 bp for 12 S and 20 bp for 16S. I can imagine taxonomic results could be meaningful with 80 bp for 12S, but 20 bp for 16S looks impossible to me. I am also concerned about overestimation of OTUs as perhaps every unique 20bp sequence was considered as an OTU even if these 20 bp were included in larger sequences? How does the obiuniq command deal with size? Line 183- I understand these data have some years now, but I think the authors should have used the currently available data at EMBL Line 189- I think the comparison of libraries constructed with or without blocking primer should use data at OTU level. Otherwise important taxa or taxa of interest in future studies could be excluded and no results regarding this are reported (not available in supplementary materials). The fact that taxonomic assignment was achieved for most OUT at family level does not preclude analysis at genus and OTU level. Without this the Discussion section could be misleading as the authors clearly state: “indicating the absence of unintended inhibition of the amplification of preys’ DNA. “. I don’t understand how this was tested if analysis were performed at family level. Also why did you rarify these data? Was it to eliminate rare prey? I think metabarcoding data applied to diets, even using universal primers, implies data needs to be treated as presence/absence rather than abundance. There is a lot that cannot be controlled in a PCR reaction, namely different levels of primer affinity to each prey DNA, different digestibility of prey which can also bias DNA “quantity” etc Line 200- Differences between libraries were evaluated using BC distance. However this accounts for abundance and what I have mentioned before I don’t think this metric should be used as it likely results in spurious results. Unless the nº of OTUs from a particular family is used as an abundance metric? There are other distances that could be applied to presence absence data (Jaccard for example). Line239- These are the kind of biases you would expect and that is why in my view, using abundance data in this kind of analysis is not correct Line 406- this sentence erroneously leads the reader to think these blocking primers only block racoon dog DNA. I think this should be re-phrased Line 413- I am very interested by this idea. Can you explain further why sequence length of blocking primer should affect the level of DNA blocked? If the primer was longer it may be more specific but I do not comprehend why there should be an implication with the amount of DNA blocked. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 3 Jun 2022 Please find our responses to the reviewers’ comments below. The parts changed are marked in the revised manuscript, and the line numbers in our responses refer to the revised manuscript with track changes. Editor: 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf RESPONSE: Thank you for your reminders. We believe the manuscript complies with PLOS ONE's style requirements. 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: [This work was supported by the General Researcher Program of the National Research Foundation of Korea (2021R1F1A1060259) (NY).] We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [This work was supported by the General Researcher Program of the National Research Foundation of Korea (2021R1F1A1060259) (NY) (https://www.nrf.re.kr/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.] Please include your amended statements within your cover letter; we will change the online submission form on your behalf. RESPONSE: The acknowledgements section was excluded. 3. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright. We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission: RESPONSE: The original Fig 1 including the map was removed. 4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. RESPONSE: The information was added (Lines 702-703). Reviewer #1: 1. The manuscript provides data on the dietary habits of raccoon dogs in Korea using HTS-based DNA metabarcoding. Additionaly presents interesting data with and without using newly developed blocking oligonucleotide RacBlk to block unnwanted amplification of the raccoon dog's DNA. The autors presented material and methods as wellas results in a clear and very precised way. The section Statistical analysis explains what statistical test has been used and why, additionaly authors prerformed PERMANOVA, Ktuskal-wallis rank sum test and post hoc Wilcoxon rank sum test . Authors also provided raw sequencing data -available in NCBI under the project number. The manuscript is written in standard english, no additional corrections are needed. Summarizng, the manuscript provides valiuable information on racoon dog's died by using advanced molecular tehniques, and thus more reliable than morphological and osteological expertise. Inventing RacBlock blocking oligonucleotide for 12S rRNA gene significantly increased the value of the paper. RESPONSE: We appreciate the positive appraisal by the reviewer #1. 2. Once the Latin names have been given in the Results section there is no need to repeat them in the discussion, there are some repetitions e.g. line 266: Suidae (pigs or boars) is repeated in line 348, in this case the bracket should be dropped. RESPONSE: We fixed them according to the advice. Reviewer #2: 1. This paper investigates the diet of the raccoon dog using only a very limited number of samples, but the authors have successfully generated a blocking primer which is another achievement of this work. Perhaps the title could be modified so this is more explicit. RESPONSE: We agree. The title was changed as follows: “Using DNA metabarcoding and a novel canid-specific blocking oligonucleotide to investigate the composition of animal diets of raccoon dogs (Nyctereutes procyonoides) inhabiting the waterside area in Korea” 2. Line 125- Please state clearly if these other canids coexist with raccoon dogs at sampled localities. This is mentioned in discussion but I think it is important for readers have this clarified earlier in the text RESPONSE: To make it clearer that there is no possibility of the interference, we have removed ambiguous words such as "believe" and "thought" from the revised manuscript. 3. Line 144-146: this information is repeated and more complete in following sections RESPONSE: The manuscript was revised to repeat the information in the following paragraphs. 4. Line 150- How was the concentration of blocking primer optimized? PCR conditions are incomplete (extension?). Did the blocking primer anneal at the same temperature as the 12S universal primers? What are the sizes of the 12S and 16S libraries? RESPONSE: We followed the thermal condition reported by Shehzad et al. (2012). The elongation step was not included in their study (Lines 152-153). According to the Tm Calculator of Thermo Fisher Scientific (https://www.thermofisher.com/kr/ko/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html), Tm of 12SV5F and 12SV5R are 51.3℃ and 49.3℃, respectively. Tm of our blocking primer is calculated to be 63.7℃. The difference in Tm seems large. However, we believe it is not unusual according to previous research reports. For instance, using the same primer pair 12SV5F/12SV5R, Shehzad et al. (2012) and Kumari et al. (2019) successfully designed blocking oligonucleotides PrioB and OBS1, respectively, whose Tm are 60.9℃ and 65.4℃, respectively. We can see that their temperatures are similar to ours. In general, blocking oligonucleotides are designed to anneal before primers anneal. Therefore, it is reasonable that the annealing temperature of the blocking oligonucleotide is higher than the annealing temperatures of the primers. The average size of targeted regions (excluding primer and adapter regions) of vertebrate 12S rRNA gene and invertebrate 16S rRNA gene are about 100 and 36 bp, respectively. The size of amplicons are larger since they also contain primer and adapter sequences (i.e., around 200 bp for 12S rRNA gene). Confirmation of inhibition of PCR amplification by the blocking oligonucleotide RacBlk was performed using a DNA extract from a carcass specimen of raccoon dog. The tested concentrations of RacBlk were 2, 3, 4, and 5 µM (see S2 Fig). We found that all concentrations of RacBlk tested successfully inhibited PCR amplification of raccoon dog DNA. To maximize the inhibitory efficiency, we chose 5 µM as the concentration of RacBlk. 5. Line 156- again, PCR conditions look incomplete. RESPONSE: We followed the thermal condition reported by De Barba et al. (2014). The elongation step was not included (Line 161). 6. Line 168- Please state whether PhiX was used in the run RESPONSE: Yes, 30% PhiX was also added (Line 169). 7. Line 176- I am not that familiar with this software but it seems minimum size of sequences considered was 80 bp for 12 S and 20 bp for 16S. I can imagine taxonomic results could be meaningful with 80 bp for 12S, but 20 bp for 16S looks impossible to me. I am also concerned about overestimation of OTUs as perhaps every unique 20bp sequence was considered as an OTU even if these 20 bp were included in larger sequences? How does the obiuniq command deal with size? RESPONSE: We agree that short sequence reads can result in ambiguous identification, and we expect that the relatively high percentage of ambiguous reads for invertebrate 16S at the family level shown in Fig 2C is due to the short barcode region (36 bp, excluding primer and adapter regions). Meanwhile, we believe that the selection of 20 bp as a cut-off length is reasonable since the barcode region that was analyzed (excluding primer and adapter regions) is 36 bp (i.e., 16 bp as buffer length). The method to identify invertebrates by targeting the short barcode region of 16S rRNA gene (36 bp) was established by De Barba et al. (2014), and we followed their method. Using their method, we successfully identified invertebrates that are known to inhabit our sampling area (Fig. 2D). There may be an issue of overestimation of OTUs; however, this study limited the analysis to taxonomic identification only, and we did not perform species richness analysis. 8. Line 183- I understand these data have some years now, but I think the authors should have used the currently available data at EMBL RESPONSE: As suggested by the reviewers, we created the latest versions of the databases and reanalyzed. All results in the revised manuscript are the reanalysis results based on the latest versions of the databases. “Specifically, the taxonomic annotation was performed against 12S (vertebrate) and 16S (invertebrate) rRNA genes databases generated from the latest snapshot (updated on March 13, 2022) of EMBL nucleotide sequences (http://ftp.ebi.ac.uk/pub/databases/ena/sequence/snapshot_latest/std/).” Lines 184-187 In addition, the discussion on genera detected with new database was added (Lines 350-351, 358-359, 363-364, and 477-479), and the discussion on genera that were not detected with new database was removed. 9. Line 189- I think the comparison of libraries constructed with or without blocking primer should use data at OTU level. Otherwise important taxa or taxa of interest in future studies could be excluded and no results regarding this are reported (not available in supplementary materials). The fact that taxonomic assignment was achieved for most OUT at family level does not preclude analysis at genus and OTU level. Without this the Discussion section could be misleading as the authors clearly state: “indicating the absence of unintended inhibition of the amplification of preys’ DNA. “. I don’t understand how this was tested if analysis were performed at family level. Also why did you rarify these data? Was it to eliminate rare prey? I think metabarcoding data applied to diets, even using universal primers, implies data needs to be treated as presence/absence rather than abundance. There is a lot that cannot be controlled in a PCR reaction, namely different levels of primer affinity to each prey DNA, different digestibility of prey which can also bias DNA “quantity” etc. RESPONSE: We agree with the reviewer that OTU-level (rather than family-level) analysis is more relevant. We re-analyzed the results based on the number and composition of unique sequences (equivalent of OTUs) (Fig. 1). We confirmed that our conclusion was unchanged. There was no significant omission of unique sequences by RacBlk. Rarefaction was performed only for the purpose to compare the sequencing results with and without RacBlk. No rarefaction was performed in other analyses, which was clarified in our revised manuscript (Lines 204-212). Meanwhile, rarefaction was necessary to compare the results with and without RacBlk. It was necessary because the number of sequences from prey animals (excluding sequences from raccoon dogs) was much smaller in libraries prepared without RacBlk than those with RacBlk. Since the difference in the number of sequences affects the comparison between the libraries, it was necessary to make the number of sequences the same across libraries by rarefaction. We rarefied all libraries to 120 reads, which was the smallest number of sequence reads of prey animals (excluding reads of raccoon dogs) found in the library prepared without RacBlk. Again, rarefaction was necessary since the comparison had to be done under the same condition (i.e., the same sequence depth or number of sequences). We are aware of the argument of how to interpret sequence results. This issue was explicitly stated in the revised manuscript (Lines 466-471). Meanwhile, we wish to keep reporting sequencing results based on relative abundance as they also contain the information of detected or undetected. It is not possible to convert binary data to continuous data, but it is possible to convert continuous data to binary data. The information of relative abundance may provide some insights such as detection specificity and sensitivity (or insensitivity) by the sequencing method used. We would like to delegate to the readers how to interpret the results. Again, the issue of how to report sequence results (binary vs. continuous) was explicitly mentioned in the revised manuscript, however (Lines 466-471). “In particular, we would like to acknowledge that there is ongoing argument over whether DNA-based methods can accurately quantify the proportion of dietary content. This study reported relative abundance rather than detected or undetected since the information of relative abundance also includes the information of detected or undetected and may provide some insights such as detection specificity and sensitivity (or insensitivity) of the sequencing method used.” Lines 466-471 10. Line 200- Differences between libraries were evaluated using BC distance. However this accounts for abundance and what I have mentioned before I don’t think this metric should be used as it likely results in spurious results. Unless the nº of OTUs from a particular family is used as an abundance metric? There are other distances that could be applied to presence absence data (Jaccard for example). RESPONSE: We added the result based on Jaccard index, too. For the above reasons, we would also like to continue to include results based on Bray-Curtis dissimilarity, too. 11. Line239- These are the kind of biases you would expect and that is why in my view, using abundance data in this kind of analysis is not correct RESPONSE: As mentioned above, the issue of how to report sequence results (binary vs. continuous) was explicitly mentioned in the revised manuscript (Lines 466-471). 12. Line 406- this sentence erroneously leads the reader to think these blocking primers only block raccoon dog DNA. I think this should be re-phrased RESPONSE: The sentence was rephrased to tone down as follows: “Furthermore, we could confirm that there was no significant change in dietary composition with and without RacBlk (Figs 1C and 1E), indicating that unintended inhibition of the amplification of preys’ DNA was insignificant.” 13. Line 413- I am very interested by this idea. Can you explain further why sequence length of blocking primer should affect the level of DNA blocked? If the primer was longer it may be more specific but I do not comprehend why there should be an implication with the amount of DNA blocked. RESPONSE: The fact that longer blocking oligonucleotides are associated with higher blocking efficiencies has also been reported by previous studies (Boessenkool et al., 2012; Homma et al., 2022). However, we do not know the mechanism behind it. One possible explanation is that a short-length blocking oligonucleotide allows annealing and extension of the universal primer to the target region of the blocking oligonucleotide before the blocking oligonucleotide is annealed to it, resulting in amplification of the target organism (which should be blocked) by the universal primers. As a possible hypothesis, the following sentence was added. “In fact, the fact that longer blocking oligonucleotides are associated with higher blocking efficiencies has been reported by previous studies [69, 70]. We do not know the mechanism behind, but one possible explanation is that a short-length blocking oligonucleotide allows annealing and extension of the universal primer to the target region of the blocking oligonucleotide before the blocking oligonucleotide is annealed to it, resulting in amplification of the target organism (which should be blocked) by the universal primers.” Lines 445-450 References Boessenkool, S., et al. (2012). Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA. Mol. Ecol., 21(8), 1806–1815. De Barba, M., et al. (2014). DNA metabarcoding multiplexing and validation of data accuracy for diet assessment: application to omnivorous diet. Mol. Ecol. Resour., 14(2), 306–323. Homma, C., et al. (2022). Effectiveness of blocking primers and a peptide nucleic acid (PNA) clamp for 18S metabarcoding dietary analysis of herbivorous fish. PLOS ONE, 17(4), e0266268. Kumari, P., et al. (2019). DNA metabarcoding-based diet survey for the Eurasian otter (Lutra lutra): Development of a Eurasian otter-specific blocking oligonucleotide for 12S rRNA gene sequencing for vertebrates. PLOS ONE, 14(12), e0226253. Shehzad, W., et al. (2012). Carnivore diet analysis based on next-generation sequencing: Application to the leopard cat (Prionailurus bengalensis) in Pakistan. Mol. Ecol., 21(8), 1951–1965. Submitted filename: Response_to_Reviewers.docx Click here for additional data file. 24 Jun 2022 Using DNA metabarcoding and a novel canid-specific blocking oligonucleotide to investigate the composition of animal diets of raccoon dogs (Nyctereutes procyonoides) inhabiting the waterside area in Korea PONE-D-22-06464R1 Dear Dr. Yamamoto, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Bi-Song Yue, Ph.D Academic Editor PLOS ONE 28 Jun 2022 PONE-D-22-06464R1 Using DNA metabarcoding and a novel canid-specific blocking oligonucleotide to investigate the composition of animal diets of raccoon dogs (Nyctereutes procyonoides) inhabiting the waterside area in Korea Dear Dr. Yamamoto: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Bi-Song Yue Academic Editor PLOS ONE
  34 in total

Review 1.  Mammals of Korea: a review of their taxonomy, distribution and conservation status.

Authors:  Yeong-Seok Jo; John T Baccus; John L Koprowski
Journal:  Zootaxa       Date:  2018-11-18       Impact factor: 1.091

2.  Proportion of prey consumed can be determined from faecal DNA using real-time PCR.

Authors:  Ella Bowles; Patricia M Schulte; Dominic J Tollit; Bruce E Deagle; Andrew W Trites
Journal:  Mol Ecol Resour       Date:  2011-01-18       Impact factor: 7.090

3.  Accuracy, precision, and method detection limits of quantitative PCR for airborne bacteria and fungi.

Authors:  Denina Hospodsky; Naomichi Yamamoto; Jordan Peccia
Journal:  Appl Environ Microbiol       Date:  2010-09-03       Impact factor: 4.792

4.  Application of blocking oligonucleotides to improve signal-to-noise ratio in a PCR.

Authors:  Hege Vestheim; Bruce E Deagle; Simon N Jarman
Journal:  Methods Mol Biol       Date:  2011

5.  Population genetic study of the raccoon dog (Nyctereutes procyonoides) in South Korea using newly developed 12 microsatellite markers.

Authors:  Yoonjee Hong; Kyung-Seok Kim; Hang Lee; Mi-Sook Min
Journal:  Genes Genet Syst       Date:  2013       Impact factor: 1.517

6.  Analysis of Australian fur seal diet by pyrosequencing prey DNA in faeces.

Authors:  Bruce E Deagle; Roger Kirkwood; Simon N Jarman
Journal:  Mol Ecol       Date:  2009-03-20       Impact factor: 6.185

7.  What you need is what you eat? Prey selection by the bat Myotis daubentonii.

Authors:  Eero J Vesterinen; Lasse Ruokolainen; Niklas Wahlberg; Carlos Peña; Tomas Roslin; Veronika N Laine; Ville Vasko; Ilari E Sääksjärvi; Kai Norrdahl; Thomas M Lilley
Journal:  Mol Ecol       Date:  2016-03-14       Impact factor: 6.185

8.  Invasion of the raccoon dog Nyctereutes procyonoides in Europe: History of colonization, features behind its success, and threats to native fauna.

Authors:  Kaarina Kauhala; Rafal Kowalczyk
Journal:  Curr Zool       Date:  2011-10-01       Impact factor: 2.624

9.  Population structure of the raccoon dog (Nyctereutes procyonoides) using microsatellite loci analysis in South Korea: Implications for disease management.

Authors:  Yoon Jee Hong; Kyung Seok Kim; Mi-Sook Min; Hang Lee
Journal:  J Vet Med Sci       Date:  2018-09-05       Impact factor: 1.267

10.  DNA metabarcoding-based diet survey for the Eurasian otter (Lutra lutra): Development of a Eurasian otter-specific blocking oligonucleotide for 12S rRNA gene sequencing for vertebrates.

Authors:  Priyanka Kumari; Ke Dong; Kyung Yeon Eo; Woo-Shin Lee; Junpei Kimura; Naomichi Yamamoto
Journal:  PLoS One       Date:  2019-12-12       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.