| Literature DB >> 35873460 |
Pengfei Zhou1, Mingxiang Chen2.
Abstract
Catharanthus roseus produces terpenoid indole alkaloids (TIAs) of high medicinal importance. The current research focuses on finding an efficient production system such as cell suspension cultures for high TIA concentrations. Catharanthus roseus cambial meristematic cells (CMCs) offer multiple advantages over dedifferentiated cells (DDCs) regarding growth, homogeneity, and shear resistance. Our lab has established a CMC culture system induced by C. roseus cambium. We determined the concentrations of TIAs in CMCs and DDCs. CMCs produced significantly higher concentrations of total alkaloids, vindoline, vinblastine, catharanthine, and ajmalicine as compared to DDCs. We then performed Illumina HiSeq transcriptome sequencing of CMCs and DDCs and explored the differential transcriptomic signatures. Of the 96,004 unigenes, 9,564 were differentially expressed between the 2 cell suspension types. These differentially expressed genes (DEGs) were enriched in 137 KEGG pathways. Most importantly, genes from the indole alkaloid biosynthesis and the upstream pathways i.e., tryptophan metabolism, monoterpenoid biosynthesis, tropane, piperidine, and pyridine alkaloid biosynthesis, and terpenoid backbone biosynthesis showed differential transcriptomic signatures. Remarkably, the expression of genes associated with plant hormone biosynthesis, signaling, and MAPK signaling pathways was relatable to the different TIA concentrations in CMCs and DDCs. These results put forward multiple target genes, transcription factors, and regulators to develop a large-scale TIA production system using C. roseus CMCs.Entities:
Keywords: MAPK signaling; indole alkaloid biosynthesis; periwinkle; plant-hormone signaling; tissue culture; vinblastine; vindoline
Year: 2022 PMID: 35873460 PMCID: PMC9305860 DOI: 10.3389/fgene.2022.867064
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Dry weight and alkaloid content of C. roseus cambial meristematic cells (CMCs) and dedifferentiated cells (DDCs). i) Changes in dry weight over time, comparison of mean content of ii) total alkaloids, iii) vinblastine, iv) vindoline, v) catharanthine, and vi) ajmalicine. The bars represent mean values for three replicates. The error bars represent standard deviation.
FIGURE 2(A) Summary of unigene annotation in different databases, (B) overall distribution of sample gene expression, and (C) Pearson correlations between CAT-1 (CMCs) and CAT-2 (DDCs).
FIGURE 3(A) Differential gene MA map. The ordinate represents the log2 fold change value; the abscissa represents the average value of gene expression in the two samples; the red dot represents the upregulation of the gene expression, and the green dot represents the downregulation of the expression. Blue indicates no significant difference in gene expression. (B) Kyoto encyclopedia of genes and genomes (KEGG) enrichment scatter plot. The ordinate represents the KEGG pathway. The abscissa represents the Rich factor. And (C) Histogram of GO classification of the DEGs between CMCs and DDCs.
FIGURE 4Heatmap of log2 fold change values of the differentially expressed genes in Indole alkaloid biosynthesis (green), Isoquinoline alkaloid biosynthesis (blue), Tropane, piperidine and pyridine alkaloid biosynthesis (dark yellow), Monoterpenoid biosynthesis (orange), and Tryptophan metabolism (grey) pathways.
FIGURE 5Differently enriched KEGG pathways in C. roseus cells (CMCs vs. DDCs). (A) Plant hormone signal transduction and (B) MAPK signaling-plant pathway. The genes (enzymes) marked in red, green, and blue represent higher, lower, and variable (some transcripts have high and the others have low) expression in DDCs as compared to CMCs, respectively. KEGG maps were developed by using KEGG mapper tool (Kanehisa and Sato, 2020).
FIGURE 6Expression analysis of key genes involved in indole alkaloid biosynthesis in C. roseus CMCs and DDCs. TDC (tryptophan decarboxylase); G10H (geraniol 10-hydroxylase (G10H); IRS (iridoid synthase); LMAT (minovincinine 19-O-acetyltransferase); STR (strictosidine synthase); SGD (strictosidine ß-glucosidase); D4H (desacetoxyvindoline 4-hydroxylase); GES (geraniol synthase); ORCA3 (Octadecanoid-derivative Responsive Catharanthus AP2-domain); HYS (heteroyohimbine synthase); TS (tabersonine synthase); and CS (catharanthine synthase). The dotted arrows indicate indirect link/uncharacterized reaction/multiple reactions. The normal arrow indicates normal reaction (molecular interaction). The bar graph shows the qRT-PCR based expression of the selected genes. The fold expression is mean of three reactions. The error bars represent standard deviation.
FIGURE 7The samples of 12-day-old (A) cambial meristematic cells (CMCs) and (B) dedifferentiated cells (DDCs) C. roseus that were used for the extraction of RNA extraction for transcriptome sequencing comparisons.
Primers for qRT-PCR analyses of C. roseus reference and TIA biosynthetic genes.
| Gene | Primer Sequence |
|---|---|
| RPS9 (40S Ribosomal protein S9) | F = TGAAGCCCTTTTGAGGAGGATG |
| R = TGCCATCCCAGACTTGAAAACA | |
| LAMT (Loganic acid methyltransferase) | F = GAGTAATTGATGCAGCCAAG |
| R = TTGATTGGATCAAAGATTGG | |
| IRS (Iridoid synthase) | F = CCTAGGCTAAATGTCCCAAA |
| R = GTCTATGGACAGACCATGTT | |
| TDC (Tryptophan decarboxylase) | F = TCCGAAAACAAGCCCATCGT |
| R = AAGGAGCGGTTTCGGGGATA | |
| G10H (Geraniol 10-hydroxylase) | F = TGAATGCTTGGGCAATTGGA |
| R = GCAAATTCTTCGGCCAGCAC | |
| STR (Strictosidine synthase) | F = TGACAGTCCCGAAGGTGTGG |
| R = CGCCGGGAACATGTAGCTCT | |
| SGD (Strictosidine | F = ATGAGAGCTCTTGTAGGAAGCCGT |
| R = GCGCACTTCCTTCCCATCAACTTT | |
| D4H (Desacetoxyvindoline 4-hydroxylase) | F = TACCCTGCATGCCCTCAACC |
| R = TTGAAGGCCGCCAATTTGAT | |
| GES (Geraniol synthase) | F = TTGTTTTCGATTGCTTCG |
| R = TCTATGTCTTGGTTGCTCTA | |
| ORCA3 (Octadecanoid-derivative Responsive | F = CGAATTCAATGGCGGAAAGC |
| R = CCTTATCTCCGCCGCGAACT | |
| CS (Catharanthine synthase) | F = CTCCTGGCGGGATGAATAAC |
| R = GGAAACCAGGGTAACCAACA | |
| TS (tabersonine synthase) | F = AGATGCTCCTGGTGGAAATG |
| R = CAACCATGGAAATCAGCAACC | |
| HYS (heteroyohimbine synthase) | F = AGCAATCAGATTTGCCAAGG |
| R = GGGTTACTGTTGAGCAAGAAAG |