Shino Takii1, Jun Wu2,3, Daiji Okamura1. 1. Department of Advanced Bioscience, Graduate School of Agriculture, Kindai University, Nara, Japan. 2. Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, United States of America. 3. Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, TX, United States of America.
Abstract
Serum-containing medium is widely used to support cell attachment, stable growth and serial passaging of various cancer cell lines. However, the presence of cholesterols and lipids in serum greatly hinders the analysis of the effects of cholesterol depletion on cells in culture. In this study, we developed a defined serum-free culture condition accessible to a variety of different types of adherent cancer cells. We tested different factors that are considered essential for cell culture and various extracellular matrix for plate coating, and found cells cultured in Dulbecco's Modified Eagle's Medium (DMEM) basal media supplemented with Albumin (BSA) and insulin-transferrin-selenium-ethanolamine (ITS-X) on fibronectin-precoated plate (called as "DA-X condition") showed comparable proliferation and survival to those in a serum-containing medium. Interestingly, we observed that DA-X condition could be adapted to a wide variety of adherent cancer cell lines, which enabled the analysis of how cholesterol depletion affected cancer cells in culture. Mechanistically, we found the beneficial effects of the DA-X condition in part can be attributed to the appropriate level of membrane cholesterol, and fibronectin-mediated signaling plays an important role in the suppression of cholesterol production.
Serum-containing medium is widely used to support cell attachment, stable growth and serial passaging of various cancer cell lines. However, the presence of cholesterols and lipids in serum greatly hinders the analysis of the effects of cholesterol depletion on cells in culture. In this study, we developed a defined serum-free culture condition accessible to a variety of different types of adherent cancer cells. We tested different factors that are considered essential for cell culture and various extracellular matrix for plate coating, and found cells cultured in Dulbecco's Modified Eagle's Medium (DMEM) basal media supplemented with Albumin (BSA) and insulin-transferrin-selenium-ethanolamine (ITS-X) on fibronectin-precoated plate (called as "DA-X condition") showed comparable proliferation and survival to those in a serum-containing medium. Interestingly, we observed that DA-X condition could be adapted to a wide variety of adherent cancer cell lines, which enabled the analysis of how cholesterol depletion affected cancer cells in culture. Mechanistically, we found the beneficial effects of the DA-X condition in part can be attributed to the appropriate level of membrane cholesterol, and fibronectin-mediated signaling plays an important role in the suppression of cholesterol production.
Modern advances in medical and biological sciences have largely relied on the development of cell culture technology [1]. The ability and quality of culture medium to support cell survival, proliferation, and function in vitro have a direct impact on research outcomes. Thus, it is essential to select the appropriate medium when conducting cell culture experiments. It is well-established that serum-containing medium provides an optimal culture condition, which is widely used to support attachment, stable growth and serial passaging of various cancer cell lines in culture. However, as cell culture research progressed, the need for serum-free culture media, which are expected to help overcome various ethical and scientific issues, became apparent [2]. Compared to serum-containing media, serum-free media have advantages such as less variability between lots, more consistent, and in many cases lower cost (unless expensive growth factors and cytokines are used) [3].Cholesterol, an essential component of mammalian cell membranes, not only maintains cell structure, but also plays an important role in other cellular functions such as biosynthesis of bile acids and hormones, embryonic development, and cell proliferation [4]. Most of the cellular cholesterol enriches in the plasma membrane after transportation from endoplasmic reticulum, which regulates cellular proliferation, differentiation, and survival. Cholesterol metabolism is known to critically contributes to cancer cell proliferation, migration and invasion, and accumulation of cholesterol in solid tumors is considered as a hallmark for aggressive cancers [5-9]. However, given that serum contains numerous cholesterols and lipids, serum-containing media are therefore not ideal for studying effects of cholesterols on cancer cells in culture. Although serum-free media with optimized compositions for each adherent cancer cell line are available, few of these cultures can support the growth of other cancer cell types, and there is a lack of universal serum-free medium applicable to a wide range of adherent cell lines. In contrast, in the field of pluripotent stem cells, the use of serum-free and/or xeno-free medium has become standard [10].In this study, we aimed to develop a universal serum-free culture medium broadly applicable to any adherent cancer cell types. While testing various essential culture parameters including extracellular matrix, we found that growing cells in Dulbecco’s Modified Eagle’s Medium (DMEM) basal medium containing Albumin (BSA) and insulin-transferrin-selenium-ethanolamine (ITS-X) on culture plates pre-coated with fibronectin (called as “DA-X condition”) showed robust cell proliferation and attached cells exhibited elongated pseudopodia, which were comparable to cells grown in a serum-containing medium. DA-X condition also facilitated the study of the effects of cholesterol and lipid on cancer cells in vitro in a wide variety of adherent cancer cell lines. Importantly, we found that cells grown in the DA-X condition maintained the right amount of membrane cholesterol important for robust cell attachment, elongated pseudopodia and survival in serum-free condition, and fibronectin-mediated signaling plays important roles in suppressing excess cholesterol production.
Materials and methods
Cell lines and culture
Cell lines using in this research were obtained from the Cell Resource Center for Biomedical Research (Institute of Development, Aging and Cancer, Tohoku University, Japan) and maintained in 10% Fetal Bovine Serum (Gibco, 10270)-contained DMEM medium (nacalai tesque, 08458–45) which is supplemented with 1x Penicillin-Streptomycin Mixed Solution (nacalai tesque, 26253–84), and passaged using TrypLE (Gibco, 12604013) every 4–5 days. Briefly for in RPMI-G [11], 2x104 cells were seeded into one well of a 4-well plate without pre-coating in RPMI1640 medium (nacalai tesque, 3026485) supplemented with 1x ITS-G: Insulin-Transferrin-Selenium (Gibco, 41400045), 1x L-Glutamine (nacalai tesque, 16948–04), 1x Penicillin-Streptomycin Mixed Solution. In DA-X condition (shown as ITS-X/ DMEM/ BSA (FN) in Fig 1A), 2x104 cells were seeded into one well of a 4-well plate pre-coated with Fibronectin in DMEM medium (High Glucose) (nacalai tesque, 08458–45) supplemented with 1x ITS-X: Insulin-Transferrin-Selenium-Ethanolamine (Gibco, 51500056), 5 mg/mL BSA: Bovine Serum Albumin (Sigma, A3059), 1x L-Glutamine, 1x Penicillin-Streptomycin Mixed Solution. DMEM/Ham’s F-12 (nacalai tesque, 11581–15) was used for ITS-X/ DMEM/F-12/ BSA (FN) (shown in Fig 1B). Extracellular matrix was coated on a well of 4-well cell culture plate (SPL, 30004) and incubated for 1 hour at 37˚C at the desired concentration, 2.35 μg/cm2 for Fibronectin (FUJIFILM, 063–05591), 1.25 μg/cm2 for Vitronectin (FUJIFILM, 220–02041), 0.5 μg/cm2 for Laminin511-E8 fragments: iMatrix-511 (MAX, 892011), 2% for Matrigel (Corning, 354234), 0.2% for Gelatin (Sigma, G1890). For optimization of serum-free culture condition for stable adhesion, the combination of basal medium, supplements and extracellular matrix shown in the notation in Fig 1A at a concentration mentioned above were attempted. For inhibition of fibronectin-binding and -mediated signaling, RGDS peptide (Cayman, 15359–5) as fibronectin Inhibitor was added in culture at 50 μg/mL (the solvent, DMSO, was added for control). The images of cells were collected by a microscopy in phase-contrast (Keyence, BZ-X710).
Fig 1
Optimization of novel serum-free condition on HeLa cells.
a, Representative images of cells in each culture condition. In screening for novel serum-free condition, 2x104 cells of HeLa cell (human cervical cancer cell line) maintained in 10% FBS/ DMEM were seeded onto each serum-free media condition. Combinations of media composition and extra-cellular matrix are shown. Improving stepwisely from RPMI-G with replacing the media composition resulted in establishment of the ITS-X/ DMEM/ BSA on fibronectin-precoated well (called as DA-X condition), which significantly improved cell adhesion, pseudopodia elongation, or proliferation. Non-coat, without any pre-coating. White and pink arrowheads indicate cells with losing attachment and cells with firm elongated pseudopodia, respectively. FN, fibronectin-coated. Scale bar, 100 μm. b, Representative images of cells cultured in DMEM/ Ham’s F-12-based medium with ITS-X/ BSA on fibronectin-precoated well. c, Representative images of cells in comparison of effect of extracellular matrix. 2x104 cells of HeLa cell maintained in 10% FBS/ DMEM were seeded onto a pre-coated well with each extracellular matrix. Regarding to cell adhesion, pseudopodia elongation, or proliferation, fibronectin was shown as much better than the other extracellular matrix. The effect of vitronectin was shown as comparable to that of fibronectin in cell adhesion and cell proliferation, but not in pseudopodia elongation. Scale bar, 100 μm.
Optimization of novel serum-free condition on HeLa cells.
a, Representative images of cells in each culture condition. In screening for novel serum-free condition, 2x104 cells of HeLa cell (human cervical cancer cell line) maintained in 10% FBS/ DMEM were seeded onto each serum-free media condition. Combinations of media composition and extra-cellular matrix are shown. Improving stepwisely from RPMI-G with replacing the media composition resulted in establishment of the ITS-X/ DMEM/ BSA on fibronectin-precoated well (called as DA-X condition), which significantly improved cell adhesion, pseudopodia elongation, or proliferation. Non-coat, without any pre-coating. White and pink arrowheads indicate cells with losing attachment and cells with firm elongated pseudopodia, respectively. FN, fibronectin-coated. Scale bar, 100 μm. b, Representative images of cells cultured in DMEM/ Ham’s F-12-based medium with ITS-X/ BSA on fibronectin-precoated well. c, Representative images of cells in comparison of effect of extracellular matrix. 2x104 cells of HeLa cell maintained in 10% FBS/ DMEM were seeded onto a pre-coated well with each extracellular matrix. Regarding to cell adhesion, pseudopodia elongation, or proliferation, fibronectin was shown as much better than the other extracellular matrix. The effect of vitronectin was shown as comparable to that of fibronectin in cell adhesion and cell proliferation, but not in pseudopodia elongation. Scale bar, 100 μm.
Modulation of cholesterol
For modulating of membrane cholesterol contents in culture, Methyl-β-cyclodextrin (MβCD) (Sigma, 332615) for depletion of membrane cholesterol [12] and soluble cholesterol (Sigma, C8667) (as a complex of MβCD and cholesterol) were added according to each purpose at 0.2 mM, 1 mM (MβCD) and 30 μM (cholesterol). 2x104 cells maintained in 10% FBS/ DMEM were seeded onto non-coat in RPMI-G or fibronectin-coated in DA-X condition well of 4-well cell culture plate. At 1 day after seeded, MβCD or soluble cholesterol was added (the solvent, sterile water or EtOH, was added for control respectively). For exploring of functions of cholesterol biosynthesis depending on culture medium, Ro48-8071 (Cayman, 10006415), a selective inhibitor of Oxidosqualene cyclase [13], known as a cholesterol biosynthesis inhibitor was used. 2x104 cells maintained in 10% FBS/ DMEM were seeded onto non-coat in 10% FBS/ DMEM or fibronectin-coated in DA-X condition well of 4-well cell culture plate. At 1 day after seeded, Ro48-8071 was added at 1 μM (the solvent, EtOH, was added for control).
Qualitative estimation of membrane cholesterol
For labeling of membrane cholesterol, cells grown on 4-well plate were fixed with 4% paraformaldehyde in PBS for 15 min at room temperature. The cells were washed three times in PBS, and then incubate with 1.5 mg/ml glycine in PBS for 10 min at room temperature to quench the paraformaldehyde. Cells were stained with filipin working solution (0.05 mg/ml filipin III (Cayman, 70440) in 10% FBS-contained PBS) for 2 hrs at room temperature, and washed three times in PBS, and then the images were collected by fluorescent microscopy in PBS in phase-contrast (Keyence, BZ-X710).
RNA preparation and real-time PCR
Total RNAs were extracted by using Sepasol-RNA I Super G (nacalai tesque, 09379) to the manufacturer’s instructions. RNAs were reverse-transcribed using ReverTra Ace qPCR RT Master Mix (TOYOBO, FSQ-201), and real-time PCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO, QPS-201) in MIC qPCR (bio molecular systems). Expression levels of each gene were normalized to β-ACTIN (human) expression and calculated using comparative CT method. The primer sequences are shown in below: β-ACTIN-F (CTGGCACCACACCTTCTACAATG), β-ACTIN-R (AATGTCACGCACGATTTCCCGC), SREBF1-F (ACAGTGACTTCCCTGGCCTAT), SREBF1-R (GCATGGACGGGTACATCTTCAA), SREBF2-F (AACGGTCATTCACCCAGGTC), SREBF2-R (GGCTGAAGAATAGGAGTTGCC), ACSS2-F (AAAGGAGCAACTACCAACATCTG), ACSS2-R (GCTGAACTGACACACTTGGAC), HMGCR-F (TGATTGACCTTTCCAGAGCAAG), HMGCR-R (CTAAAATTGCCATTCCACGAGC), HM-GCS1-F (GATGTGGGAATTGTTGCCCTT), HMGCS1-R (ATTGTCTCTGTTCCAACTTCCAG), LDLR-F (ACCAACGAATGCTTGGACAAC), LDLR-R (ACAGGCACTCGTAGCCGAT), ACLY-F (TCGGCCAAGGCAATTTCAGAG), ACLY-R (CGAGCATACTTGAACCGATTCT).
Statistical analysis
Statistical analysis was performed using the Student’s t-test. P values < 0.05 were considered to be statistically significant.
Results
Development of a novel serum-free culture condition for HeLa cells
ITS-G/ RPMI1640 (referred to as “RPMI-G” hereafter), a defined serum-free cell culture medium reported previously [11], contains ITS-G supplement composed of Insulin-Transferrin-Selenium, known to support cell proliferation in reduced-serum medium. RPMI-G supported robust cell adhesion and proliferation of several melanoma cell lines. We tested culturing HeLa cells in RPMI-G medium. Interestingly, however, HeLa cells loosely attached to the culture plate 2~3 days after seeding and detached, and consequently could not be maintained in RPMI-G medium (Fig 1A). To establish a simpler and more reliable serum-free condition that can facilitate the functional analysis of cholesterol and lipid metabolism of various adherent cancer cell lines including HeLa cells, we optimized the RPMI-G medium taking consideration of several culture parameters: (1) Cell adhesion to culture plates, (2) Cell morphology (with or without pseudopodia), and (3) Cell proliferation. We didn’t consider the long-term cultivability in this report. After testing the effects of various supplements, base medium and extracellular matrix in serum-free conditions, we found ethanolamine in ITS-X, fibronectin-precoating and DMEM base medium had positive effects on cell adhesion and extension of pseudopodia, and the supplementation of BSA improved cell proliferation (Fig 1A). Interestingly, we found although DMEM/Ham’s F-12 is widely used as a basal media for serum-free cultures [1], cell attachment was markedly attenuated with the retraction of pseudopodia on day 5 while initial cell attachment and growth were not affected (Fig 1B).We also tested the effects of several extracellular matrix proteins, which are widely used in pluripotent stem cells including human iPS cells (Fig 1C) [1, 2]. Taken together, ITS-X/ DMEM/ BSA on fibronectin pre-coated culture plates, referred to as the “DA-X condition”, was determined to be the optimal serum-free culture condition that supports stable adhesion, extended pseudopodia and robust cell proliferation, which is comparable to 10% FBS/ DMEM medium condition (Fig 1).
The utility of DA-X condition for studying cholesterol function
It is difficult to see the early effects of cholesterol biosynthesis inhibition or depletion of membrane cholesterol (e.g. treatment with Methyl-β-cyclodextrin [12]) in adherent cultures, since serum even at reduced levels contains large amounts of lipids and cholesterols. In fact, Ro48-8071 known as a cholesterol biosynthesis inhibitor by selective inhibition of Oxidosqualene cyclase had no harmful effects at all even at 1 μM on adherent HeLa cells cultured in 10% FBS/ DMEM medium (Fig 2A, two images at the top). In sharp contrast, addition of Ro48-8071 in DA-X condition had a dramatic effect, and almost all cells detached and underwent cell death within 48 hours (Fig 2A, two images at the bottom). These results demonstrate the potential of the serum-free DA-X condition to provide an appropriate culture environment for analyzing the role of lipids and cholesterols in adherent cancer cell lines.
Fig 2
Availability of DA-X condition on analysis for cholesterol function, and in several cancer lines.
a, Effect of cholesterol biosynthesis inhibitor, Ro48-8071, on HeLa cells in serum-containing and -free culture condition for 48 hrs. In cells grown in 10% FBS/ DMEM, Ro48-8071 was shown to have no effect on cell survival and even their proliferation, while almost cells cultured in DA-X condition were shown to be dead. Scale bar, 100 μm. b and c, Comparison of the effects of RPMI-G medium and DA-X condition on cell adhesion, pseudopodia and proliferation in representative human cancer cell lines of each organ and tissue. Images of cells cultured in RPMI-G (b) and DA-X condition (c) at day 5 are shown. The number of cells at the start of culture was optimized for each cell type to reach about 80% confluency at day 5 in 10% FBS/ DMEM medium (the using cancer cell lines and their number of cells at the start of cultures in one well of a 4-well plate are shown below). HepG2 (hepatoma, 4x104), A549 (lung cancer, 2x104), Panc-1 (pancreatic cancer, 4x104), HeLa (cervical cancer, 2x104), SH-SY5Y (neuroblastoma, 4x104), SW620 (colon cancer, 4x104), PC-3 (prostatic cancer, 3x104), MCF-7 (breast cancer, 3x104). Scale bar, 100 μm.
Availability of DA-X condition on analysis for cholesterol function, and in several cancer lines.
a, Effect of cholesterol biosynthesis inhibitor, Ro48-8071, on HeLa cells in serum-containing and -free culture condition for 48 hrs. In cells grown in 10% FBS/ DMEM, Ro48-8071 was shown to have no effect on cell survival and even their proliferation, while almost cells cultured in DA-X condition were shown to be dead. Scale bar, 100 μm. b and c, Comparison of the effects of RPMI-G medium and DA-X condition on cell adhesion, pseudopodia and proliferation in representative human cancer cell lines of each organ and tissue. Images of cells cultured in RPMI-G (b) and DA-X condition (c) at day 5 are shown. The number of cells at the start of culture was optimized for each cell type to reach about 80% confluency at day 5 in 10% FBS/ DMEM medium (the using cancer cell lines and their number of cells at the start of cultures in one well of a 4-well plate are shown below). HepG2 (hepatoma, 4x104), A549 (lung cancer, 2x104), Panc-1 (pancreatic cancer, 4x104), HeLa (cervical cancer, 2x104), SH-SY5Y (neuroblastoma, 4x104), SW620 (colon cancer, 4x104), PC-3 (prostatic cancer, 3x104), MCF-7 (breast cancer, 3x104). Scale bar, 100 μm.
DA-X condition as universal serum-free condition for cancer cell lines
The development of serum-free media that can be broadly applied to any cancer cell line is important for studying the role of lipids and cholesterols in the survival and proliferation of cancer cells. Next, we performed side-by-side comparison of RPMI-G medium and DA-X condition in terms of cell adhesion, pseudopodia and proliferation using representative human cancer cell lines derived from different organs and tissues (Fig 2B and 2C). Cancer cells maintained in 10% FBS/ DMEM medium were switched to culture in serum-free conditions RPMI-G and DA-X, and phase contrast images were recorded on day 5 to monitor cell viability, attachment, morphology, and proliferation. In general, we found DA-X condition was more reliable than RPMI-G to support cell survival and proliferation with pronounced elongated pseudopodia in tested cell lines (Fig 2B and 2C). Cell proliferation and attachment of SH-SY5Y (neuroblastoma) and PC-3 (prostatic cancer) in DA-X condition was comparable to those in RPMI-G. Although HepG2 (hepatoma) and SW620 (colon cancer) in DA-X condition showed comparable proliferation when compared to that in RPMI-G, they exhibited more evident adhesion and pseudopodia in cells than those in RPMI-G. In the other lines including A549 (lung cancer), Panc-1 (pancreatic cancer), HeLa (cervical cancer), MCF-7 (breast cancer), cell survival and proliferation were observed only under DA-X condition but not in RPMI-G. Taken together, we demonstrate the efficacy in culturing various adherent cancer cell lines in the serum-free DA-X condition (at least for 5 days without passaging), which holds great potential for analyzing role of lipids and cholesterol in these cells (Fig 2).
Varied cholesterol content in serum-free culture medium condition
RPMI-G, a defined serum free cell culture medium, supports de novo fatty acid and -cholesterol biosynthesis in several adherent melanoma cell lines, which enabled unperturbed cell adhesion and proliferation [11]. While testing the hypothesis that cells grown in the DA-X condition have increased fatty acid and cholesterol production through upregulation of biosynthesis-related genes when compared to the RPMI-G culture medium, we surprisingly found that the amount of cholesterol in the membrane of HeLa cells in DA-X medium was greatly reduced in comparison to that in RPMI-G (Fig 3A). Consistently, significant transcriptional down-regulation of cholesterol biosynthesis-related genes was also observed in cells cultured in the DA-X condition. In contrast, these genes were up-regulated in RPMI-G when compared with 10% FBS/ DMEM as previously reported (Fig 3B) [11]. Together, these results lead us to hypothesize that cells grown in RPMI-G medium are prone to detach due to the excess of membrane cholesterol, DA-X condition provides benefit for stable cell adhesion in part due to lowered membrane cholesterol content.
Fig 3
Required cholesterol level on membrane optimized by DA-X condition in HeLa cells.
a, Cholesterol labeling with filipin fluorescence staining in each culture condition. Cells were cultured in 10% FBS/ DMEM, RPMI-G, DA-X condition for 2 days, and then applied for the staining. Signals of fluorescence were enriched in membrane of cells regardless of culture condition, and the intensity was strong in 10% FBS/ DMEM and RPMI-G, but quite faint in DA-X condition. Images for filipin staining were obtained using the same exposure time. Scale bar, 50 μm. b, Quantitative PCR analysis of expression of de novo cholesterol biosynthesis-related genes. Cells cultured in each condition for 2 days, and collected for further gene expression analysis. Error bars indicate s.d. (n = 3, biological replicates). t-test, **p < 0.01 and *p < 0.05. c, Enhancement of cell adhesion and proliferation by depletion of membrane cholesterol with Methyl-β-cyclodextrin (MβCD) at 0.2 mM in RPMI-G culture medium. Pink arrowheads indicate cells with firm elongated pseudopodia. d, Effects of excess and depletion of membrane cholesterol on cell adhesion by addition of soluble cholesterol and MβCD in DA-X condition. At day 4 and 5, attenuated cell adhesion with the retraction of pseudopodia was widely observed not only in addition of cholesterol, but also in depletion of membrane cholesterol with MβCD at 1 mM. Scale bar, 100 μm. White arrowheads indicate cells with losing attachment.
Required cholesterol level on membrane optimized by DA-X condition in HeLa cells.
a, Cholesterol labeling with filipin fluorescence staining in each culture condition. Cells were cultured in 10% FBS/ DMEM, RPMI-G, DA-X condition for 2 days, and then applied for the staining. Signals of fluorescence were enriched in membrane of cells regardless of culture condition, and the intensity was strong in 10% FBS/ DMEM and RPMI-G, but quite faint in DA-X condition. Images for filipin staining were obtained using the same exposure time. Scale bar, 50 μm. b, Quantitative PCR analysis of expression of de novo cholesterol biosynthesis-related genes. Cells cultured in each condition for 2 days, and collected for further gene expression analysis. Error bars indicate s.d. (n = 3, biological replicates). t-test, **p < 0.01 and *p < 0.05. c, Enhancement of cell adhesion and proliferation by depletion of membrane cholesterol with Methyl-β-cyclodextrin (MβCD) at 0.2 mM in RPMI-G culture medium. Pink arrowheads indicate cells with firm elongated pseudopodia. d, Effects of excess and depletion of membrane cholesterol on cell adhesion by addition of soluble cholesterol and MβCD in DA-X condition. At day 4 and 5, attenuated cell adhesion with the retraction of pseudopodia was widely observed not only in addition of cholesterol, but also in depletion of membrane cholesterol with MβCD at 1 mM. Scale bar, 100 μm. White arrowheads indicate cells with losing attachment.
Range of optimal membrane cholesterol for stable cell adhesion
To determine whether there is an appropriate range of membrane cholesterol for stable cell adhesion in serum-free medium condition, we modulated the membrane cholesterol levels in both RPMI-G and DA-X conditions to see their effects on cell adhesion. Augmentation and depletion of membrane cholesterol were achieved by supplementation with soluble cholesterol and Methyl-β-cyclodextrin (referred to as “MβCD” hereafter), respectively (Fig 3C and 3D). Depletion of cellular membrane cholesterol by MβCD in RPMI-G (Fig 3A and 3B) resulted in a significant improvement in cell adhesion (Fig 3C). In contrast, under DA-X conditions, both increase and depletion of membrane cholesterol led to the attenuation of cell adhesion accompanied by the retraction of elongated pseudopodia (Fig 3D). These results suggest that the excess of membrane cholesterol in RPMI 1640 medium may have caused cell death due to compromised cell adhesion, and the beneficial effects of the DA-X condition may due to the appropriate amount of membrane cholesterol achieved by the suppression of cholesterol biosynthesis-related gene expression (Fig 3) [14].
Involvement of fibronectin in the suppressing genes needed for cholesterol biosynthesis
To determine the molecular mechanisms by which expression of cholesterol biosynthesis-related genes were suppressed in DA-X condition, we inhibited fibronectin-binding and -mediated signaling by the addition of RGDS peptide [2, 15, 16], and quantified the expression levels of cholesterol biosynthesis-related genes by quantitative PCR analysis (Fig 4A and 4B). Inhibition of fibronectin with RGDS peptide in DA-X condition resulted in not only different cell morphology (Fig 4A) but also significant up-regulation of cholesterol biosynthesis-related genes (Fig 4B). Therefore, fibronectin-binding or -mediated signaling play important roles in the suppression of cholesterol production in DA-X condition.
Fig 4
Involving fibronectin in down-regulation of cholesterol biosynthesis-related genes expression in DA-X condition.
a, Representative images of HeLa cells under RGDS peptide treatment in DA-X culture condition. After exposed to RGDS peptide for 3 days, retracting the pseudopodia of cells was observed accompanied by tightly association between neighbor cells. Scale bar, 100 μm. White arrowheads indicate cells with the retraction of pseudopodia. b, Quantitative PCR analysis of expression of de novo cholesterol biosynthesis-related genes. HeLa cells exposed to RGDS peptide for 4 days under DA-X condition were collected for further gene expression analysis. Error bars indicate s.d. (n = 3, biological replicates). t-test, **p < 0.01 and *p < 0.05. c, Schematic representation summarizing the appropriate range of cholesterol contents on cell membrane in serum-free medium condition for cell adhesion and proliferation.
Involving fibronectin in down-regulation of cholesterol biosynthesis-related genes expression in DA-X condition.
a, Representative images of HeLa cells under RGDS peptide treatment in DA-X culture condition. After exposed to RGDS peptide for 3 days, retracting the pseudopodia of cells was observed accompanied by tightly association between neighbor cells. Scale bar, 100 μm. White arrowheads indicate cells with the retraction of pseudopodia. b, Quantitative PCR analysis of expression of de novo cholesterol biosynthesis-related genes. HeLa cells exposed to RGDS peptide for 4 days under DA-X condition were collected for further gene expression analysis. Error bars indicate s.d. (n = 3, biological replicates). t-test, **p < 0.01 and *p < 0.05. c, Schematic representation summarizing the appropriate range of cholesterol contents on cell membrane in serum-free medium condition for cell adhesion and proliferation.
Discussion
Here, we show that the amount of cholesterol in the cell membrane greatly affects cell attachment, pseudopodia formation and eventually the survival of cells under serum-free conditions. Furthermore, functional analysis by modulating membrane cholesterol content in RPMI-G and DA-X conditions revealed that there is the appropriate amount of range of membrane cholesterol for stable cell attachment, pseudopodia formation and proliferation in serum-free medium condition (Figs 3C, 3D and 4C). We demonstrated that cells grown in the DA-X culture condition maintained the right amount of cholesterol in cell membrane in part through extracellular matrix (fibronectin) signaling. The positive results seen using eight representative human cancer cell lines suggest that the DA-X condition serves as a universal serum-free culture condition that support pseudopodia formation, robust cell attachment and proliferation prior to cell passaging. This contrasts with conventional serum-free media, which are typically developed and optimized for each cell types. We therefore believe the DA-X culture condition can serve as a powerful platform for clarifying the role of cholesterol in different cancer cells [1].We also demonstrated that supplementation of Ro48-8071 in DA-X condition had profound effects on cell detachment and viability (Fig 2A). Statin, inhibitors of HMG-CoA reductase, has also shown to inhibit cancer cell proliferation and increase apoptosis [8, 17, 18], which seems dependent on cell attachment since similar effects were not observed in acute lymphoid leukemia grown in suspension [7]. Future studies are warrantied to further examine the mechanism(s) of cell death by cholesterol biosynthesis inhibition on cancer cells.We observed that marked increase of membrane cholesterol content in HeLa cells cultured in RPMI-G (Fig 3A and 3B), which is consistent with seen in other type of serum-free conditions [19]. Cells in these conditions are prone to detachment and cell apoptosis. Enrichment of cholesterol in the lipid raft of membrane in cancer cells make them more sensitive to cholesterol depletion and induces anoikis like cell death [20], suggesting that there is a close relationship between the amount of membrane cholesterol in cancer cells and cell survival in serum-free culture condition.Finally, from the perspective of decarbonization, recently research on cultured meat is rapidly progressing but most, if not all, cultures still use serum-supplemented medium. Serum-free medium will be essential for the establishment of cultured meat in the future in order to reduce cost, achieve consistency and minimize the impact of carbonization [21]. Our study revealed that keeping the right amount of membrane cholesterol is essential for cell survival and proliferation in serum-free culture conditions, and we believe these results will facilitate the development of serum-free medium for cultured meat.
Cq value in quantitative PCR analysis as raw data for the gragh.
Cq value for Fig 3B (upper) and Fig 4B (bottom). The expression of cholesterol biosynthesis-related genes as genes of interest is measured between cultured cells in each condition as biological groups. Each biological group contains three biological replicates. b-ACTIN is used as a reference gene.(PDF)Click here for additional data file.25 Feb 2022
PONE-D-21-33428
The amount range of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition.
PLOS ONE
Dear Dr. Okamura,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Please submit your revised manuscript by April 11, 2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Avaniyapuram Kannan Murugan, M.Phil., Ph.D.Academic EditorPLOS ONEJournal Requirements:hen submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.3. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was partly supported by grants from JSPS KAKENHI Grant Number JP20K06661 (Grant-in-Aid for Scientific Research (C)), Kindai University Research Enhancement Grant (21st Century Joint Research Enhancement Grant), the Cooperative Research Project Program of Joint Usage/Research Center at the Institute of Development, Aging and Cancer, Tohoku University."We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "No"Please include your amended statements within your cover letter; we will change the online submission form on your behalf.4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.We will update your Data Availability statement to reflect the information you provide in your cover letter.5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments:Interesting study and reviewers' comments reflected the same. However, some important points raised by the reviewers to be addressed before the publication.Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Takii et al. submitted a research article entitle “The amount range of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition”. They aimed to develop a universal serum-free culture medium to facilitate the study of the effects of cholesterol and lipid on cancer cells in vitro in various adherent cancer cell lines. Since the serum-containing media contain numerous cholesterols and lipids, and are not ideal for studying effects of cholesterols on cancer cells in culture, they found that Dulbecco's Modified Eagle's Medium (DMEM) basal medium containing Albumin (BSA) and insulin-transferrin-selenium-ethanolamine (ITS-X) on culture plates pre-coated with fibronectin (called as “DA-X condition”) are comparable to a serum-containing medium. They both showed similar robust cell proliferation and elongated pseudopodia cells.While this is an interesting finding, there are some points that should be addressed before this research article is consider for publication.Major points:1- In line 169 it is stated that almost all cells detached and underwent apoptosis within 48 hours (Fig. 2a, two images at bottom) after the use of the selective inhibitor of Oxidosqualene cyclase, although there are no assessments of apoptosis. Since the authors did not conduct a concentrations dependent experiment on Ro48-8071, toxicity of the compound cannot be excluded. It has been previously shown the effect of Ro48-8071 in (nM), therefore, I will recommend to perform a concentrations dependent experiment on Ro48-8071 with maximum concentration of 1 μM on cells cultured in DA-X condition. Authors may include the results in a supplementary document and revise the main results accordingly, if needed.Minor points:1- In line 106, reference is missing.2- Correct the spelling of “Oxidosqualen cyclase” to Oxidosqualene cyclase.3- Enhance the resolution of the histograms in figure 3b and 4b, so the entire information can be easily seen.Reviewer #2: The manuscript "The amount range of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition by Takii et al. is well-studied and well-written. I recommend for publication.Minor comments1. The title is not conclusive and if "range" is removed, the title would be better received. or The title can be modified for better and as conclusive.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: NoWhile revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
11 Mar 2022Dr. Avaniyapuram Kannan Murugan, M.Phil., Ph.D.Academic Editor, PLOS ONE3rd March, 2022Dear Dr. Murugan,I would like to express my sincere gratitude to you for taking your valuable time to an evaluation and provide useful comments regarding our manuscript, “The amount of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition” (the title has been changed in response to reviewers’ comment). I would also like to thank the editor and reviewers for their constructive advice, which will greatly improve our paper. We agree with you that reason for the decision as minor revision, so we have addressed as below in response to “additional editor comments” and “Review Comments to the Author” by changing the content to better conform with the formatting and content rules of PLOS ONE.I have separated my responses to the reviewers’ comments according to each reviewer.---------------------------------------------------------------------------------------------------Reviewer #1:While this is an interesting finding, there are some points that should be addressed before this re-search article is consider for publication.Major points:1- In line 169 it is stated that almost all cells detached and underwent apoptosis within 48 hours (Fig. 2a, two images at bottom) after the use of the selective inhibitor of Oxidosqualene cyclase, alt-hough there are no assessments of apoptosis.2- Since the authors did not conduct a concentrations dependent experiment on Ro48-8071, toxicity of the compound cannot be excluded. It has been previously shown the effect of Ro48-8071 in (nM), therefore, I will recommend to perform a concentrations dependent experiment on Ro48-8071 with maximum concentration of 1 μM on cells cultured in DA-X condition. Authors may include the re-sults in a supplementary document and revise the main results accordingly, if needed.Our responses to Major points:1- We fully agree with you and have incorporated this suggestion. In our revised manuscript, we de-scribed it as “cell death”, not “apoptosis” in line 171.2- You have raised an important question regarding “toxicity of the compound”; since we’re sorry that this part was not clear in the original manuscript. However, we believe that it can be excluded from the conclusion since the harmful effects of Ro48-8071 even at 1µM on HeLa cells cultured in 10%FBS/DMEM were not shown at all in figure 2a (two images at the top). Therefore, we should have explained that “Ro48-8071 known as a cholesterol biosynthesis inhibition by selective inhibi-tion of Oxidosqualene cyclase had no harmful effects at all on adherent HeLa cells cultured in 10% FBS/ DMEM medium.” in line 167-169, as we have revised the contents of this part.Minor points:1- In line 106, reference is missing.2- Correct the spelling of “Oxidosqualen cyclase” to Oxidosqualene cyclase.3- Enhance the resolution of the histograms in figure 3b and 4b, so the entire information can be easily seen.Our responses to Minor points:1- We have incorporated your comments by the addition of an appropriate reference in line 106. In addition, we realized with your comment to need an appropriate reference regarding the function of Methyl-� -cyclodextrin and so made it in line 166.2- We have corrected spelling of this throughout our revised paper (in line 106 and 168).3- By checking the files of figure at submission, the resolution of the histograms in figure 3b and 4b was high enough to clearly see the information. This is probably due to the conversion of the image file format when the manuscript was compiled for sending to reviewers. Therefore, we believe that sufficient resolution of the histograms can be ensured for publication.---------------------------------------------------------------------------------------------------Reviewer #2: The manuscript "The amount range of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition by Takii et al. is well-studied and well-written. I recommend for publication.Minor comments1. The title is not conclusive and if "range" is removed, the title would be better received. or The title can be modified for better and as conclusive.Our responses to Minor points:1- We fully agree with you and have incorporated this suggestion by removing the word “range” from the title (in line 2). I would like to express our thanks for allowing us an opportunity to reconsider the title for more conclusive.---------------------------------------------------------------------------------------------------With these changes to our final manuscript, we hereby resubmit our manuscript for a secondary evalu-ation. We are certain that you will find this most recent version of our manuscript clears up the main issues you indicated in your response.Thank you one again for your kind consideration.Sincerely yours,Daiji Okamura, Ph.D.Department of Advanced Bioscience,Graduate School of Agriculture,Kindai UniversityTEL: +81-742-43-5384; FAX: +81-742-43-8976; e-mail: dokamura@nara.kindai.ac.jpSubmitted filename: Response to Reviewers.docClick here for additional data file.12 Apr 2022The amount of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition.PONE-D-21-33428R1Dear Dr. Okamura,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Avaniyapuram Kannan Murugan, M.Phil., Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response)Reviewer #2: Manuscript: The amount of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition.The authors have addressed all the comments. I do not have further comments.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No28 Jun 2022PONE-D-21-33428R1The amount of membrane cholesterol required for robust cell adhesion and proliferation in serum-free condition.Dear Dr. Okamura:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Avaniyapuram Kannan MuruganAcademic EditorPLOS ONE
Authors: Marie-France Demierre; Peter D R Higgins; Stephen B Gruber; Ernest Hawk; Scott M Lippman Journal: Nat Rev Cancer Date: 2005-12 Impact factor: 60.716
Authors: Carlos Fernández; María del Val T Lobo Md; Diego Gómez-Coronado; Miguel A Lasunción Journal: Exp Cell Res Date: 2004-10-15 Impact factor: 3.905
Authors: Claudia A Sánchez; Emma Rodríguez; Elvira Varela; Estrella Zapata; Araceli Páez; Felipe A Massó; Luis F Montaño; Rebeca Lóopez-Marure Journal: Cancer Invest Date: 2008-08 Impact factor: 2.176
Authors: J Dimitroulakos; D Nohynek; K L Backway; D W Hedley; H Yeger; M H Freedman; M D Minden; L Z Penn Journal: Blood Date: 1999-02-15 Impact factor: 22.113