Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding.

DNA barcoding is a supplementary tool in plant systematics that is extensively used to resolve species-level controversies. This study assesses the significance of using two DNA barcoding loci (e.g., psbA-trnH and trnC-petN) in distinguishing 33 plant samples of the genus Syringa. Results showed that the average genetic distance K2P of psbA-trnH DNA marker was 0.0521, which is much higher than that of trnC-petN, which is 0.0171. A neighbor-joining phylogenetic tree based on psbA-trnH and trnC-petN indicated that the identification rate of psbA-trnH and trnC-petN alone were 75% and 62.5%, respectively. The barcode combination of psbA-trnH+trnC-petN could identify 33 samples of the genus Syringa accurately and effectively with an identification rate of 87.5%. The 33 Syringa samples were divided into four groups: Group I is series Syringa represented by Syringa oblata; Group II is series Villosae represented by Syringa villosa; Group III is series Pubescentes represented by Syringa meyeri; and Group IV is section Ligustrina represented by Syringa reticulata subsp. pekinensis. These research results provided strong evidence that the combinatorial barcode of psbA-trnH+trnC-petN had high-efficiency identification ability and application prospects in species of the genus Syringa.

Introduction

DNA barcodes enable the rapid and accurate identification of species using short, standardized DNA regions as species tags [1]. In addition to assigning specimens to known species, DNA barcoding will accelerate the pace of species discovery by allowing taxonomists to sort specimens rapidly and by highlighting divergent taxa that may represent new species [2]. DNA barcoding had been widely used in various biological fields because of its advantages of high sensitivity, accuracy, and objectivity [3-6]. One of the major challenges faced by barcoding is the ability to resolve sister species within a large geographical range. Consortium for the Barcode of Life (CBOL) recommended the use of two plastid loci (e.g., matK and rbcL) as the standard plant DNA barcode loci [7]. A large number of experiments had been conducted using these two markers in different taxa and species. However, the identification results were unsatisfactory. Chase emphasized that the universality and identification effect of matK primers were not ideal [8]. Sass found that the rbcL often used for phylogenetic analysis across large groups of plants did not usually contain enough variability to identify individual species [9]. Increasing number of studies had shown that a system based on any one or small number of chloroplast genes will fail to differentiate taxonomic groups with extremely low amount of plastid variations while it will be effective in other groups [10,11]. Therefore, some scholars suggested that the screening of plant barcodes should not only focus on a single fragment but must be supplemented with additional fragment as required, and a combination of multiple fragment markers should be used [12]. Kress and Erickson combined the non-coding trnH-psbA spacer region, and the use of a portion of the coding rbcL gene as a two-locus global land plant barcode that provides the necessary universality and species discrimination is recommended [13]. Lahaye reported that the combination of matK to trnH-psbA and psbK-psbI could slightly increase its performance in identifying species [14]. Ho Viet identified 21 jewel orchids by rbcL+matK [15]. Meanwhile, Bhagya Chandrasekara found that rbcL+matK+trnH-psbA could still not completely solve the phylogenetic problem of Cinnamomum [16]. Therefore, for the species identification of different taxa, effective barcoding and their combination schemes, which can be used as supplementary markers for DNA barcoding, must be developed.

psbA-trnH and trnC-petN are chloroplast intergenic spacer sequences that are neither restricted by function nor affected by selection. Moreover, these two loci for the species level exhibited considerable genetic variability and divergence, ease of amplification, short sequence length, conserved flanking sites for developing universal primers, and ease of alignment and species relationship analysis [17]. Literature reported that psbA-trnH had successfully identified aquatic freshwater plants and the authenticity of herbal medicines accurately and effectively [18,19]. Niu sequenced psbA-trnH and 8 other chloroplast loci of 16 individuals of Triplostegia that represented the entire distribution range of both species recognized [20]. Similarly, trnC-petN showed high identification potential in Triticum plants [21], and Liu revealed the phylogenetic relationships and biogeographic diversification history of Cissus, which used trnH-psbA and trnC-petN markers [22].

The genus Syringa (family Oleaceae) are mainly distributed in southeast Europe, Japan, China, Afghanistan and North Korea. Approximately 27 wild species of the genus Syringa have been described, and most of which are native to China [23]. However, disputes about the infrageneric classification and relationships of the genus Syringa exist, and a comprehensive taxonomic system has not yet been established. The classification standard proposed by Zhang and Qiu that divided the genus Syringa into 2 sections and 4 series, including section Syringa and section Ligustrina is generally accepted. The section Syringa can be divided into series Syringa, series Pinnatifoliae, series Pubescentes, and series Villosae [24]. At present, some new varieties of the genus Syringa are constantly appearing in the market, but the classification standards are different, and the genetic relationship is uncertain. For example, on the question of species or subspecies of S. wolfii, it was classified as species in Flora Reipublicae Popularis Sinicae [24], but Chen pointed out that S. wolfii should be a subspecies of S. villosa [25]. In addition, no reports on the genetic relationship of S. ‘Si Ji Lan’, S. ‘Zhan Mu Shi’, and S. ‘Xiang Ya Duan’ are presented. Thus, solving these problems through morphological classification is challenging. Therefore, the main objective of this paper is to select gene fragments with multiple mutation loci according to the chloroplast genome sequence of the genus Syringa, identify various species of the genus Syringa by using sequence-specific markers, and develop DNA barcodes.

Materials and methods

Sample collection and DNA extraction

A total of 33 samples of the genus Syringa and 2 outgroup genera (Table 1) were collected from the garden nursery of Hebei Agricultural University and Beijing Botanical Garden in April–May 2021. The fresh leaves of the plant were placed in −80°C fridge. The genomic DNA was extracted from leaves by using PlantGen DNA Kit (CWBIO). The quantification and purity of the extracted DNA were measured using NanoDrop 2000 (Thermo Scientific) and 1.2% agarose gel electrophoresis.

Table 1

Information of the plant materials.

No.	Taxonomic group	Species	Source	No.	Taxonomic group	Species	Source
1	Series Syringa	S. vulgaris ‘Macroflora’	BeiJing	18	SeriesVillosae	S. villosa	BaoDing
2		S. vulgaris ‘Alba Plena’	BeiJing	19		S. josikaea	BeiJing
3		S. × chinensis	BeiJing	20		S. emodi	BeiJing
4		S. × chinensis ‘Saugeana’	BaoDing	21		S. ‘Zhan Mu Shi’	BaoDing
5		S. oblata var. affinis	BaoDing	22	SeriesPubescentes	S. pubescens subsp. patula	BeiJing
6		S. oblata	BaoDing	23		S. pubescens subsp. microphylla	BaoDing
7		S. oblata ‘Ziyun’	BaoDing	24		S. pubescens subsp. microphylla ‘Superba’	BeiJing
8		S. oblata subsp. dilatata	BaoDing	25		S. microphylla ‘Superba’	BaoDing
9		S. × hyacinthiflora ‘Luo Lan Zi’	BaoDing	26		S. meyeri	BeiJing
10		S. × hyacinthiflora ‘Asessippi’	BaoDing	27		S. meyeri ‘Palibin’	BaoDing
11		S. × hyacinthiflora ‘Blanche Sweet’	BaoDing	28		S. ‘Si Ji Lan’	BaoDing
12		S. × hyacinthiflora ‘Mount Baker’	BaoDing	29	Section Ligustrina	S. reticulata subsp. pekinensis	BeiJing
13	Series Villosae	S. × prestoniae ‘James Macfarlane’	BaoDing	30		S. ‘Jinyuan’	BeiJing
14		S. × prestoniae ‘Minuet’	BaoDing	31		S. reticulata subsp. amurensis	BaoDing
15		S. tomentella	BeiJing	32		S. reticulata	BeiJing
16		S. wolfii	BeiJing	33		S. ‘Xiang Ya Duan’	BaoDing
17		S. sweginzowii	BeiJing	34	Outgroup	Forsythia suspensa	BaoDing
				35		Ligustrum lucidum	BaoDing

PCR amplification

Based on the complete chloroplast genomes of five species of the genus Syringa in NCBI, intergenic spacer or intron regions with high variation were selected, and all the primers were designed by Primer primer 5.0 (Table 2). High-quality template DNA was used for PCR amplification (T100TM Thermal Cycler, BioRad). PCR reaction for psbA-trnH and trnC-petN was carried out in a total volume of 50 μL that contains 2 μL genomic DNA template, 3 μL of each primer, 25 μL 2 × Taq PCR MasterMix, 17 μL double distilled deionized water. The reaction conditions were initial denaturation at 94°C for 2 min, subsequently 32 cycles starting with 94°C denaturation for 30 s, annealing for 30 s, followed with a final extension at 72°C for 45 s, followed by 72°C for 8 min. The PCR products were detected by 1.2% agarose gel electrophoresis, and the bidirectional sequencing was completed by BGI (Beijing BGI Company).

Table 2

PCR primer information.

Gen Bank	Accession no.	Region	Primer sequence (5’→3’)	Tm/°C	PCR products size/bp
Syringa wolfii	NC049090	psbA-trnH	F: GTTATGCATGAACGTAATGCTC	56	336–518
Syringa vulgaris voucher G. Besnard	NC036987		R: CGCGCATGGTGGATTCACAATCC
Syringa yunnanensis voucher	NC042468	trnC-petN	F: TTTTTCCCCAGTTCAAATCCG	54	778–804
Syringa pinnatifolia	MG917095		R: GACTACCATTAAAGCAGCCCA
Syringa persica cv. Laciniata	NC042280

Data analysis

The sequencing results were aligned and spliced by using SeqMan software (DNAStar). The sequence data were further utilized to analyze the AT and GC contents and SNPs for each species using BioEdit. The software MEGA X was used to compare the obtained sequences and analyze the loci of variation. Average interspecific and intraspecific distances were calculated by using a Kimura 2-parameter (K2P) distance model. A neighbor-joining (NJ) phylogenetic tree on the sequences was performed using the software MEGA X with 1000 bootstrap replications to check the support rate of each fulcrum. In addition, data were also used to develop DNA barcodes for each species by using online DNA Barcode Generator (QR barcode) software (http://biorad-ads.com/DNABarcodeWeb/), and the psbA-trnH and trnC-petN sequences of the genus Syringa were transformed into two-dimensional images using the QR barcode approach (https://www.the-qrcode-generator.com).

Results

Sequence characteristics

The specific DNA fragments of all tested species of the genus Syringa were successfully amplified by using psbA-trnH and trnC-petN primers, the lengths of the amplified products were in the ranges of 336–518 bp and 778–804 bp, and the average lengths were 465 bp and 785 bp (Fig 1). Similarly, DNA sequencing also suggested that psbA-trnH and trnC-petN generated high-quality amplicons. psbA-trnH and trnC-petN achieved amplifying and sequencing efficiencies of 100%. In the amplicons of psbA-trnH, the average nucleotide composition of AT and GC for species of the genus Syringa was 71.28% and 28.72%, respectively. In trnC-petN, the average AT and GC were 61.76% and 38.16%, respectively. Moreover, all the sequences of amplicons were aligned with those sequences published on NCBI. The consistency of psbA-trnH was 81.45%–84.81%, and that of trnC-petN was 96.67%– 97.23%.

Fig 1

PCR amplified products using psbA-trnH (left) and trnC-petN (right) primers.

Genetic distance between interspecific and intraspecific

The interspecific and intraspecific genetic distances of all samples were calculated by MEGA X software, and the results were shown in Fig 2. For psbA-trnH, the maximum and mean of K2P genetic distance in tested species of the genus Syringa were calculated as 0.1359 and 0.0521±0.0013, respectively. Similarly, for trnC-petN, the maximum and means of K2P genetic distance in the tested species were 0.0438 and 0.0171±0.0005, respectively. The distance of the psbA-trnH marker has been increased because it is considered a high potential barcoding region for the systematic study in plant evolution.

Fig 2

Analysis of interspecific and intraspecific distance of the genus Syringa based on psbA-trnH (lower left) and trnC-petN (upper right).

Analysis of variant sites and barcodes

The results showed 91 variable sites (V), 73 parsimony-informative sites (Pi), 18 singleton sites (S) in psbA-trnH, and 45 variable sites (V), 41 parsimony-informative sites (Pi), and 4 singleton sites (S) in trnC-petN (S1 Table).

Unique barcodes with psbA-trnH 508 bp and trnC-petN 182 bp and 330 bp were highly conserved in series Syringa. Other species in the series Syringa had their own unique barcodes, except for sharing one barcode of S. × hyacinthiflora ‘Asessippi’, S. × hyacinthiflora ‘Blanche Sweet’, and S. × hyacinthiflora ‘Mount Baker’.

Series Villosa generated a highly conserved unique barcode in psbA-trnH 424 bp. S. josikaea, S. × prestoniae ‘James Macfarlane’ and S. × prestoniae ‘Minuet’ shared a single set of barcodes, whereas all others had shown characteristic barcode.

Series Pubescentes was identified by the absence of the barcode at psbA-trnH 162, 165, 166, 170–172, 176, 178, 182, 189, 231, 236, 260, 263, 272, 277, 286, 304, and 319 bp. Meanwhile, the presence of the highly conserved barcode in trnC-petN 381, 403, 431, 570 bp. S. meyeri shared barcodes with S. meyeri ‘Palibin’. The others had unique DNA barcodes.

The highly conserved barcodes that identify section Ligustrina were psbA-trnH 172 bp and trnC-petN 401, 495, 497–499, 503, 505, 507, 511–513, 514, 535, and 802 bp. Each species of section Ligustrina had unique SNPs.

Phylogenetic analysis for the psbA-trnH and trnC-petN

Phylogenetic tree based on psbA-trnH showed that S. × chinensis and S. × chinensis ‘Saugeana’, which belongs to series Syringa, was clustered inside the series Villosae, and the success rate of identification was 75% (Fig 3). However, in trnC-petN, a crossover between series Villosae (S. tomentella) and series Pubescentes was observed, and the identification success rate was 62.5% (Fig 4). The results showed that the two markers used alone could not distinguish all samples of the genus Syringa. Therefore, the phylogenetic tree was established by the two marker combinations. Meanwhile, series Syringa, series Villosa, series Pubescentes, and section Ligustrina formed independent branches, and the success rate of identification was 87.5% (Fig 5). Phylogenetic tree based on psbA-trnH and trnC-petN indicated that the 33 samples of the genus Syringa were divided into four groups: Group I is series Syringa represented by S. oblata; Group II is series Villosae represented by S. villosa; Group III is series Pubescentes represented by S.meyeri; and Group IV is section Ligustrina represented by S.reticulata subsp. pekinensis. The DNA barcodes of species of the genus Syringa were established using psbA-trnH+trnC-petN variable sites. The combination of two barcodes can distinguish the genus Syringa, and species of the genus Syringa information was captured by scanning the QR code image using a mobile terminal. Fig 6 only showed the QR code information of four representative the genus Syringa group based on psbA-trnH+trnC-petN sequence. The results showed that the combination of the barcodes psbA-trnH and trnC-petN were sufficient for classifying Syringa species.

Fig 3

Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of psbA-trnH intergenic spacers.

Fig 4

Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of trnC-petN intergenic spacers.

Fig 5

Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of psbA-trnH and trnC-petN intergenic spacers.

Fig 6

Four species of the genus Syringa morphology, DNA barcoding, and two-dimensional DNA barcoding image of psbA-trnH and trnC-petN sequences.

(A) S. oblata; (B) S. villosa; (C) S. meyeri; (D) S. reticulata subsp. pekinensis. In the center-colored DNA image, the different colors represent various nucleotides (A T C G) and the numbers represent the lengths of the sequences that can be used in obtaining clear sequence information.

Discussion

Traditional morphological markers are greatly influenced by environmental factors, as well as the developmental stages of the plant. These markers failed to effectively distinguish some morphologically consistent species, which consist of S. reticulata subsp. pekinensis and S. reticulata. However, molecular markers had been extensively employed in species classification and identification because of their abundance and high polymorphism. Specifically, AFLP, SSR, ISSR, and other polymorphisms are identified by complying with changes in DNA length [26-28]. As indicated from the previous study of the authors, ISSR molecular markers were adopted to identify plants of the genus Syringa [29]. According to the results, gene exchange was reported between series Pubescentes and series Villosae, which was consistent with the results in Gao who used the germplasm characterization of different plants of the genus Syringa by applying AFLP markers [30]. Thus, neither of the two markers could accurately distinguish the two groups. As the sequencing technology had been leaping forward, the method of exploiting DNA sequence was recognized to be reliable and accurate in identifying species. DNA barcoding can accurately identify species by marking the sequence variation site. In this study, the built chloroplast DNA barcodes could identify 33 samples of the genus Syringa accurately.

To establish the DNA barcode suitable for the identification of the plants of the genus Syringa, the complete chloroplast genomes of five species of the genus Syringa were first found on the NCBI. Then, sequence alignment was performed to screen the DNA fragments suitable for the barcode. Eventually, eight fragments with larger variations were determined as DNA barcode candidates. From the experience of other scholars, this study was carried out sequentially from the fragments with large variability [3,12], and psbA-trnH and trnC-petN had high and reliable identification abilities for the genus Syringa. The success rate of amplification and sequencing of psbA-trnH and trnC-petN fragment was 100%, and the identification rate of two marker combinations was 87.5%. The PCR amplification and sequencing success rates for psbA-trnH in 122 plant samples of Apocynaceae were 100% and 61%, and the identification efficiency at the species level is 82% [31]. A study used trnC-petN and other markers to construct the relationships and biogeographic diversification history of Cissus [22]. psbA-trnH and trnC-petN fragments can be used as DNA barcode options.

PCR amplification and sequencing results showed that psbA-trnH spans a large gene length (336–518 bp) because of the role of insertions/deletions in the evolution of the intergenic region in psbA-trnH, even among sister species [32]. As a result, the fragment length varied greatly among different plants. In this study, the psbA-trnH DNA length of series Pubescentes was significantly lower than those of other species. The length of trnC-petN ranged from 778 bp to 804 bp, and the number of S. reticulata and S. ‘Xiang Ya Duan’ was 803 bp, which was significantly higher than the 778 bp of S. reticulata subsp. pekinensis and S. reticulata subsp. amurensis. The results also indicated that the degree of base variation was positively correlated with the distance of genetic relationship between species.

In this study, 33 samples were divided into four groups, namely, series Syringa, series Villosae, series Pubescentes, and section Ligustrina. In traditional morphological markers, section was divided according to the length of the corolla tube. Generally, the genus Syringa could be divided into two types: section Syringa and section Ligustrina [24]. However, differences were not observed in section at the chloroplast genome level. This finding was consistent with our results using ISSR molecular markers to examine the relationships of the genus Syringa [29]. This finding may be due to the weak linkage among these sequences or the molecular markers and corolla tube length traits used in the experiment. Yang conducted a correlation analysis between SSR markers and corolla traits and discovered that SO649 markers were linked to the length of the corolla tube. The transcriptome sequence of the SO649 marker was annotated as E3 ubiquitin-protein ligase, which was a B3 domain-containing protein. The B3 domain-containing protein is essential for stress responses and plant growth and development [23]. Therefore, the corolla tube length related genes were assumed to be located in the nuclear genome rather than in the chloroplast intergenic spacers. The anthers of S. emodii are longer than the corolla tube, which is consistent with the morphological classification of the section Ligustrina [33]. The results of Ki-Joong and Robert’s cpDNA tree analysis revealed that S. emodii clustered in the series Villosae but not in the section Ligustrina [33], indicating a weak association between the corolla tube length and the chloroplast genes. In addition, the IPlant (http://www.IPlant.cn) and Chen proposed that S. wolfii was a subspecies of S. villosa [25]. In this study, S. wolfii was closely related to S. villosa, forming sister relationship. S. wolfii was identified as an independent species in the Flora Reipublicae Popularis Sinicae [24], and our study supported their view. Furthermore, the three unknown genetic relationship species were successfully identified by using psbA-trnH and trnC-petN fragments. The S. ‘Si Ji Lan’ was closely related to S. meyeri, the S. ‘Zhan Mu Shi’ was closely associated with S. josikaea, and the S. ‘Xiang Ya Duan’ was near S. reticulata. These two chloroplast genomic primers may provide sufficient molecular data for identifying closely related Syringa species.

The current study tested the effectiveness of these two fragments and their combination markers using a large number of experimental samples, and the identification efficiency of the combination markers below the species level was 85%. The result had shown that the chloroplast fragments psbA-trnH and trnC-petN could be used as identification barcodes of Syringa plants. Moreover, we developed QR codes based on the DNA sequence and established characteristic barcodes for each species.

Barcode of selected species of the genus Syringa based on variable regions of psbA-trnH and trnC-petN markers.

(PDF)

Click here for additional data file.

(PDF)

Click here for additional data file.

19 May 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Branislav T. Šiler, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. Thank you for stating the following financial disclosure:

This work was supported by the Key R & D projects of Hebei Province, China (No.19226367D).

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. Thank you for stating the following in the Acknowledgments Section of your manuscript:

This work was supported by the Key R & D projects of Hebei Province, China (No.19226367D). The authors would like to thank Dr. Mengxin for her assistance.

Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

This work was supported by the Key R & D projects of Hebei Province, China (No.19226367D).

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Additional Editor Comments:

The first impression is that it was written in a rather casual manner, i.e., it is abundant in typos and wrong punctuation, line and page numbers are lacking, vernacular phrases and vague sentences are met (e.g., second paragraph of Introduction: ", Niu et al. (2018)", "which used", the sentence that begins with "We obtained..." and the next sentence - are these the results of this study? If yes, they cannot stand in Introduction; if previously published, then citation should be provided); third paragraph: "The Syringa...plants" - vernacular expression; "...and other places" - scientifically unacceptable - please specify them; "Approximately 27 wild species of Syringa" - are there any non-wild species? Moreover, "of Syringa" is a colloquial expression - please write "species of the genus Syringa". What are "Sect and "Ser"? Are they "section" and "series"? Why they stand capitalized? Why is one italicized and other not? Please see e.g., https://www.newworldencyclopedia.org/entry/Taxon for proper writing. What is "Sort" in Table 1? What is the meaning of "inter- and intra- distance of Syringa" in the Fig.2 caption? Please also note that markers stated in the captions for Fig.3, Fig.4, and Fig.5 are not genetic markers but intergenic spacers. A meticulous editing by a native English speaker or a professional editing agency must be performed.

Regarding the results of the study and discussion upon them, the term "phylogenetic" should be avoided in this study since no dendrogram has been rooted. Please rectify the Discussion section in this sense.

Table 3 cannot stand in the main text, since being intermittent and too large. Please submit it as a supplementary material and rectify its referencing in the text.

Figures must be submitted as separate files in proper extensions and resolution. You may find more at https://journals.plos.org/plosone/s/figures. Please consult the PACE tool for checking those parameters.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper evaluates the effectiveness of two well-known DNA sequence fragments at identifying plant specimens of the genus Syringa, and thus at their potential broader use as DNA barcodes within this taxon. The study is straightforward, although I am somewhat bothered by the fact that most taxa used therein are hybrids and cultivars.

While I am not familiar with the development of DNA barcodes, I found that part of the paper to be sound. However, I find it unsatisfactory to include "phylogenetic analysis/relationship" without any outgroup, especially given the fact that Syringa is paraphyletic. It is different if the goal is to molecularly characterize groups previously recognized with morphological characters (e.g., the sections), which was met with the barcode development.

The discussion about weak linkage or molecular markers and corolla tube should be further clarified and references should be added to that sentence.

With regards to format, the paper needs to be checked thoroughly, including tables and figures, for inconsistencies. For instance, subspecies should not be capitalized; names and words should be written correctly (e.g., "oblata" vs. "oblate"; "Syringa" vs. "Syring"; "section" vs. "Sect"); spaces should be added between words and after punctuations.

The paper can also benefit from further editing to improve the English language and to remove some awkwardness throughout the text. For instance, in the Introduction, "disputes about the under the genus classification and interspecific relationships …", why not just say "the infrageneric classification and relationships".

I deplore the lack of page and line numbers, which makes it more difficult to point to deficiencies accurately.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

22 Jun 2022

Dear Dr. Branislav T. Šiler:

Thank you very much for giving us an opportunity to revise our manuscript. We appreciate the editor and reviewers very much for their constructive comments and suggestions on our manuscript entitled “Identification and phylogenetic analysis of Syringa based on chloroplast genomic DNA barcoding” (ID: PONE-D-22-01886).

We have studied reviewers’ comments carefully. According to the reviewers’ detailed suggestions, we have made a careful revision on the original manuscript. All revised portions are marked in red in the “Revised Manuscript with Track Changes” which we would like to submit for your kind consideration.

Kind regards.

Ruihong Yao

E-mail: 337514209@qq.com

Corresponding author : Baosheng Shi

E-mail address: baoshengshi@hebau.edu.cn

Dear Dr. Branislav T. Šiler and reviewers:

Thank you for your letter and the reviewers’ comments on our manuscript entitled “Identification and phylogenetic analysis of Syringa based on chloroplast genomic DNA barcoding” (ID: PONE-D-22-01886). Those comments are very helpful for revising and improving our paper, as well as the important guiding significance to other research. We have studied the comments carefully and made corrections which we hope meet with approval. The main corrections are in the manuscript and the responds to the reviewers’ comments are as follows (the replies are highlighted in blue ).

Replies to the Editor Comments:

1.The first impression is that it was written in a rather casual manner, i.e., it is abundant in typos and wrong punctuation, line and page numbers are lacking, vernacular phrases and vague sentences are met (e.g., second paragraph of Introduction: “, Niu et al. (2018)”, “which used”, the sentence that begins with “We obtained...” and the next sentence - are these the results of this study? If yes, they cannot stand in Introduction; if previously published, then citation should be provided).

Response: We’d like to extend our apology for the trouble brought to you. We have checked the problem of format throughout the manuscript carefully, and made correction one by one. As for the format of citation in the reference, We will cite it again and add references to the citations. For instance, behind the “Niu et al. (2018)” in the Lines 80-82, I cited the 20th reference; behind “which used” in the Lines 84-85, I cited the 22th reference; “We obtained...” in the original paper is the content about the experiment in this chapter, and I have deleted it from the citation.

third paragraph: “The Syringa...plants” - vernacular expression; “...and other places” - scientifically unacceptable - please specify them; “Approximately 27 wild species of Syringa” - are there any non-wild species? Moreover, “of Syringa” is a colloquial expression - please write “species of the genus Syringa”.

Response: The words “The Syringa... plants” in the Line 86 of the third paragraph have been changed to “The genus Syringa...”. “... and other places” in Line 87 have been changed to “Afghanistan and North Korea”; “... wild species” in Line 87 referred to the words falling within the scope of description in the 23th reference, in which non-wild species refer to hybrids and cultivars. Every “of Syringa” in the paper has been changed to “species of the genus Syringa”.

What are “Sect” and “Ser”? Are they “section” and “series”? Why they stand capitalized? Why is one italicized and other not? Please see e.g., https://www.newworldencyclopedia.org/entry/Taxon for proper writing. What is “Sort” in Table 1?

Response: We would like to extend my gratitude to you for the website https://www.newworldencyclopedia.org/entry/Taxon offered. “Sect.” and “Ser.” refer to the abbreviation of “section” and “series” in this paper, and I have changed all the “Sect.” and “Ser.” to “section” and “series” in this paper. With regard to the problems about capital and small letters of the initial character and italics, I referred to A reference. The ways of writing are “section Syringa”, “section Ligustrina”, “series Pinnatifoliae”, and “series Pubescentes”. The word “Sort” in Table 1 under the Line 115 refers to the classification of “section” and “series”. It’s the problem related to our statement, and we have changed “Sort” to “Taxonomic group”.

(A). Li J, Zhang AD. Paraphyletic Syringa (Oleaceae): Evidence from Sequences of Nuclear Ribosomal DNA ITS and ETS Regions. Systematic Botany. 2002; 27(3): 592-597.

What is the meaning of “inter- and intra- distance of Syringa” in the Fig.2 caption? Please also note that markers stated in the captions for Fig.3, Fig.4, and Fig.5 are not genetic markers but intergenic spacers. A meticulous editing by a native English speaker or a professional editing agency must be performed.

Response: The phrase “Inter- and intra-distance of Syringa” in Line 172 in Fig.2 represents “interspecific and intraspecific distance of Syringa”, and the phrase has been changed to the complete spelling. The phrase “genetic markers” in Lines 219-226 in the Fig.3, Fig.4, and Fig.5 have been changed to “intergenic spacers”. We have polished the paper, and the proof is in the figure as follows.

2. Regarding the results of the study and discussion upon them, the term “phylogenetic” should be avoided in this study since no dendrogram has been rooted. Please rectify the Discussion section in this sense.

Response: I’d like to extend my deep gratitude to you for pointing out the problems, because the problems pointed out by you indeed help perfect this paper. In the discussion, I have modified the use of the word “phylogenetic”. We have changed “phylogenetic relationships” in Line 266 in the second paragraph to “relationships”; We have changed the sentence “These two chloroplast genomic primers can be used to identify and clarify the phylogenetic relationships between the species and varieties of Syringa” in Lines 306-307 of the fourth paragraph to “These two chloroplast genomic primers may provide sufficient molecular data for identifying closely related Syringa species”.

3. Table 3 cannot stand in the main text, since being intermittent and too large. Please submit it as a supplementary material and rectify its referencing in the text.

Response: We have submitted Table 3 again as S1 Table, and have corrected its citation in the main body (Line 178).

4. Figures must be submitted as separate files in proper extensions and resolution. You may find more at https://journals.plos.org/plosone/s/figures. Please consult the PACE tool for checking those parameters.

Response: I’d like to extend my deep gratitude to you for the tools offered by you, and we have checked the figure again using the software PACE. We have submitted again and please check it.

Replies to the Reviewers’ Comments:

Reviewer #1:

1. The paper evaluates the effectiveness of two well-known DNA sequence fragments at identifying plant specimens of the genus Syringa, and thus at their potential broader use as DNA barcodes within this taxon. The study is straightforward, although I am somewhat bothered by the fact that most taxa used therein are hybrids and cultivars.

Response: We’d like to convey our apology to you for the confusion brought to you. The establishment of phylogenetic relationship based on the informative sites of chloroplast genome sequence has been widely applied, which deals with the relationships among different orders, families, genera and even subspecies of angiosperm. For instance, the scholar established the phylogenetic tree by selecting 22 grape varieties in B reference.

But the varieties of cultivars, and its hybrids are high in number, with complicated genetic relationship. If they can be identified using DNA barcodes, the value of DNA barcodes can be better interpreted. For instance, the author studied the phylogenetic relationships and genomic compatibility were compared for 60 accessions of Syringa using chloroplast DNA (cpDNA) and nuclear ribosomal DNA (rDNA) markers in C reference. The plant material for this article includes Syringa cultivars and hybrids. The author studied the phylogenetic relationship between quinoa of different varieties in D reference. The author studied the phylogenetic relationship of peony using DNA barcodes in E reference. The research materials included 40 species, subspecies taxa or varieties of peony.

(B). Yang YM. A Phylogenetic Study of Vitis Based on Chloroplast Genomes. M.Ag. Thesis, Chinese Academy of Agricultural Sciences. 2019.

(C). Ki JK, Jansen RK. A chloroplast DNA phylogeny of lilacs (Syringa, Oleaceae): plastome groups show a strong correlation with crossing groups. American Journal of Botany. 1998; 85.

(D). Gao ZM. Complete chloroplast genomes of Chenopodium quinoa strains and phylogenetic relationship. M.Ag. Thesis, Shanxi University. 2021.

(E). Zhang JM, Wang JX, Xia T, et al. Application of DNA barcoding based on phylogenetic analysis in clarifying species problems of Paeonia. Scientia Sinica(Vitae). 2008; 38(12): 11.

2. While I am not familiar with the development of DNA barcodes, I found that part of the paper to be sound. However, I find it unsatisfactory to include “phylogenetic analysis/relationship” without any outgroup, especially given the fact that Syringa is paraphyletic. It is different if the goal is to molecularly characterize groups previously recognized with morphological characters (e.g., the sections), which was met with the barcode development.

Response: I’d like to extend my deep gratitude to you for your suggestions, which allows this paper to be more perfect. Concerning the problem of outgroup, we have selected Forsythia suspensa and Ligustrum lucidum as outgroups, and conducted cluster analysis again, as shown in the figure as follows.

Fig 3. Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of psbA-trnH intergenic spacers.

Fig 4. Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of trnC-petN intergenic spacers.

Fig 5. Phylogenetic relationship among different species of the genus Syringa differentiated on the basis of psbA-trnH and trnC-petN intergenic spacers.

DNA barcoding has obvious advantage in the phylogenetic relationships of different varieties, as well as the determination of the relationship between different species and the homology of molecular characters. At the same time, it is applied in the species identification, molecular geography and research on the origin of species. Later, many scholars developed DNA barcoding for the identification of genetic relationships. For instance, nine endangered endemic plant species in SKP were selected to test the variable abilities of three different DNA barcodes by the authors, and it was found that the barcode sequences were efficient in finding the genetic relationships between the nine species in F reference.

(F). Amh A, Aa B, Fma C, et al. Phylogenetic Relationships and DNA Barcoding of Nine Endangered Medicinal Plant Species Endemic to Saint Katherine Protectorate. Saudi Journal of Biological Sciences. 2021; 28: 1919-1930.

3. The discussion about weak linkage or molecular markers and corolla tube should be further clarified and references should be added to that sentence.

Response: (Lines 285-299) Thanks for your advice very much. The length of the corolla tube was used to split sections in traditional morphological markers. In general, the genus Syringa can be separated into two sections: Syringa and Ligustrina [24]. At the chloroplast genome level, however, no changes were found in sections. This outcome was in line with our findings from a study of Syringa genus connections using ISSR genetic markers [29]. Yang conducted a correlation analysis between SSR markers and corolla traits and discovered that SO649 markers were linked to the length of the corolla tube. The transcriptome sequence of the SO649 marker was annotated as E3 ubiquitin-protein ligase, which was a B3 domain-containing protein. The B3 domain-containing protein is essential for stress responses and plant growth and development [23]. Therefore, the corolla tube length related genes were assumed to be located in the nuclear genome rather than in the chloroplast intergenic spacers. The anthers of S. emodii are longer than the corolla tube, which is consistent with the morphological classification of the section Ligustrina [33]. The results of Ki-Joong and Robert's cpDNA tree analysis revealed that S. emodii clustered in the series Villosae but not in the section Ligustrina [33], indicating a weak association between the corolla tube length and the chloroplast genes. All in all, this finding may be due to the weak linkage among these sequences or the molecular markers and corolla tube length traits used in the experiment.

4. With regards to format, the paper needs to be checked thoroughly, including tables and figures, for inconsistencies. For instance, subspecies should not be capitalized; names and words should be written correctly (e.g., “oblata” vs. “oblate”; “Syringa” vs. “Syring”; “section” vs. “Sect”); spaces should be added between words and after punctuations.

Response: We’d like to express our apology to you for the trouble brought to you. We have checked the problems in the format of this paper, and have corrected the writing of Latin names in the manuscript, tables and figures. We have changed the “oblate” in the table and figures to “oblata”, changed “Syring” in Line 282 to “Syringa”, changed the word “Sect.” to “Section” in the entire paper and changed “Ser.” to “Series”. Regarding the problems about capital and small letters of the initial character and italics, I wrote them according to the A reference. The ways of writing are “section Syringa”, “section Ligustrina”, “series Pinnatifoliae”, and “series Pubescentes”.

(A). Li J, Zhang A D. Paraphyletic Syringa (Oleaceae): Evidence from Sequences of Nuclear Ribosomal DNA ITS and ETS Regions. Systematic Botany. 2002; 27(3): 592-597.

5. The paper can also benefit from further editing to improve the English language and to remove some awkwardness throughout the text. For instance, in the Introduction, “disputes about the under the genus classification and interspecific relationships …”, why not just say “the infrageneric classification and relationships”.

Response: We’d like to extend our apology to you for the trouble brought to you. As for the problem of English writing, we have turned to the institutions specialized in English polishing. The proof of polishing is shown in the figure as follows.

6. I deplore the lack of page and line numbers, which makes it more difficult to point to deficiencies accurately.

Response: We’d like to extend our apology to you for the trouble brought to you. Your workload increased due to my negligence. We have added line numbers in the newly submitted manuscript. I’d apologize again for not adding the line numbers.

Once again, thank you very much for your constructive comments and suggestions which would help us both in English and in depth to improve the quality of the paper.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

29 Jun 2022

3 Jul 2022

Dear Dr. Branislav T. Šiler:

Thank you very much for giving us an opportunity to revise our manuscript. We appreciate the editor and reviewers very much for their constructive comments and suggestions on our manuscript entitled “Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding” (ID: PONE-D-22-01886R1).

We have studied reviewers’ comments carefully. According to the reviewers’ detailed suggestions, we have made a careful revision on the original manuscript. All revised portions are marked in red in the “Revised Manuscript with Track Changes” which we would like to submit for your kind consideration.

Kind regards.

Ruihong Yao

E-mail: 337514209@qq.com

Corresponding author : Baosheng Shi

E-mail address: baoshengshi@hebau.edu.cn

Dear Dr. Branislav T. Šiler and reviewers:

Thank you for your letter and the reviewers’ comments on our manuscript entitled “Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding” (ID: PONE-D-22-01886R1). Those comments are very helpful for revising and improving our paper, as well as the important guiding significance to other research. We have studied the comments carefully and made corrections which we hope meet with approval. The main corrections are in the manuscript and the responds to the reviewers’ comments are as follows (the replies are highlighted in blue ).

Replies to the Editor Comments:

The authors have significantly improved the manuscript. Indeed, the term “genus” was placed in front of “Syringa” throughout the text but not in the main title. Please rectify this. Moreover, please remove the short title to avoid possible misunderstandings.

Response: I’d like to extend my deep gratitude to you for your suggestions. The words “... of Syringa based on...” in the main title have been changed to “... of the genus Syringa based on...”; “... of Syringa” in line 109 have been changed to “... of the genus Syringa”; The words “... of Syringa ...” in line 194 of the S1 Table title have been changed to “... of the genus Syringa ...”, and the title of S1 Table in supporting information has also been corrected accordingly. In addition, we have deleted the short title.

Replies to the Journal:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Response: Sincerely thanks for your kindly suggestions. We have reviewed the references and there are no retracted papers, and each paper can be searched by hyperlink. In terms of the reference format, we have updated as follows: Reference 14 on lines 370-373 has no page number and volume number (as shown in Fig 1); Reference 16 “Cinnamomum” on line 380 is updated to “Cinnamomum”; the volume issue of Reference 17 on line 385 is 12 (10); the page number of Reference 23 on line 410 is 436; Page numbers pp. 76-84 are supplemented to Reference 24 on lines 411-412, in addition, we have updated the English title of book from “Flora of China” to “Flora Reipublicae Popularis Sinicae”, as well as “Flora of China” on line 98 and line 302 to “Flora Reipublicae Popularis Sinicae”.

Fig 1

Once again, thank you very much for your constructive comments and suggestions which would help us both in English and in depth to improve the quality of the paper.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

6 Jul 2022

Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding

PONE-D-22-01886R2

Dear Dr. Shi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Branislav T. Šiler, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

11 Jul 2022

PONE-D-22-01886R2

Identification and phylogenetic analysis of the genus Syringa based on chloroplast genomic DNA barcoding

Dear Dr. Shi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Branislav T. Šiler

Academic Editor

PLOS ONE