Literature DB >> 35848691

Pro-apoptotic, anti-metastatic, and anti-telomerase activity of Tinospora cordifolia and its active polysaccharide arabinogalactan during Benzo(a)pyrene-induced lung carcinogenesis.

Vandana Mohan1, Koul Ashwani1.   

Abstract

BACKGROUND: The present study aims to unravel the pro-apoptotic, anti-metastatic, and anti-telomerase activity of aqueous extract of Tinospora cordifolia stem (Aq.Tc) and its active component arabinogalactan (AG) during Benzo(a)pyrene [B(a)P]-induced lung tumorigenesis in mice.
MATERIALS AND METHODS: Lung tumors were induced in male BALB/c mice using B(a)P as a carcinogen. Animals were administered twice with 50 mg/kg b.wt (i.p.) dosage of B(a)P at the 2nd and 4th week of the study. Mice were orally treated with Aq.Tc and AG on alternate days at a dose of 200 mg/kg b.wt and 7.5 mg/kg b.wt, respectively, for continuous 22 weeks.
RESULTS: Oral administration of animals with Aq.Tc and AG suppressed the development of lung carcinogenesis by modulating the mRNA and protein expressions of different apoptotic genes; bcl-2, bax, caspase 3, and caspase 9. The pro-apoptotic proficiency of Aq.Tc and AG was further confirmed by DNA agarose gel electrophoresis showing fragmentation in B(a)P + Aq.Tc group and smear formation in B(a)P + AG group. In contrast to the control group, an increase in tumor invasion factors such as matrix metalloproteinases-2 (MMP-2) and MMP-9 was also observed in B(a)P treated animals. Nevertheless, Aq.Tc and AG treatment effectively mitigated the B(a)P-induced upregulation of MMP-2 and MMP-9. The activity of the telomerase enzyme was also observed to be upregulated in B(a)P treated animals which consecutively found to get normalized with the parallel administration of Aq.Tc and AG.
CONCLUSION: Aq.Tc and AG successfully mitigated the altered expression of apoptosis, metastasis, and telomerase activity-associated genes during pulmonary carcinogenesis.

Entities:  

Keywords:  Apoptosis; Tinospora cordifolia; lung cancer; metastasis; telomerase

Mesh:

Substances:

Year:  2022        PMID: 35848691      PMCID: PMC9396687          DOI: 10.4103/ijp.ijp_962_20

Source DB:  PubMed          Journal:  Indian J Pharmacol        ISSN: 0253-7613            Impact factor:   2.833


Introduction

Lung carcinogenesis is the most frequently occurring cancer globally. Out of all lung carcinomas, non-small cell lung cancer has been accounted for more than 80%.[1] Tobacco smoking is one of the major etiological and lifestyle-associated risk factor for the development of lung carcinogenesis. Polycyclic aromatic hydrocarbons such as benzo(a)pyrene [B(a)P] is a potent carcinogen present in the environment that plays a major role in lung carcinogenesis.[2] Carcinogenesis is a regulatory interplay between the tumor suppressor genes, oncogenes, and cell death pathways. Deregulation of apoptotic pathways may lead to carcinogenic transformations opening a way to cell dedifferentiation and metastasis. Therefore, the activation of apoptosis is generally considered a promising therapeutic approach in chemoprevention.[3] Other important hallmarks of cancer include replicative immortality and metastasis. Replicative immortality can be defined as an unlimited potential for cellular proliferation and may unanimously associate with the telomerase reactivation. Tumor cells are basically the artifacts of escaping crisis, an episode of normal cellular development and its subsequent fatality resulting into a lowered population of surviving cells.[4] Telomerase activation, a critical event in cellular immortality is considered one of the prime targets in cancer prevention and treatment. Plethora of reports is available in the literature demonstrating the inhibition of cancer cell line growth using different antitelomerase agents. These agents are likely to act by using the p53-independent apoptotic cell death scheme.[5] Nowadays, considerable attention has been focused on the remedial application of medicinal plants and their phytochemicals as one of the promising sources for new chemopreventive drugs. Surprisingly, the underlying molecular mechanisms for most of the putative chemopreventive agents are not fully understood. The fundamental mechanisms behind any chemoprevention include activation of apoptotic signaling cascades, inhibition of cell proliferation, inhibition of metastasis, etc. Previous studies demonstrated that certain chemopreventive agents can induce apoptosis in cancer cells (both in vivo and in vitro models), which may further dictate their efficacy to inhibit carcinogenesis.[6] Despite advances in cancer management, most cancer mortalities are due to tumor invasion/metastasis. Numerous reports have shown that metastasis accounts for approximately 90% of the total cancer deaths.[7] Metastasis entails the changes in the extracellular matrix and basement membrane components due to the strenuous action of proteinases, such as serine proteinases, matrix metalloproteinases (MMPs), etc. MMP-2 and MMP-9 belong to the zinc-binding endopeptidases family and are considered to play a crucial role in the progression of metastasis. On the basis of these functionalities, MMPs are also considered to be a prime target for the development of diverse chemopreventive agents.[8] A number of in vitro and in vivo studies showed herbal remedies to be an effective measure for the development of novel anti-cancer agents. Tinospora cordifolia (Guduchi or Amrita) classified under the family Menispermaceae has commonly been used in the ancient medicinal system for ages.[9] T. cordifolia is a well-documented remedy against throat malignancy in the diverse human population. Acute toxicity studies of T. cordifolia have marked it to be safe for human consumption, even at higher doses.[10] Furthermore, the senescence-inducing potential of T. cordifolia extract has also been reported for its anti-proliferative, pro-apoptotic, and anti-metastatic prospective against glioma cells.[11] Many of the pharmacological activities of this plant has been attributed to the polysaccharide (PS) fraction isolated from the stem of this plant. The search for the development of novel anticancer drugs also led to the detection of PS as one of the budding anticancer agents. Owing to their various pharmacological activities such as anticancer, immunomodulatory, and anti-inflammatory effects, PS isolated from varied natural sources such as plants, animals, fungi, etc., have gained considerable attention.[12] Arabinogalactan (AG), one such PS is present abundantly in the aqueous extract of T. cordifolia.[13] Preliminary work demonstrating the chemopreventive potential of AG during the initiation of lung carcinogenesis has earlier been carried out in our laboratory.[14] The chemopreventive efficacy of aqueous T. cordifolia as evident by various biomarkers has also been reported previously.[15] Therefore, the present study is extrapolating the earlier research, with an aim to explore the pro-apoptotic as well as the anti-metastatic potential of AG alongside T. cordifolia as a better chemopreventive agent against experimentally induced lung tumorigenesis.

Materials and Methods

Chemicals and kits used

Chemicals required for RNA isolation were of molecular biology grade, for example, chloroform, ethanol, isopropanol, and formaldehyde were purchased from Amresco, Ohio (USA). Hydrogen peroxide (H2O2), formamide, methanol, ammonium acetate, sucrose, 3,3’,5,5’-Tetramethylbenzidine, and AG were purchased from Merck Ltd., India. All other chemicals used were of analytical grade. Antibodies against caspase 3 (sc-7148), caspase 9 (sc-7885), bax (B 8429), and bcl-2 (sc-783) were purchased from Santa Cruz Biotechnology, Santa Cruz, CA (USA). Antibody against mouse β-actin and peroxidase-conjugated secondary antibody (A6154) were brought from Sigma (St Louis, MO, USA). One-step reverse transcription polymerase chain reaction (PCR) kit was purchased from Ampliqon (Biolmol GmbH, Hamburg, Germany) and Mouse TE Telomerase ELISA kit was obtained from Elab sciences (Elab Science Biotechnology Inc, Wuhan, Hubei).

Aqueous Tinospora cordifolia stem extract (Aq.Tc) preparation

The stems of T. cordifolia were collected from the Botanical Garden, Panjab University, Chandigarh and were got identified and authenticated from Prof. M.C. Sidhu, Department of Botany, Panjab University, Chandigarh, India. The aqueous extract was prepared as per the methodology described in the previous study.[15] Briefly, the collected stems were washed in sterile double distilled water and shade dried. The dried stems were finely grounded in a mixer and sieved to obtain a fine powder. 500 ml distilled water was added to 100 g of dried powder of Tc stem in a flask and mixed well. The mixture was briefly vortexed and the slurry thus obtained was filtered. The filtrate was centrifuged at 8000 x g to obtain a clear solution (supernatant). The solution was lyophilized to form a fine powder and stored in a dark container at 4°C for further use. Preliminary phytochemical characterization of the extract showed tannins, flavonoids, PS, carbohydrates and proteins to be present.[15] Also, the amount of AG was also determined in Aq.Tc using phenol sulphuric acid method (Data previously published). In our earlier study, the Aq.Tc and AG also showed a concentration-dependent free radical scavenging activity in an in vitro system.[15]

Animal model and experimental conditions

Male BALB/c mice weighing 25–30 g were obtained from the Central Animal House, Panjab University, Chandigarh (Approval no PU/IAEC/S/15/61). Animals were kept in rice husk bedded polypropylene cages under controlled temperature conditions with ad libitum food and water supply. The present study has been ethically approved by the Institutional Animal Ethics Committee. Mice were arbitrarily segregated into 6 groups (n = 8). Group I has been marked as control with no special treatment. Group II and III received an oral dosage of Aq.Tc (200 mg/kg b.wt) and AG (7.5 mg/kg b.wt) on alternating days for continuous 22 weeks. Group IV was administered twicely with 50 mg/kg b.wt (i.p.) dosage of B(a)P at the 2nd and 4th weeks of the study. Group V and VI animals were also supplemented with the aforementioned doses of Aq.Tc and AG for the continuous 22 weeks along with the additional administration of aforesaid B(a)P dosage at the 2nd and 4th weeks of the study. The body mass, diet, and water intake were noted on the weekly basis. Dose and route of varied treatments were finalized as per the previous published report.

Lung tumor analysis

To determine the type of tumor formed in lung tissue, hematoxylin and eosin staining was performed at the 22nd week of the study.

Primary transcript analysis

Mice lung tissues were excised at the 22nd week of the study. Total RNA obtained by using tri-reagent was further used for the expression analysis of different genes. β-actin has been used as an internal control. The sequence of different gene primers used for the current investigation is listed in Table 1.
Table 1

List of primer pairs used and their sequences

GeneStrandPrimer sequence (5’–3’)Temperature (°C)Reference/accession number
Caspase 3SenseAGTCAGTGGACTCTGGGATC60.7[16]
AntisenseGTACAGTTCTTTCGTGAGCA58.0
Caspase 9SenseTGCACTTCCTCTCAACGCAGGACC74.3BA00958237
AntisenseTCCAAGGTCTCCATGTACCAGGAGC71.9BA00958238
BaxSenseGGTTTCATCCAGGATCGAGACGG71.6BA00958239
AntisenseACAAAGATGGTCACGGTCTGCC69.4BA00958240
Bcl-2SenseAGAGGGGCTACGAGTGGGAT66.0[16]
AntisenseCTCAGTCATCCACAGGGCGA68.9
MMP-2SenseACCCTAGGGGATGCTTGGAT65.6BA00095637
AntisenseACGAGCGAAGGGCATACAAA66.7BA00095638
MMP-9SenseTTCACCGGCTAAACCACCTC66.1BA00095635
AntisenseTAACGCCCAGTAGAGAGCCT62.8BA00095636
β-actinSenseATCCGTAAAGACCTCTATGC57.3BA00327870
AntisenseAACGCAGCTCAGTAACAGTC59.7BA00327871

MMP: Matrix metalloproteinases

List of primer pairs used and their sequences MMP: Matrix metalloproteinases The annealing temperatures recorded for the different genes used were: Bcl-2 (62.45°C), Bax (65.5°C), Caspase 3 (54.33°C), Caspase 9 (68.1°C), MMP-2 (61.15°C), MMP-9 (59.45°C), and β-actin (53.5°C). The reaction mixture was primed as per the manufacturer's protocol and was further amplified using PCR machine (G-STORM, Akribis Scientific limited, UK). The amplicons so obtained were electrophoresed on 1.5% agarose gel. The gel pictures were then analyzed by using the software ImageJ (NIH, USA).

Protein expression analysis

To analyze the relative protein expression of apoptotic genes, cytoplasmic extract from pulmonary tissues after the 22nd week of carcinogenesis was tested by using ELISA method. Protein expression of caspase 3, caspase 9, Bcl-2, and Bax were measured as per the standardized protocols.[17] The resultant reaction product was measured at 405 nm by using an ELISA reader (Stat fax 325+, Awareness Technology Inc., USA).

DNA fragmentation

DNA fragmentation analysis was done by the method described by Grimberg et al. with some modifications.[18] After the complete course of the study, i.e., 22 weeks, lung tissues (70–80 mg) were homogenized in 400 μl TE buffer and vortexed. Then, 50 μl of 10% sodium dodecyl sulfate (SDS) was added and the mixture was again vortexed. Afterward, the mixture was left undisturbed at 56°C for the next 30 min. 150 μl of ammonium acetate was then added and vortexed. It was further incubated for 15 min at 37°C. Then, the centrifugation at 12,000 × g for the next 15 min was done. The supernatant so obtained was incubated with 30 μl of proteinase K at 55°C for the subsequent 1 h. The mixture was then again pelleted at 12,000 × g for 15 min and supernatant was separated. Now, 500 μl of 95% ethanol was added to the supernatant and again centrifuged at 12,000 × g. The pellet thus obtained was washed with 70% ethanol and was dissolved in 10 μl TE buffer. Purity of DNA was determined by Aratio= A260/A280 and an approximately ratio of 1.8 signifies pure DNA fraction. DNA Samples were electrophoresed at 70 V using 1.5% agarose gel. The separated bands thus obtained were visualised under ultraviolet transilluminator (BioRad system, USA).

Gelatin zymography

After 22nd week of the study, enzymatic activity of MMP-2 and MMP-9 in lung tissues was assessed by SDS-polyacrylamide gel electrophoresis gelatin zymography method. Tissue samples (75 μg) were denatured using sample buffer in 1:1 ratio. Samples were electrophoresed at 10 mA current through the stack gel and followed by 15 mA for the separating one. For subsequent renaturation, the gel was washed in Triton X-100 (2.5%) for the next 1 h at 37°C. The gel was then incubated overnight in a developing buffer at 37°C. Afterwards, the gel was stained with amido black solution for 1–2 h followed by destaining. As a result, clear white bands determining the gelatinolytic activity of proteins would become visible. The intensity of bands was analyzed with the software ImageJ (NIH, USA).

Telomerase activity

Quantitative estimation of telomerase was also done after 22nd week of the study by using double-antibody sandwich enzyme-linked immunosorbent one-step process assay according to the instructions provided by kit manufacturer (Mouse TE Telomerase, Elab science). Lung tissues were minced in PBS at 4°C to prepare a 10% homogenate. The homogenate was then centrifuged at 5000 × g for 5 min. The supernatant thus obtained was used to estimate the enzymic activity at 450 nm using multiwell plate ELISA reader.

Protein estimation

Lowry et al. method was used to determine the total Protein content of the different samples (cytoplasmic extract for apoptotic studies).[19]

Statistical analysis

Data was expressed as mean ± standard deviation (SD) and statistical significance was concluded with one-way ANOVA followed by least significant difference post hoc test. All the statistical measures were done by using software Statistical Package for Social Sciences (SPSS) (version 14) for windows (SPSS Inc., Illinois, USA). Values having P ≤ 0.05 were only considered significant.

Results

Lung tumor formation and histopathological evaluation

After 22nd week of B(a)P instillation to mice, lung tumors were evident in B(a)P, B(a)P + Aq.Tc and B(a)P + AG groups. However, the tumor number and incidences were found to be significantly higher in B(a)P group (tumor number 96, incidence 100%) when compared to B(a)P + Aq.Tc (53, 66.6%) and B(a)P + AG group (71, 83.3%) [Figure 1]. Histopathological observations revealed the presence of hyperchromatic nuclei with an extensive proliferation of alveolar epithelium. Furthermore, the analysis also showed the infiltration of higher amount of eosinophilic macrophages into the pulmonary parenchyma. These observations classically resembles to the histoarchitecture of lung adenocarcinoma. However, Aq.Tc and AG effectively facilitated to reduce the histopathological alterations inflicted by B(a)P.[15]
Figure 1

Gross morphological and histopathological changes in pulmonary tissue at 22nd week of the treatment regime (a) Control; (b and c) B(a)P group; RL: Right lung; LL: Left lung. Arrow indicates presence of tumors. sa: single squamous epithelium av: alveolar sacs sb: small bronchiole ad: alveolar destruction, ep: extensive proliferation of alveolar epithelium and presence of hyperchromatic nuclei in the alveolar wall; i: Inflammatory cellular infiltrations N; thinning of alveolar walls)

Gross morphological and histopathological changes in pulmonary tissue at 22nd week of the treatment regime (a) Control; (b and c) B(a)P group; RL: Right lung; LL: Left lung. Arrow indicates presence of tumors. sa: single squamous epithelium av: alveolar sacs sb: small bronchiole ad: alveolar destruction, ep: extensive proliferation of alveolar epithelium and presence of hyperchromatic nuclei in the alveolar wall; i: Inflammatory cellular infiltrations N; thinning of alveolar walls)

mRNA expression of apoptotic genes

Caspase 9

In comparison to control group, mRNA expression of caspase 9 was found to be significantly reduced in the B(a)P treated group (P ≤ 0.001). However, in contrast to the B(a)P group a noteworthy upregulation in the caspase 9 expression was observed in B(a)P + Aq.Tc and B(a)P + AG group (P ≤ 0.01) [Figure 2a and b].
Figure 2

mRNA expression of Apoptotic genes in various treatment groups. (a) RT-PCR gel showing mRNA expression. (b) caspase 9 graph, (c) bcl-2 graph, (d) bax graph, (e) Caspase 3 graph. Values expressed as: Mean ± SD (n= 4). Data analyzed using one-way ANOVA (post hoc test). a1: P ≤ 0.001; a2: P ≤ 0.01 significant to control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant to AG group, d1: P ≤ 0.001; d2: P ≤ 0.01 significant to B(a)P group. RT-PCR: Reverse transcription-polymerase chain reaction, SD: Standard deviation, AG: Arabinogalactan

mRNA expression of Apoptotic genes in various treatment groups. (a) RT-PCR gel showing mRNA expression. (b) caspase 9 graph, (c) bcl-2 graph, (d) bax graph, (e) Caspase 3 graph. Values expressed as: Mean ± SD (n= 4). Data analyzed using one-way ANOVA (post hoc test). a1: P ≤ 0.001; a2: P ≤ 0.01 significant to control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant to AG group, d1: P ≤ 0.001; d2: P ≤ 0.01 significant to B(a)P group. RT-PCR: Reverse transcription-polymerase chain reaction, SD: Standard deviation, AG: Arabinogalactan

Bcl-2

Densitometric analysis revealed a significant increase in the mRNA expression of Bcl-2 of B(a)P treated animals when compared with Aq.Tc, AG and control groups (P ≤ 0.01). Whereas in contrast to the B(a)P group, a noteworthy reduction in the mRNA expression was observed in B(a)P + Aq.Tc and B(a) P + AG group (P ≤ 0.001) [Figure 2c].

Bax

In B(a)P group, mRNA expression of Bax was also found to be significantly lesser in comparison to the Aq.Tc (P ≤ 0.01), AG (P ≤ 0.01) and control group (P ≤ 0.01) respectively. However, increase in the gene expression of Bax was observed with the co-treatment of Aq.Tc and AG when evaluated with B(a) P group (P ≤ 0.001) [Figure 2d].

Caspase 3

A significant decline in the expression of caspase 3 gene was observed in B(a)P treated animals when compared to control (P ≤ 0.001), Aq.Tc (P ≤ 0.001) and AG group (P ≤ 0.001) respectively. Whereas, Aq.Tc and AG co-supplementation resulted in a significant normalization of caspase 3 expression in B(a)P + Aq.Tc and B(a)P + AG group (P ≤ 0.001). [Figure 2e].

Assessment of protein expression of apoptosis associated genes

A significant decrease in caspase 9 protein expression was noted in B(a)P group when compared to Aq.Tc, AG and control groups (P ≤ 0.01) respectively. However, in comparison to B(a)P group, a considerable elevation in caspase 9 expression was seen in B(a)P + Aq.Tc (P ≤ 0.01) and B(a)P + AG treated groups (P ≤ 0.01) [Table 2].
Table 2

Effect of aqueous Tinospora cordifolia stem extract and Arabinogalactan on protein expression of apoptosis-associated genes during Benzo(a)pyrene-induced pulmonary carcinogenesis

A405 (nm)Caspase 3Caspase 9BaxBcl-2
Control0.753±0.0690.754±0.1210.743±0.0480.105±0.031
Aq.Tc0.773±0.1170.721±0.1280.738±0.0340.104±0.032
AG0.776±0.1350.713±0.0450.758±0.0740.109±0.028
B(a)P0.655±0.032a3, b3, c30.521±0.128a2, b2, c20.617±0.048a2, b2, c20.130±0.027a1, b1, c1
B(a)P+Aq.Tc0.739±0.120d30.778±0.072d20.688±0.034d20.093±0.016d1
B(a)P+AG0.810±0.044d30.726±0.025d20.704±0.044d20.103±0.025d2

a1P≤0.001, a2P≤0.01, a3P≤0.05 significant as compared to the control group, b1P≤0.001, b2P≤0.01 significant as compared to Aq.Tc group, c1P≤0.001 significant as compared to AG group, d1P≤0.001, d2P≤0.01, d3P≤0.05 significant as compared to B(a)P group. Values are expressed as: Mean±SD (n=4) and analyzed using one-way ANOVA followed by LSD post hoc test. LSD: Least significant difference, SD: Standard deviation, Aq.Tc: Aqueous Tinospora cordifolia stem extract, AG: Arabinogalactan, B(a)P: Benzo(a)pyrene

Effect of aqueous Tinospora cordifolia stem extract and Arabinogalactan on protein expression of apoptosis-associated genes during Benzo(a)pyrene-induced pulmonary carcinogenesis a1P≤0.001, a2P≤0.01, a3P≤0.05 significant as compared to the control group, b1P≤0.001, b2P≤0.01 significant as compared to Aq.Tc group, c1P≤0.001 significant as compared to AG group, d1P≤0.001, d2P≤0.01, d3P≤0.05 significant as compared to B(a)P group. Values are expressed as: Mean±SD (n=4) and analyzed using one-way ANOVA followed by LSD post hoc test. LSD: Least significant difference, SD: Standard deviation, Aq.Tc: Aqueous Tinospora cordifolia stem extract, AG: Arabinogalactan, B(a)P: Benzo(a)pyrene A significant decline in caspase 3 expression was observed in B(a)P treated group when compared to Aq.Tc, AG and control groups (P ≤ 0.05). However, no significant variation in caspase 3 was noted in Aq.Tc and AG treated animals when compared to control animals. Whereas, a noteworthy upregulation in caspase 3 expression was observed in B(a)P + AG group and B(a)P + Aq.Tc when compared to B(a)P group (P ≤ 0.05) [Table 2]. In comparison to Aq.Tc, AG and control groups, a significant modulation in terms of high Bcl-2 expression was seen in B(a)P treated group (P ≤ 0.001). However, co-administration of Aq.Tc (P ≤ 0.001) and AG (P ≤ 0.01) significantly assisted to modulate the B(a)P mediated disturbances in Bcl-2 levels [Table 2]. B(a)P administration resulted in a significant decline in the Bax expression when compared to Aq.Tc, AG and control groups (P ≤ 0.01). However, a significant upregulation in the Bax expression of B(a)P + Aq.Tc and B(a)P + AG groups was noted when compared to B(a)P group (P ≤ 0.01) [Table 2].

mRNA expression of metastasis associated genes during B(a)P induced pulmonary carcinogenesis

Matrix metalloproteinases-9

Similar to zymographic studies, B(a)P group also showed a significant elevation in the gene expression of MMP-9 when compared to control group (P ≤ 0.001). Conversely, the co-supplementation of Aq.Tc and AG significantly assisted to normalize the MMP-9 gene expression (P ≤ 0.001) in comparison to B(a)P treated animals [Figure 3a and c].
Figure 3

Quantitative mRNA expression of MMP-2 and MMP-9 genes in various treatment groups. (a) RT-PCR gel depicting mRNA expression. (b) Fold change of mRNA expression of MMP-2 (c) MMP-9. Values are expressed as: Mean ± SD (n= 4). Data is analysed by one-way ANOVA (post hoc test). a1: P ≤ 0.001; a2: P ≤ 0.01significant compared to the control group, b1: P ≤ 0.001 significant compared to Aq.Tc group, c1: P ≤ 0.001 significant compared to AG group, d1: P ≤ 0.001 significant compared to B(a)P group. MMP-2: Matrix metalloproteinases-2, MMP-9: Matrix metalloproteinases-9, RT-PCR: Reverse transcription-polymerase chain reaction, SD: Standard deviation, AG: Arabinogalactan

Quantitative mRNA expression of MMP-2 and MMP-9 genes in various treatment groups. (a) RT-PCR gel depicting mRNA expression. (b) Fold change of mRNA expression of MMP-2 (c) MMP-9. Values are expressed as: Mean ± SD (n= 4). Data is analysed by one-way ANOVA (post hoc test). a1: P ≤ 0.001; a2: P ≤ 0.01significant compared to the control group, b1: P ≤ 0.001 significant compared to Aq.Tc group, c1: P ≤ 0.001 significant compared to AG group, d1: P ≤ 0.001 significant compared to B(a)P group. MMP-2: Matrix metalloproteinases-2, MMP-9: Matrix metalloproteinases-9, RT-PCR: Reverse transcription-polymerase chain reaction, SD: Standard deviation, AG: Arabinogalactan

Matrix metalloproteinases-2

No significant alterations in the mRNA expression of MMP-2 was observed in between the Aq.Tc, AG and control groups. However, B(a)P administration resulted in a considerably enhanced gene expression of MMP-2 when evaluated with control group (P ≤ 0.001). Further, this B(a)P induced elevation was found to get stabilized with the co-treatment of Aq.Tc and AG with significant lowering in the expression of MMP-2 (P ≤ 0.001) [Figure 3a and b].

Enzymatic activity of matrix metalloproteinases

Matrix metalloproteinase-2

B(a)P treatment resulted in a significant increase in the enzymatic activity of MMP-2 when compared to the control, Aq.Tc and AG groups (P ≤ 0.001) respectively. Whereas, co-administration of Aq.Tc and AG helped to significantly reduce the hyperactivity of MMP-2 in B(a)P treated animals (P ≤ 0.001). Additionally, in comparison to control and Aq.Tc groups, only AG treated animals also showed a considerable decrease in the activity of MMP-2 (P ≤ 0.01) [Figure 4a and c].
Figure 4

Enzymatic activity of MMP-9 and MMP-2 during B(a)P induced lung tumorigenesis. (a) Representative activity of MMP-2 and MMP-9. (b) Gelatinolytic activity of MMP-9 and (c) MMP-2. Data is analysed using one-way ANOVA followed by post hoc test. a1: P ≤ 0.001; a2: P ≤ 0.01significant compared to the control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant compared to AG group, d1: P ≤ 0.001; d2: P ≤ 0.01 significant compared to B(a)P gr. MMP-2: Matrix metalloproteinases-2, MMP-9: Matrix metalloproteinases-9, AG: Arabinogalactan

Enzymatic activity of MMP-9 and MMP-2 during B(a)P induced lung tumorigenesis. (a) Representative activity of MMP-2 and MMP-9. (b) Gelatinolytic activity of MMP-9 and (c) MMP-2. Data is analysed using one-way ANOVA followed by post hoc test. a1: P ≤ 0.001; a2: P ≤ 0.01significant compared to the control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant compared to AG group, d1: P ≤ 0.001; d2: P ≤ 0.01 significant compared to B(a)P gr. MMP-2: Matrix metalloproteinases-2, MMP-9: Matrix metalloproteinases-9, AG: Arabinogalactan

Matrix metalloproteinase-9

Similar hyperactivity of MMP-9 was also observed in B(a)P treated animals when compare with the control, Aq.Tc and AG treated animals (P ≤ 0.001) respectively. No significant variation in the MMP-9 expression was seen among the control, Aq.Tc and AG groups. However, in comparison to B(a)P group, a significant decline in the MMP-9 activity was recorded in B(a)P + Aq.Tc and B(a)P + AG groups (P ≤ 0.001) [Figure 4a and b].

DNA ladder assay

Ladder assay was performed for the assessment of cellular apoptosis. Apoptosis usually results in the nuclear DNA fragmentation of variable molecular sizes. The results showed an intact genomic DNA bands in control, Aq.Tc and AG group samples. Similarly, B(a)P group samples also showed a prominent intact DNA band with no visible fragmentation. However, B(a)P + Aq.Tc samples showing an evident DNA fragmentation portrayed the induction of apoptosis. Similarly, AG co-supplementation also resulted into a diffused and smear DNA band which may also be associated to the necrotic damages [Figure 5].
Figure 5

DNA fragmentation assay of lung tissue from different treatment groups Lane I – DNA ladder, Lane II – Control, Lane III – Aq.Tc, Lane IV – AG, Lane V – B(a)P, Lane VI – B(a)P + Aq.Tc, Lane VII – B(a)P + AG

DNA fragmentation assay of lung tissue from different treatment groups Lane I – DNA ladder, Lane II – Control, Lane III – Aq.Tc, Lane IV – AG, Lane V – B(a)P, Lane VI – B(a)P + Aq.Tc, Lane VII – B(a)P + AG

Telomerase enzyme activity during B(a)P induced pulmonary tumorigenesis

The analysis revealed a noteworthy increase in the telomerase activity in B(a)P treated animals in comparison to Aq.Tc, AG and control groups (P ≤ 0.001). However, B(a)P + Aq.Tc and B(a)P + AG groups showed a significant decrease in the telomerase activity (P ≤ 0.001) in comparison to B(a)P group. Further, a significant variation in terms of increased telomerase activity was also recorded in B(a)P + AG group when compared to Aq.Tc (P ≤ 0.001), AG (P ≤ 0.01) and control (P ≤ 0.01) groups respectively. However, no significant variation in telomerase activity was seen in Aq.Tc and AG groups when compared to control group [Figure 6].
Figure 6

Effect of Aq.Tc and AG on telomerase enzyme activity during B(a)P induced pulmonary tumorigenesis Values are expressed as: Mean ± SD (n= 5) and analysed using one-way ANOVA followed by LSD post hoc test. a1: P ≤ 0.001 significant as compared to the control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant as compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant as compared to AG group, d1: P ≤ 0.001 significant as compared to B(a)P group. AG: Arabinogalactan, SD: Standard deviation, LSD: Least significant difference

Effect of Aq.Tc and AG on telomerase enzyme activity during B(a)P induced pulmonary tumorigenesis Values are expressed as: Mean ± SD (n= 5) and analysed using one-way ANOVA followed by LSD post hoc test. a1: P ≤ 0.001 significant as compared to the control group, b1: P ≤ 0.001; b2: P ≤ 0.01 significant as compared to Aq.Tc group, c1: P ≤ 0.001; c2: P ≤ 0.01 significant as compared to AG group, d1: P ≤ 0.001 significant as compared to B(a)P group. AG: Arabinogalactan, SD: Standard deviation, LSD: Least significant difference

Discussion

Since cancer leads to the activation of multiple dysregulated pathways, therefore, the prevention or treatment strategies to combat this disease needs to address the complexities involved with it. Various hallmarks of cancer include metastasis, cellular immortality, dysregulation of apoptosis etc. Chemopreventive drugs such as medicinal plant extracts and their active components are well known to exert their inhibitory effects on carcinogenesis through multiple signalling pathways that regulate cell growth and apoptotic pathways. T. cordifolia and its active PS viz AG have myriad pharmacological properties (including anti-cancer activity) which makes it an ideal chemopreventive agent to be tested against lung carcinogenesis. Previous study from our laboratory revealed that T. cordifolia and AG were successful in reducing the tumor burden, modulated various biomarkers and induced apoptosis. Therefore, the current study was designed to unravel various molecular pathways underlying the chemopreventive effects of T. cordifolia and AG against experimentally induced lung tumorigenesis. In the present study, lung tumors were found to be raised in male BALB/c mice following the B(a)P injection (i. p.). By the end of 22 weeks, tumors obtained in B(a)P, B(a)P + Aq.Tc and B(a)P + AG groups were found to be histologically similar as adenocarcinoma. As previously reported, chemopreventive response of Aq.Tc and AG was demonstrated in terms of reduced tumor incidence, multiplicity and reduced number of visible tumor.[15] Activation of oncogenes and simultaneous declension of apoptosis results into the excessive cell proliferation leading to tumorigenesis. Apoptosis primarily maintains the requisite number of cells in an organism by balancing the cell's growth, division and death. Any disturbance in the activity of pro-and anti-apoptotic proteins, reduced caspases and death receptor signalling may dodge apoptosis. Disparity in the pro and anti-apoptotic members of the Bcl-2 family usually results in dysregulated apoptosis. The underlying reason could be the under-expression or over-expression of the pro-or anti-apoptotic proteins respectively or both.[20] The present study demonstrated a significant elevation in Bcl-2 and decline in bax, caspase 3 and caspase 9 expression of B(a)P treated animals. These results were found to be in line with the previous reports demonstrating B(a)P introduced similar disturbances in the expression of apoptotic genes.[21] However, the co-administration of Aq.Tc significantly assisted to stabilize the B(a)P mediated disturbances in the Bcl-2, bax, caspase 3, caspase 9. These regulatory results were also found parallel to our previous findings demonstrating increased number of apoptotic cell bodies in B(a)P + Aq.Tc group (using TUNEL assay). In one such report, aqueous extract of T. cordifolia was found to modulate the apoptosis associated genes in glioblastomas at both transcriptional and translational levels.[11] Another report signifying the apoptotic potential of T. cordifolia showed the induction of constitutive expression of caspase activated DNase (CAD) in both cytoplasm and nucleus.[22] CAD, a member of nuclease family enzyme is well known for its genomic DNA fragmentation properties. This may also suggests that in the current study T. cordifolia may also have introduced apoptosis through the caspase-3 dependent activation of CAD. AG, an active PS fraction of T. cordifolia has also been well acknowledged for its varied pharmacological properties. In the present study, AG was also found to modulate the expression of pro-and anti-apoptotic proteins for the induction of apoptosis during B(a)P induced lung tumorigenesis. It has been reported previously that combination of AG and curcumin has significantly increased the bax/bcl-2 ratio as well as levels of caspase-3 and thereby induced apoptosis in breast cancer cells in vitro and in vivo (MDA-MB-231 cells).[23] Apoptosis has generally been quantified by using DNA ladder assay. Apoptosis, a phenomenon of programmed cell death leads to the degradation of genomic DNA resulting in a ladder like pattern when electrophoresed. In the present investigation, the intact genomic bands were seen in control, Aq.Tc and AG group DNA samples when electrophoresed. However, a diffused band with an unresolved tail was appeared in B(a)P + AG group samples. This pattern type signifies the presence of intact as well as fragmented DNA. It also signifies that the DNA fragments formed though not clear were might be of high molecular weight which is an indication of early stage DNA fragmentation. However, the co-treatment of Aq.Tc resulted in a conspicuous DNA ladder formation which further dictates the pro-apoptotic potential of Aq.Tc during B(a)P mediated lung carcinogenesis. Our results were also in concordance to the earlier reports where ethanolic extract of T. cordifolia showed reduction in DNA damage in arsenite induced DNA damage in lymphocytes.[24] Degradation of the basement membrane or extracellular matrix by proteinases like MMPs is an important event in metastasis and tumor invasion. Increased expression of these MMP enzymes is a common characteristic in different types of cancers such as breast, ovarian, colorectal, prostate and lung cancers.[25] In the current investigation, B(a)P administration resulted in a marked upregulation in the gene as well as enzymatic expressions of MMP-2 and MMP-9. Similarly, Chandrashekar et al., also reported an upregulation of MMP-2 and MMP-9 activity during B(a)P induced tumorigenesis.[26] Mishra and Kaur, also reported a decreased expression of MMPs in glioblastoma cells after treatment with Aq.Tc.[11] Several isolated active components such as curcumin have been reported to inhibit metastasis via the inhibition of MMP-2 and MMP-9 during prostate cancer.[27] PS derived from Inonotus obliquus repressed the expression and activity of MMP-2 and MMP-9 in B16-F10 melanoma cells through the suppression of MAPK, COX-2, and NF-κB signaling pathways.[28] All these observations indicate Aq.Tc and AG as an anti-metastatic agents by mitigating B(a)P induced lung carcinogenesis. Activity of telomerase enzyme has generally been found to get elevated in all types of human tumors. Telomere stability is the necessary factor for the long-term proliferation of tumors. Telomere length and telomerase activity are very much crucial for tumor initiation and survival. Adenocarcinomas in humans are thought to universally bypass the cellular senescence and signaling pathways activated by the upregulated telomerase expression.[4] In humans, shorter telomeres and repressed telomerase activity may have evolved as an anticancer defense mechanism.[29] In the present investigation, B(a)P treatment also resulted in increased telomerase activity at the 22nd week of treatment. Previous reports also suggest that telomerase activity gets increased in preneoplastic and neoplastic conditions.[5] Furthermore, in the present study, co-administration with Aq.Tc and AG significantly downregulated the telomerase activity in B(a)P-induced tumorigenesis. This activity could be attributed to the anti-telomerase activity of these chemopreventive agents. Chemopreventive agents such as medicinal plants reduce/inhibit the telomerase activity that can be utilized for the treatment of cancer. Boklan et al. reported that telomere shortening, decreased cell proliferation and malformed cell cycle-associated genes leading to apoptosis are mainly due to the inhibition of the telomerase enzyme.[30] Thus it is evident from the present study that Aq.Tc and AG acted as a chemopreventive agent by repressing the telomerase activity during B(a)P-induced lung tumorigenesis.

Conclusion

It is evident from the present study that Aq.Tc and AG supplementation successfully mitigated the altered expression of apoptosis-associated genes, repressed telomerase activity, and metastasis-associated genes. However, Aq.Tc was found to be more efficacious anti-cancer agent in comparison to AG in terms of inducing apoptosis (as observed by expression of apoptosis-associated genes and DNA fragmentation analysis). This superior chemopreventive potential of Aq.Tc could mainly be owed to the synergistic effects of different active phytochemicals present in it. However, further studies are warranted to establish both Aq.Tc and AG as potent chemopreventive agents.

Financial support and sponsorship

Nil.

Conflicts of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
  28 in total

1.  Protein measurement with the Folin phenol reagent.

Authors:  O H LOWRY; N J ROSEBROUGH; A L FARR; R J RANDALL
Journal:  J Biol Chem       Date:  1951-11       Impact factor: 5.157

2.  Combination of arabinogalactan and curcumin induces apoptosis in breast cancer cells in vitro and inhibits tumor growth via overexpression of p53 level in vivo.

Authors:  Hassan Moghtaderi; Houri Sepehri; Farnoosh Attari
Journal:  Biomed Pharmacother       Date:  2017-02-24       Impact factor: 6.529

3.  Capsaicin inhibits benzo(a)pyrene-induced lung carcinogenesis in an in vivo mouse model.

Authors:  P Anandakumar; S Kamaraj; S Jagan; G Ramakrishnan; S Asokkumar; C Naveenkumar; S Raghunandhakumar; T Devaki
Journal:  Inflamm Res       Date:  2012-06-27       Impact factor: 4.575

Review 4.  Non-small cell lung cancer: current treatment and future advances.

Authors:  Cecilia Zappa; Shaker A Mousa
Journal:  Transl Lung Cancer Res       Date:  2016-06

5.  Short-term zinc deficiency affects nuclear factor-kappab nuclear binding activity in rat testes.

Authors:  P I Oteiza; M S Clegg; C L Keen
Journal:  J Nutr       Date:  2001-01       Impact factor: 4.798

6.  Polysaccharide from Inonotus obliquus inhibits migration and invasion in B16-F10 cells by suppressing MMP-2 and MMP-9 via downregulation of NF-κB signaling pathway.

Authors:  Ki Rim Lee; Jong Seok Lee; Young Rae Kim; In Gyu Song; Eock Kee Hong
Journal:  Oncol Rep       Date:  2014-03-21       Impact factor: 3.906

7.  Effects of Withania somnifera and Tinospora cordifolia extracts on the side population phenotype of human epithelial cancer cells: toward targeting multidrug resistance in cancer.

Authors:  Naseer Maliyakkal; Asmy Appadath Beeran; Sai A Balaji; Nayanabhirama Udupa; Sreedhara Ranganath Pai; Annapoorni Rangarajan
Journal:  Integr Cancer Ther       Date:  2014-12-29       Impact factor: 3.279

Review 8.  Dysregulation of apoptotic signaling in cancer: molecular mechanisms and therapeutic opportunities.

Authors:  Jessica Plati; Octavian Bucur; Roya Khosravi-Far
Journal:  J Cell Biochem       Date:  2008-07-01       Impact factor: 4.429

Review 9.  Roles of telomeres and telomerase in cancer, and advances in telomerase-targeted therapies.

Authors:  Mohammad A Jafri; Shakeel A Ansari; Mohammed H Alqahtani; Jerry W Shay
Journal:  Genome Med       Date:  2016-06-20       Impact factor: 11.117

10.  Chemopreventive role of arabinogalactan against experimentally induced pulmonary carcinogenesis: a study in relation to its initiation phase.

Authors:  Ashwani Koul; Shaffy Garg; Vandana Mohan
Journal:  Drug Chem Toxicol       Date:  2019-08-05       Impact factor: 3.356

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.