H B Deepak1, Sabina Evan Prince2, Pratima Deshpande3. 1. Department of Biomedical Sciences, School of Biosciences and Technology, VIT, Vellore, Tamil Nadu; Department of Biology, Jubilant Biosys Ltd., Bengaluru, Karnataka, India. 2. Department of Biomedical Sciences, School of Biosciences and Technology, VIT, Vellore, Tamil Nadu, India. 3. Department of Biology, Jubilant Biosys Ltd., Bengaluru, Karnataka, India.
Abstract
OBJECTIVES: Psoriasis is a chronic infectious skin disease triggered by an autoimmune process involving T-cell-mediated hyper-proliferation of keratinocytes. The objective of this study is to assess the modulation of programmed death 1 (PD-1) and its ligand programmed cell death ligand 1 (PD-L1) through JAK/STAT pathway during the development of a psoriasis-like disease by both in vitro and in vivo model. Baricitinib, a known inhibitor of JAK1 and JAK2, was used to study the impact on PD-1 and PD-L1. MATERIALS AND METHODS: Human peripheral blood mononuclear cells (PBMC) were stimulated with either anti-CD3/CD28 or PMA/Ionomycin, to modulate level of PD-1 and PD-L1 under psoriasis-like condition. Interferon-gamma (IFNγ) was used to treat HaCaT cells to mimic the diseased keratinocytes found in Psoriatic patients. Psoriasis was induced with Imiquimod (IMQ) in animal model to study the cross-talk between different cell types and pathways. RESULTS: Expression levels of PD-1 and PD-L1 in PBMC, and secretion of cytokines, namely tumor necrosis factor-α (TNFα), IFNγ, interleukin (IL)-6, and IL-1 β, were down-regulated on treatment with baricitinib. Further, in IFNγ-treated HaCaT cells (keratinocytes) mRNA levels of KRT-17 and PD-L1 were up-regulated.). Interestingly, in IFNγ-treated HaCat cells baricitinib decreased the levels of inflammatory cytokines such as IL-1 β, IL-6, and TNFα along with KRT-17 and PD-L1. On IFNγ-treatment. Data from both PBMC and HaCaT suggest an anti-inflammatory role for this compound. Accordingly, baricitinib was able to alleviate disease symptom in IMQ induce mice model of psoriasis. As a consequence of baricitinib treatment down-regulation of p-STAT3, PD- and PD-L1 expression levels were observed. CONCLUSION: This study demonstrates a crosstalk between JAK/STAT and PD-1/PD-L1 pathways. It also demonstrates that cytokines such as IFNγ and IL-17 are down-regulated by baricitinib. We believe decreased expressions of PD-1 and PD-L1 may be a consequence of baricitinib-induced down-regulation of IFNγ and IL-17. More importantly, our data from the acute model of psoriasis indicates that PD-L1 behaves as a T-cell-associated T-cell-associated surrogate activation marker rather than immunosuppressive marker in early phase of psoriasis. Therefore it does not exhibit a causal relationship to disease.
OBJECTIVES: Psoriasis is a chronic infectious skin disease triggered by an autoimmune process involving T-cell-mediated hyper-proliferation of keratinocytes. The objective of this study is to assess the modulation of programmed death 1 (PD-1) and its ligand programmed cell death ligand 1 (PD-L1) through JAK/STAT pathway during the development of a psoriasis-like disease by both in vitro and in vivo model. Baricitinib, a known inhibitor of JAK1 and JAK2, was used to study the impact on PD-1 and PD-L1. MATERIALS AND METHODS: Human peripheral blood mononuclear cells (PBMC) were stimulated with either anti-CD3/CD28 or PMA/Ionomycin, to modulate level of PD-1 and PD-L1 under psoriasis-like condition. Interferon-gamma (IFNγ) was used to treat HaCaT cells to mimic the diseased keratinocytes found in Psoriatic patients. Psoriasis was induced with Imiquimod (IMQ) in animal model to study the cross-talk between different cell types and pathways. RESULTS: Expression levels of PD-1 and PD-L1 in PBMC, and secretion of cytokines, namely tumor necrosis factor-α (TNFα), IFNγ, interleukin (IL)-6, and IL-1 β, were down-regulated on treatment with baricitinib. Further, in IFNγ-treated HaCaT cells (keratinocytes) mRNA levels of KRT-17 and PD-L1 were up-regulated.). Interestingly, in IFNγ-treated HaCat cells baricitinib decreased the levels of inflammatory cytokines such as IL-1 β, IL-6, and TNFα along with KRT-17 and PD-L1. On IFNγ-treatment. Data from both PBMC and HaCaT suggest an anti-inflammatory role for this compound. Accordingly, baricitinib was able to alleviate disease symptom in IMQ induce mice model of psoriasis. As a consequence of baricitinib treatment down-regulation of p-STAT3, PD- and PD-L1 expression levels were observed. CONCLUSION: This study demonstrates a crosstalk between JAK/STAT and PD-1/PD-L1 pathways. It also demonstrates that cytokines such as IFNγ and IL-17 are down-regulated by baricitinib. We believe decreased expressions of PD-1 and PD-L1 may be a consequence of baricitinib-induced down-regulation of IFNγ and IL-17. More importantly, our data from the acute model of psoriasis indicates that PD-L1 behaves as a T-cell-associated T-cell-associated surrogate activation marker rather than immunosuppressive marker in early phase of psoriasis. Therefore it does not exhibit a causal relationship to disease.
Entities:
Keywords:
Baricitinib; HaCaT; imiquimod; programmed death 1; psoriasis
Psoriasis is a chronic inflammatory skin disease caused by T-cell-mediated keratinocyte hyperproliferation, dilated, keratinocyte differentiation, leukocyte infiltration, and hyperplastic blood vessels primarily into the dermis. In addition to the increased proliferation of keratinocytes observed in psoriasis, there are distinct differences in the levels of expression of the different keratins. Out of 20 types of keratins, the type I, K16, and K17 are generally not expressed at high levels in normal epidermis. However, in normal hair follicles, low level of K17 is expressed. K16 and K17 are predominantly involved in epidermis hyper-proliferation which is associated with psoriatic pathogenesis.[1] The activation of resting T-cells, triggered by the T-cell antigen receptor, is dependent on intracellular signals modulated by co-stimulating and also in negative receptor signals. Different cells participate in adaptive immunity and skin's innate, such as neutrophils, keratinocytes, natural killer cells, macrophages, T-cells, and dendritic cells (DCs), all have been shown to be involved in psoriasis pathogenesis.[2] Keratinocytes orchestrate immune responses by the development of chemokines and interaction with TLR.[3] STAT3 signaling is a more important determinant for mediating skin inflammation in keratinocytes rather than in T-cells. Therefore, the cross-talks between keratinocytes, T-cells, and DCs are key triggers of the persistent inflammatory circuits. Few co-stimulatory interactions cause the proliferation and activation of naive T-cells, whereas others enhance regulation and suppress the activation of T-cells.[4] The best inhibitory pathway for T-cell activation is CD80/CD86-CTLA-4.[5] Programmed death 1 (PD-1), which interacts with programmed cell death ligand 1 (PD-L1) (B7-H1) and PD-L2 (B7-DC) to regulate the production of T-cells. PD-1 polymorphism studies have correlated with the incidence of many autoimmune diseases, such as diabetes ankylosing spondylitis, rheumatoid arthritis, and multiple sclerosis. Studies in mouse models have revealed that knocking out either PD-1 or PD-L1 will lead to the development of diabetes, increase in T cell production, and insulitis of pro-inflammatory cytokines.[6]Experiments on the PD-1-deficient mice model have demonstrated that PD-1 has a significant role in the prevention of autoimmunity and in controlling peripheral tolerance. The PD-1-deficient mice model C57BL/6 developed arthritis and lupus-like illness.[7] The blocking immune checkpoint signaling has been extensively explored for its treatment potential in cancer. A number of clinical trials are underway to explore antibody-mediated PD-1 blockade although there is no approved PD-1 agonist for this purpose. Therapeutic strategies like production of agonist antibodies for autoimmunity alleviation, changing the signaling of the immune checkpoints are being investigated for the treatment of autoimmune disorders and also for arriving form on the rejection of transplants.This study aimed to explore the modulation of PD-1and its ligand PD-L1 dependent on JAK/STAT pathway in the development and progression of psoriasis. It has been observed that baricitinib modulates activated peripheral blood mononuclear cells (PBMC). PD-L1 and KRT-17 are also modulated by baricitinib in interferon-gamma (IFNγ)-treated HaCaT cells that mimic psoriasis. Further, in Imiquimod (IMQ) induced model of psoriasis, baricitinib down-regulates the disease pathogenesis. This, along with other inflammatory and psoriatic markers, correlated with the downregulation of PD-1 and PD-L1.
Materials and Methods
Cell cultures
Human keratinocyte cell line (HaCaT) was purchased from National Center for Cell Science, Pune, India. They were harvested in Dulbecco's modified Eagle's medium (DMEM; Gibco, USA), supplemented with 10% heat-inactivated fetal bovine serum (Gibco), 100 U/ml penicillin, 100 μg/ml streptomycin. All cells were persisted in a humidified incubator at 37°C with 5% CO2 and 5 passages were tested. PBMC from a healthy donor was prepared over a histopaque gradient using the standard method. Isolated PBMC were suspended in RPMI media (Gibco: 11875-093), supplemented with 10% heat-inactivated fetal bovine serum (Gibco), 100 U/ml penicillin, 100 μg/ml streptomycin.
Antibodies and cytokines
Unconjugated anti-PD-1(NBP1-43107) and anti-PD-L1 (NBP1-43262) were purchased from Novus Biologicals. Keratin 17 (D73C7; 4543S), phospho-Stat3 (Tyr705; 9145S), Vinculin (E1E9V; 13901) mAb were obtained from CST. Human recombinant Interferon (IFN) γ (PHC4031) was obtained from Thermo scientific. APC conjugated anti-human CD279 (PD-1) (621610), PE anti-human CD274 (B7-H1, PD-L1) (329706), and FITC anti-human CD3 (317306) antibody were procured from Biolegend.
Human peripheral blood mononuclear cells cultures stimulated with anti-CD3/CD28 and PMA/ionomycin
PBMC were seeded at 0.2 × 106 cells in 24 wells plate. Plated PBMC were pretreated with baricitinib for 1 h. Cells were stimulated with anti-CD3 (OKT3) at 2 μg/ml (Biolegend: 317301) along with soluble anti CD28 at 1 μg/ml (Biolegend: 302901) also a combination of PMA and Ionomycin (50 ng/ml and 1 μg/ml respectively) for 3 days. Posttreatment, cells were processed for expression studies through Flow cytometry, and the supernatant was used for cytokine analysis. Proliferation analysis of cells was carried out using Alamar blue dye. The use of PBMC was approved with Reg. no. ECR/141/Intd/KA/2013.
Interferon γ-induced HaCaT-cell stimulation
HaCaT cells were seeded 1 day before the process at a density of 0.2 × 106 viable cells in 24 wells plate. The following day, cells were pretreated with baricitinib for 1 h at the indicated concentration. Cells were treated with or without IFNγ (100 ng/mL; Thermo Scientific) for 24 h at 37°C in 5% CO2 in a humidified incubator.
Imiquimod-induced psoriasis model
BALB/C mice (8–10 weeks of age) were obtained from Liveon Biolabs Pvt. Ltd. and were used with the authentication by the Animal Ethical Committees at Jubilant Biosys, Bengaluru, India (IAEC/JDC/2019-196R). Psoriasis in mice was induced by topical application of 62.5 mg IMQ cream (5%) (Glenmark Pharmaceuticals Ltd) daily on the right ear and back (shaved) for seven consecutive days. For therapy, baricitinib (15 mg/ml) was dissolved in acetone: DMSO (7:1) ratio, and 20 μl was applied on-ear and back of mice 30 min prior to IMQ application for 7 days. Control group mice were treated similarly with 20 μl of 7:1 acetone: DMSO. Ear thickness was observed and recorded daily. After the treatment period, the animals were sacrificed by cervical dislocation, skin sections of the ear and bank were removed using a 6 mm diameter punch, and weighed before further processing.
Flow cytometric analysis
Flow cytometry with dual staining was performed using fluorescence-conjugated mAbs that included FITC anti-human CD3 Antibody, APC conjugated anti-human CD279 (PD-1), PE anti-human CD274 (B7-H1, PD-L1). Staining was performed on PBMC and HaCaT cells to analyze the expression levels of PD-1 and PD-L1 upon treatment. Conjugated antibodies at predetermined optimum concentrations were added and incubated at room temperature for 1 h. Postincubation, the cells were washed twice with at least 2 ml of Cell Staining Buffer After centrifugation at 350× g for 5 min, the cell pellet was resuspended in cell staining buffer and used for flow cytometric analysis. Upon analysis, at least 10,000 events (human cells) were recorded using a BD FACSCalibur™ flow cytometer (BD Bioscience). Data were analyzed by FlowJo software.
Western blotting analysis
Total proteins of HaCaT cells were used for Western blot analysis. The treated cells were washed once with DPBS and the cells were incubated with RIPA buffer on ice for 10 min. For the western blot analysis, homogenate was prepared from the 6 mm biopsy dermal punch of right ear pinna isolated after sacrificing the mice. Biopsies were homogenized using GenoGrinder and then centrifuged at 100,00 rpm for 5 min before collection of the supernatant. The protein concentration of the supernatant from cells and tissue was determined. Thereafter, 20 μg protein samples were separated by 8% SDS-PAGE gel, transferred to a nitrocellulose membrane. 2% BSA was used to block the membrane in PBST for 60 min at room temperature. It was then incubated overnight at 4°C with primary antibodies against PD-1, PD-L1, KRT17, STAT3, phospho-STAT3, and vinculin. Subsequently, the membranes were washed in PBST and incubated for 60 min at room temperature with HRP-labeled goat anti-rabbit secondary antibodies. Protein bands were visualized with Luminata Forte (Millipore: WBLUF0100). Blots were developed using Image Quant LAS 4000.
Real-time quantitative polymerase chain reaction
Total mRNA was extracted from cells and 6 mm biopsy dermal Punch of right ear pinna isolated after sacrificing the mice using RNeasy Mini Kit from Qiagen, according to the manufacturer's instructions. cDNA was synthesized with 500 ng of this RNA using iScript™ cDNA Synthesis Kit (Bio-Rad). Thereafter, cDNA was used to determine the relative expression of target genes with the iTaq™ Universal SYBR® Green Supermix (Bio-Rad). The reaction was performed according to the manufacturer's instructions, with an initial temperature of 95°C for 2 min and followed by 95°C for 30 s, 60°C for 45 s, 72°C for 30 s for 40 cycles. Primer sequences are listed in Table 1 for human genes and Table 2 shows the list of mouse primes used in a quantitative polymerase chain reaction (qPCR).
Table 1
Primer sequences for the quantitative PCR for human genes
Gene name
Forward sequence
Reverse sequence
PD-1
AAGGCGCAGATCAAAGAGAGCC
CAACCACCAGGGTTTGGAACTG
PD-L1
TGCCGACTACAAGCGAATTACTG
CTGCTTGTCCAGATGACTTCGG
KRT-17
ATCCTGCTGGATGTGAAGACGC
TCCACAATGGTACGCACCTGAC
IL-17
CGGACTGTGATGGTCAACCTGA
GCACTTTGCCTCCCAGATCACA
IFNγ
TAGCAGGGGTGAGAGTCTTTG
AAGGCGCAGATCAAAGAGAGCC
ICAM
TCTTCCTCGGCCTTCCCATA
AGGTACCATGGCCCCAAATG
TNF alpha
CTCTTCTGCCTGCTGCACTTTG
ATGGGCTACAGGCTTGTCACTC
IFN: Interferon, PCR: Polymerase chain reaction
Table 2
Primer sequences for the quantitative PCR for mouse genes
Gene name
Forward sequence
Reverse sequence
PD-1
CGGTTTCAAGGCATGGTCATTGG
TCAGAGTGTCGTCCTTGCTTCC
PD-L1
AGTCTCCTCGCCTGCAGATA
CTCTCCCCCTGAAGTTGCTG
KRT-17
CTGCTGGATGTGAAGACAAGGC
GGTTCTTTTGGCTTGTACTGAGTC
IL-17
CAGACTACCTCAACCGTTCCAC
TCCAGCTTTCCCTCCGCATTGA
IFNγ
CCGATGGGTTGTACCTTGTC
TGCATCCTTTTTCGCCTTGC
IL-22
TGCGATCTCTGATGGCTGTC
CCTCGGAACAGTTTCTCCCC
TNFα
GGTGCCTATGTCTCAGCCTCTT
GCCATAGAACTGATGAGAGGGAG
IL-6
TACCACTTCACAAGTCGGAGGC
CTGCAAGTGCATCATCGTTGTTC
IP-10
TAAACTCATGGCACCGGCAT
GGCATTTGGCAGCTTTACCC
IFN: Interferon, PCR: Polymerase chain reaction
Primer sequences for the quantitative PCR for human genesIFN: Interferon, PCR: Polymerase chain reactionPrimer sequences for the quantitative PCR for mouse genesIFN: Interferon, PCR: Polymerase chain reaction
Cytokine analysis
Culture supernatants were harvested at the indicated time points. The homogenate from ear pinna was centrifuged and the supernatant was used for estimation. Cytokine concentration was assessed by ELISA (R and D Systems) according to the manufacturer's instructions.
Histopathological analysis
Tissues were processed into paraffin blocks using standard methods by sectioning. Hematoxylin and eosin were used to stain at the sample.
Statistical analysis
All the data are presented as mean SEM. Data were analyzed using version 5 of GraphPad Prism (San Diego, CA, USA) and presented as means ± SEM (n = 4), Data comparisons of means and SEM of data were made using multiple comparison tests of a two-sided Student's t-test/Dunnett. When compared with control #P < 0.05, ##P < 0.01, ###P < 0.001 and when compared with disease group (IFNγ/IMQ) *P < 0.05, **P < 0.01, ***P < 0.001. All experiments were replicated twice independently.
Results
Regulation of cytokines and programmed death 1/programmed cell death ligand 1 in activated peripheral blood mononuclear cells
In this study, anti-CD3/CD28 antibodies or a combination of PMA/Ionomycin was used for the activation of PBMC and the same was measured after culture for 3 days. Transcript levels of PD-1, IFNγ, interleukin (IL)-17, and tumor necrosis factor-α (TNFα) were elevated in the activated PBMC [Figure 1a and b]. Activation of PBMC was assessed by measuring protein levels of PD-1 and PD-L1 on the cell-surface by flow cytometry. Elevated levels of PD-1 and PD-L1 were seen on the surface of T cells [Figure 1c and d]. Elevated levels of cytokines TNFα, IFNγ, IL-6, and IL-1 β were noted in the activated PBMC groups [Figure 1e].
Figure 1
Effect of co-stimulation with anti-CD3/anti-CD28 and PMA/Ionomycin: PBMC were incubated with and without stimulation for 72 h. Gene expression levels were analyzed with RT-qPCR. Relative gene expression was assessed for each marker by comparing DCt value and normalized with housekeeping gene, (a) Gene markers upregulated upon stimulation with anti-CD3/anti-CD28 in PBMC, (b) Gene markers upregulated upon stimulation with PMA/Ionomycin in PBMC. Cells were stained with fluorescently conjugated monoclonal antibodies directed against PD-1 and PDL-1. Samples were acquired with a FACSCalibur system (Becton Dickinson), and the resulting data were analyzed using FlowJo software, (c) shows MFI of PD-1, (d) shows MFI of PDL-1 with and without stimulation, (e) Release of cytokines TNF alpha, IFN gamma, IL-6, and IL-1 beta upon stimulation with anti-CD3/anti-CD28 and PMA/Ionomycin in PBMC. *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Effect of co-stimulation with anti-CD3/anti-CD28 and PMA/Ionomycin: PBMC were incubated with and without stimulation for 72 h. Gene expression levels were analyzed with RT-qPCR. Relative gene expression was assessed for each marker by comparing DCt value and normalized with housekeeping gene, (a) Gene markers upregulated upon stimulation with anti-CD3/anti-CD28 in PBMC, (b) Gene markers upregulated upon stimulation with PMA/Ionomycin in PBMC. Cells were stained with fluorescently conjugated monoclonal antibodies directed against PD-1 and PDL-1. Samples were acquired with a FACSCalibur system (Becton Dickinson), and the resulting data were analyzed using FlowJo software, (c) shows MFI of PD-1, (d) shows MFI of PDL-1 with and without stimulation, (e) Release of cytokines TNF alpha, IFN gamma, IL-6, and IL-1 beta upon stimulation with anti-CD3/anti-CD28 and PMA/Ionomycin in PBMC. *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Role of JAK1/2 on proliferation and interferon-gamma release in activated peripheral blood mononuclear cells
To assess the impact of JAK1/2 on the function of PBMC, 300nM of baricitinib, a known inhibitor of the pathway, was used in cultures along with anti-CD3/CD28 antibodies [Figure 2a and b]. Baricitinib appears to significantly diminish proliferation as assessed by the addition of Alamar Blue as well as IFNγ production measured by ELISA following 3 days of stimulation of PBMC.
Figure 2
Effect of Baricitinib on proliferation rate and release of IFNγ. (a) Shows significant decrease in proliferation rate in baricitinib-treated group in comparison to group stimulated with anti-CD3/anti-CD28. (b) Shows decrease in release of IFNγ cytokine upon baricitinib treatment in comparison to group stimulated with anti-CD3/anti-CD28. ###P < 0.001, ***P < 0.001. IFNγ: Interferon gamma
Effect of Baricitinib on proliferation rate and release of IFNγ. (a) Shows significant decrease in proliferation rate in baricitinib-treated group in comparison to group stimulated with anti-CD3/anti-CD28. (b) Shows decrease in release of IFNγ cytokine upon baricitinib treatment in comparison to group stimulated with anti-CD3/anti-CD28. ###P < 0.001, ***P < 0.001. IFNγ: Interferon gamma
Effect of interferon-gamma on HaCaT cells used as an in vitro model for psoriasis
This experiment was carried out to study whether IFNγ treatment modulates inflammation markers on Keratinocytes that are implicated in psoriasis-associated pathogenesis. IFNγ-induced KRT-17 expressions in HaCaT are a widely accepted mimic of in vitro model of psoriasis. Treatment of HaCaT cells with IFNγ led to elevate KRT-17, ICAM-1, and IL-6 mRNA expression. It was interesting to note that in this setting, the level of PD-L1 expression at mRNA level showed 3-fold increase over control cells [Figure 3b]. As per anticipation, transcript and protein levels of PD-L1 were also found to be elevated. PD-L1 is known to be an IFN-inducible gene [Figure 3a].
Figure 3
Effect of IFNγ on HaCaT cells: Cells were treated with 100 ng/ml of IFNγ for 24 h; (a) Cells were stained with fluorescently conjugated monoclonal antibodies directed against PDL-1. Samples were acquired with a FACSCalibur system (Becton Dickinson), and the resulting data were analyzed using FlowJo software. (b) Gene expression levels of PD-L-1, KRT-17, ICAM, IL-6 were analyzed with RT-qPCR. Relative gene expression was assessed for each marker by comparing DCt value and normalized with housekeeping gene. *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Effect of IFNγ on HaCaT cells: Cells were treated with 100 ng/ml of IFNγ for 24 h; (a) Cells were stained with fluorescently conjugated monoclonal antibodies directed against PDL-1. Samples were acquired with a FACSCalibur system (Becton Dickinson), and the resulting data were analyzed using FlowJo software. (b) Gene expression levels of PD-L-1, KRT-17, ICAM, IL-6 were analyzed with RT-qPCR. Relative gene expression was assessed for each marker by comparing DCt value and normalized with housekeeping gene. *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Role of JAK1/2 on the regulation of psoriatic inflammatory markers in HaCaT cells
To analyze the role of JAK/STAT pathway in controlling the activation state of keratinocytes, cells were pretreated with baricitinib, a JAK1/2 inhibitor followed by IFNγ treatment for 24 h. HaCaT cells treated with IFNγ showed elevated mRNA levels of KRT-17, ICAM, and PD-L1. The same was significantly inhibited by treating with baricitinib [Figure 4a]. Cytokine analysis of supernatant shows elevated levels of TNFα, IL-6, and IL-1 β in the activated keratinocytes. However, with baricitinib treatment levels of cytokines were significantly inhibited [Figure 4b].
Figure 4
Baricitinib downregulates IFNγ-induced psoriatic condition in HaCaT cell; (a) Baricitinib treatment downregulated gene expression of PD-L1, KRT-17, and ICAM in IFNγ-treated HaCaT cells. (b) Baricitinib downregulated release of cytokines such as TNFα, IL-6, and IL-1 β in IFN gamma-treated HaCaT cells. ###P < 0.001, *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumor necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Baricitinib downregulates IFNγ-induced psoriatic condition in HaCaT cell; (a) Baricitinib treatment downregulated gene expression of PD-L1, KRT-17, and ICAM in IFNγ-treated HaCaT cells. (b) Baricitinib downregulated release of cytokines such as TNFα, IL-6, and IL-1 β in IFN gamma-treated HaCaT cells. ###P < 0.001, *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumor necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Effect of baricitinib on imiquimod-induced psoriasis in mice
To analyze the relationship between PD-1 and PD-L1 with JAK/STAT in modulating disease, the efficacy of baricitinib in IMQ-induced psoriasis was tested. IMQ is a TLR7/8 ligand and potent immune activator, can induce and exacerbate psoriasis.[8] Two days after IMQ application, both the dorsal skin and left ear pinna of mice showed signs of erythema, inflammation, thickening, and scaling. Over time the duration of psoriasis-like symptoms grew steadily in severity. Ear thickness was used as an indicator of inflammation and mice treated with vehicle did not show any signs of inflammation [Figure 5c]. Topical use of baricitinib at 300 μg/20 μl/animal demonstrated a significant decrease in ear thickness as compared to control mice treated with IMQ [Figure 5a]. Spleen weight was assessed on day 8 after dissection. Spleen weights of IMQ-treated mice were 2-fold higher than that of the vehicle-treated control group of animals. Spleen weights and ear biopsy punch weights of the IMQ + baricitinib-treated group were significantly lower than those of the IMQ [Figure 5b].
Figure 5
Baricitinib treatment ameliorated IMQ induced psoriasis: (a) Topical application of baricitinib at 300 μg/20 μl/animal in mice experienced significant reduction in ear thickness when compared to IMQ treated control. (b) The spleen weight and weight of ear biopsy punch of the IMQ + Baricitinib group was significantly lower than those of the IMQ. (c) Representative images: Morphological analysis of inflamed ear and skin treated with IMQ alone and combination of IMQ and baricitinib compared with control. (d) Hematoxylin and eosin (H and E) staining of mouse ear from IMQ alone and combination of IMQ and baricitinib compared with control, reflecting the hallmarks of psoriasis with abnormally thickened epidermis, thickened keratinized upper layer (hyperkeratosis (double-headed arrow) and increased immune cell influx. Scale bars = 100 μm (e) Gene expression analysis of the ear tissue was performed, Cytokine genes IL-22, IFN γ, IP-10, IL-6, TNF α, IL-1 and KRT-17 were elevated along with PD-1 and PD-L1 in IMQ alone group, Baricitinib treatment significantly reduced the pro-inflammatory gene and expression profile of immune checkpoints as compared to IMQ treated group. Compared with control: #P < 0.05, ##P < 0.01, ###P < 0.001 and when compared with IMQ group: *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: Imiquimod
Baricitinib treatment ameliorated IMQ induced psoriasis: (a) Topical application of baricitinib at 300 μg/20 μl/animal in mice experienced significant reduction in ear thickness when compared to IMQ treated control. (b) The spleen weight and weight of ear biopsy punch of the IMQ + Baricitinib group was significantly lower than those of the IMQ. (c) Representative images: Morphological analysis of inflamed ear and skin treated with IMQ alone and combination of IMQ and baricitinib compared with control. (d) Hematoxylin and eosin (H and E) staining of mouse ear from IMQ alone and combination of IMQ and baricitinib compared with control, reflecting the hallmarks of psoriasis with abnormally thickened epidermis, thickened keratinized upper layer (hyperkeratosis (double-headed arrow) and increased immune cell influx. Scale bars = 100 μm (e) Gene expression analysis of the ear tissue was performed, Cytokine genes IL-22, IFN γ, IP-10, IL-6, TNF α, IL-1 and KRT-17 were elevated along with PD-1 and PD-L1 in IMQ alone group, Baricitinib treatment significantly reduced the pro-inflammatory gene and expression profile of immune checkpoints as compared to IMQ treated group. Compared with control: #P < 0.05, ##P < 0.01, ###P < 0.001 and when compared with IMQ group: *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IFNγ: Interferon gamma, TNFα: Tumour necrosis factor-α, IL: Interleukin, IMQ: ImiquimodHistopathological examination of ear pinna showed psoriasis-like lesions that developed over the course of IMQ treatment. Dense dermal infiltrate, thickening of epidermis, acanthosis, parakeratosis, and hyperkeratosis are seen, which are typical histopathological hallmarks of human psoriatic disease. A histological review showed that baricitinib decreased inflammatory infiltration in the mouse ear and reduced hyperkeratosis [Figure 5d].Gene expression levels of cytokines playing a pivotal role in this system was determined to assess the involvement of checkpoint axis in the production of IMQ-induced inflammation in the mice. Ear samples were processed for studying the expression of psoriatic markers, inflammatory markers, and immune checkpoint markers like PD-1 and PD-L1. Gene expression analysis of the ear tissue was performed and the previous findings of IL-17 axis involved in the disease were confirmed. Cytokine genes IL-22, IFNγ, IP-10, IL-6, TNFα, and IL-17 were elevated along with KRT-17. It is interesting to know than even PD-1 and PD-L1 mRNA levels were elevated. With the exception of IL-17, baricitinib treatment significantly reduced all the pro-inflammatory gene expressions as compared to IMQ-treated group. Baricitinib-treated group also shows the reduced expression profile of immune checkpoints [Figure 5e].Protein expression analysis by western blotting shows elevated levels of KRT-17 and pSTAT3 in IMQ-treated groups and these are the markers for keratinocyte/immune cell proliferation. However, with baricitinib treatment, the level of KRT-17 and p-STAT3 was significantly reduced [Figure 6a]. Down-regulation of KRT-17 and pSTAT3 coincided with the down-regulation of PD-1 and PD-L1 levels [Figure 6b]. Cytokine analysis from the ear homogenate showed elevated levels of IL-17, IL-6, TNFα, and IL-1 β in the IMQ-treated group as compared to the control group. Baricitinib treatment significantly reduced the elevated cytokine levels [Figure 6c].
Figure 6
Effect of Baricitinib treatment on protein expression and cytokine production: (a) Protein expression analysis by western blotting shows Baricitinib downregulates elevated levels of PD-1, PD-L1, KRT-17, pSTAT3 and STAT3 in comparison with IMQ treated groups. (b) Densitometry analysis of the blots shows significant downregulation of PD-1, PD-L1, KRT-17 and p-STAT3 when compared to IMQ-treated group. (c) Cytokine analysis from the ear homogenate showed elevated levels of IL-17, IL-6, TNF and IL-1 beta in the IMQ treated group, the same were downregulated in Baricitinib-treated group. Compared with control: #P < 0.05, ##P < 0.01, ###P < 0.001 and when compared with IMQ group: *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IMQ: Imiquimod
Effect of Baricitinib treatment on protein expression and cytokine production: (a) Protein expression analysis by western blotting shows Baricitinib downregulates elevated levels of PD-1, PD-L1, KRT-17, pSTAT3 and STAT3 in comparison with IMQ treated groups. (b) Densitometry analysis of the blots shows significant downregulation of PD-1, PD-L1, KRT-17 and p-STAT3 when compared to IMQ-treated group. (c) Cytokine analysis from the ear homogenate showed elevated levels of IL-17, IL-6, TNF and IL-1 beta in the IMQ treated group, the same were downregulated in Baricitinib-treated group. Compared with control: #P < 0.05, ##P < 0.01, ###P < 0.001 and when compared with IMQ group: *P < 0.05, **P < 0.01, ***P < 0.001. PD-1: Programmed death 1, PD-L1: Programmed cell death ligand 1, IMQ: Imiquimod
Discussion
The study has demonstrated three major findings. First, surface expression of PD-L1 in HaCaT cells up-regulated by IFNγ that is negatively impacted by baricitinib indicates the involvement of JAK/STAT pathway in PD-L1 up-regulations by IFNγ. Second, baricitinib is able to modulate levels of cytokines associated with psoriatic pathogenesis in IMQ-induced model. Reduction in levels of pathogenic cytokines may have been associated with disease alleviation in the treated group. Third, low PD-1/PD-L1 generally associated with increased disease magnitude appears to have no impact on disease severity. The study has addressed the effect of baricitinib in IMQ-induced psoriasis on PD-L1 expression in mice.The activation of T-cells is a crucial regulatory feature of the adaptive immune response. T-cell activation involves at least two signals. The first one involves an interaction on the antigen-presenting cell between the T-cell receptor and the main histocompatibility complex, and the second signal is a co-stimulation that could be stimulating or inhibitory.[9] After TCR-mediated activation, PD-1 is upregulated on lymphocytes and remains elevated in the context of the persistent Ag-specific immune stimulation. PD-1 up-regulation in PBMC using anti-CD3/CD28 and PMA/Ionomycin has been demonstrated.[10] The finding of this study also falls in line with the activation state induced by antiCD3/CD28 and PMA/Ionomycin. The triggered immune response can be classified as responses of type 1 (TH1), 2 (TH2) or 17 (TH17) based on the cytokines secreted from CD4+ T cells of the effector. The pathophysiology of psoriasis is regulated by an immune response IL-17A+ Th17.[11] Studies have also established that hyperproliferation and abnormal differentiation of keratinocytes is a secondary phenomenon induced by immune activation. Activated T lymphocytes are required for the development and persistence of immune responses in psoriatic skin.[12]IFNγ-induced KRT-17 expressions in HaCaT have been studied widely in the in vitro model of psoriasis. IFNγ is released by activated T-cells and natural killer cells, and adaptive immune responses are thus regulated. The JAK-STAT pathway is crucial for downstream cytokine signaling. Multiple cytokines are strongly expressed via the JAK/STAT pathway in psoriatic skin lesions and these include IL-6, IL-17, IFNγ, IL-19, IL-20, IL-22, and IL-23.[13] STAT1 and STAT3, JAK signaling proteins are highly elevated in keratinocytes and are considered to play a key role in the pathogenesis of psoriasis.[14] IFNγ can use JAK/STAT1 pathway to up-regulate KRT17 expression. K17 is considered a hallmark of psoriasis since it is over-expressed in the lesional psoriatic epidermis but is not present in healthy epidermis.[15] In this study, up-regulation of KRT17 has been noted on IFNγ treatment. Further treatment with baricitinib was successful in modulating the level of KRT17 expression. Although elevated PDL-1 levels are known to be protective against psoriasis, yet data from this study shows a decrease in the levels following baricitinib treatment. It is hypothesized that IFNγ-induced PDL-1 is related with the activation status of the cells and hence not indicative of disease protection.IL-6, produced by activated DCs is a key factor in promoting differentiation of Th17 via STAT3 and orphan receptor-related retinoic acid induction with IL-23 essential for in vivo memory function Th17.[16] The Th17 network has recently emerged as a major component in the pathogenesis of psoriasis and includes IL-23 and IL-22. The signaling of IL-22 and IL-23 is based on the protein tyrosine kinases family JAK.[17] These findings suggest that activation markers, which express T-cells, are involved in the initiation and progression of psoriasis lesions. Consequently, deregulated PD-1 signaling pathways may sustain chronic inflammation and promote auto-inflammatory changes.[18] Studies have also shown that elevated PD-1 and PD-L1ares protective against autoimmune disorder such as psoriasis. However, in this study, on baricitinib treatment, elevated PD-1 and PD-L1 expression levels, which is indicative of their role in protecting against the disease was not observed. It is hypothesized that since cytokines such as IFN and IL-17, which induce PD-1 and PD-L1 expression levels, are down-regulated by baricitinib, their decreased expressions are a consequence of down-regulated cytokines rather than being the cause of it.Reduced expressions of both PD-L1 and PD-L2 in the psoriatic epidermis have been observed as compared to healthy controls. It has been proposed that decreased expression of PD-L1 and PD-L2 could have resulted from impairment of the psoriasis Treg system, which could allow continuous activation of T-cells. It is likely that keratinocytes can interact with PD-1 on T-cells in psoriatic PD-L1 and PD-L2, and modulate the immune response.[2] It has reported that expression of PD-1/PD-1 ligand does not have a negative effect on T-cells to function, extend or survive in response to more γc cytokine exposure, but makes them susceptible to PD-1 ligand-mediated TCR-induced function suppression.[19] CD3+PD-1+ T-cells percentage in the patients was also noted to be higher than in the healthy controls. No correlation between PD-1 expressing T-cells and PASI levels has been found.[20] There is also no correlation between CD4+ PD-1+ or CD8+ PD-1+ T-cells and the clinical properties of psoriasis.[21]PD-1 modulation of immune responses may depend on the type of co-stimulating signal being delivered, the cytokine milieu, and the signaling pathways activated in responding cell. PD-1 with co-stimulatory signals induces high levels of IL-2 and cannot attenuate immune responses. Findings also suggest that the expression of non-T-cell-derived cytokines such as IL-15 can overcome PD-1 inhibition at peripheral sites of inflammation.[22]STAT activity is commonly correlated with changes in Pdcd1's chromatin structure and increases the expression of PD-1 in spleen CD8 T-cells. The regulatory regions NFATc1/STAT interact with the promoter region of the Pdcd1 gene and increase the expression of PD-1 after cytokine stimulation.[8] Alit has been observed that elevation of both IL-17A and IL-22 leads to increased dermal inflammation, epidermal acanthosis, and neutrophilic abscess formation in PD-1 deficient (PD-1KO) mice after IMQ application. PD-L1 is up-regulated on keratinocytes during IMQ treatment and potentially suppresses activation of GDL T-cells through its interaction with PD-1.[23]Tofacitinib is an oral JAK inhibitor that is used to treat rheumatoid arthritis by a mechanism that is different from that of conventional biological therapies. The drug may alter the immune system's ability to combat infections like herpes zoster. In addition, opportunistic infections and cancer have also been recorded in users.[24] Baricitinib is an orally active inhibitor of Janus kinase (JAK), used to treat mild to extreme rheumatoid arthritis. Baricitinib has also been used to treat atopic dermatitis, psoriasis, and alopecia isata.[25] Patients with mild to serious symptoms treated with baricitinib experienced significant improvements in PASI-75 for 12 weeks.[26] Recently, Baricitinib-induced PPP, which could be a result of JAK-1/3 inhibition, has been reported. It can result in down-regulation of IL-1 and IL-8, which are potential mediators of PPP.[25]
Conclusion
In this study, a correlation between JAK/STAT and up-regulated expression of PD-1 and PD-L1, in conditions mimicking psoriasis, has been demonstrated. In activated PBMC proliferation and IFNγ release were attenuated by Baricitinib treatment. Baricitinib, inhibited expression of psoriatic markers such as KRT-17, ICAM, and pro-inflammatory cytokines IL-6, TNF α and IL-1 β in IFNγ challenged HaCaT cells. It was interesting to see inhibition of PD-1 and PD-L1 by baricitinib treatment in IMQ-treated mice model implicating that they are not immunosuppressive in this context. These data support the role of PD-1 and PD-L1 as T cell/stromal cell activation markers, which arise in response to cytokines such as IFNγ with no apparent role to play in disease modulation, in the IMQ model. In fact, it suggests that in this acute model of psoriasis, PD-L1 is less representative of immune suppression, which it is normally associated with and more representative of T-cell-associated surrogate activation marker, which exhibits no causal relationship. Overall, this study demonstrates that Baricitinib-regulated PD-1/PD-L1 levels are not prognostic in nature. In contrast, this data supports their behavior as a treatment-associated therapeutic biomarker. A more relevant chronic model of psoriasis is required to establish or discount the role of PD-L1/PD-1 in pathogenesis.
Authors: Rachel Rosenthal; Célia Groeper; Laura Bracci; Michel Adamina; Chantal Feder-Mengus; Paul Zajac; Giandomenica Iezzi; Martin Bolli; Walter P Weber; Daniel M Frey; Urs von Holzen; Daniel Oertli; Michael Heberer; Giulio C Spagnoli Journal: J Immunother Date: 2009-04 Impact factor: 4.456
Authors: Hector M Granados; Andrew Draghi; Naomi Tsurutani; Kyle Wright; Marina L Fernandez; Francisco A Sylvester; Anthony T Vella Journal: PLoS One Date: 2017-09-06 Impact factor: 3.240