High-level gentamicin resistance mediated by Aac(6')-Ie-aph(2")-Ia gene in Enterococcus species isolated from clinical samples in Northern India.

CONTEXT: Enterococci are known to cause life-threatening infections which are difficult to treat as the organism harbors innate resistance to many antibiotics and can amass resistance toward many others through plasmid-mediated genetic exchange. AIMS: The study evaluates the drug susceptibility profile of various Enterococcus species isolated from various patient specimens submitted for bacteriological analysis and check the incidence of aac(6') Ie-aph(2") Ia gene. SETTING AND
DESIGN: This in vitro cross-sectional study was executed at bacteriology laboratory of a 470 bedded hospital in New Delhi.
MATERIALS AND METHODS: Drug susceptibility testing was carried out on enterococcal isolates. High-level gentamicin-resistant (HLGR) isolates detected by micro broth dilution assay were then subjected to molecular detection of aac(6') Ie-aph(2") Ia gene. STATISTICAL ANALYSIS USED: The level of significance was established by Chi-square test.
RESULTS: Among the 182 enterococcal stains detected, 76.9% were Enterococcus faecalis and 20.3% were Enterococcus faecium. 12.08% strains were vancomycin resistant. 39% expressed resistance toward high-level gentamicin (HLG) and this finding was significantly higher in E. faecium than E. faecalis. HLGR strains expressed a higher degree of resistance to other drugs in contrast to non-HLGR isolates. In 67 out of 71 HLGR isolates the bifunctional gene was detected.
CONCLUSION: Considerable presence of HLG and vancomycin resistance in the clinical isolates is alarming and should be taken seriously. The study shows high dissemination of aac(6')-Ie-aph(2")-Ia gene among Enterococci isolated from the region.

Introduction

Enterococcus is ubiquitous in nature and has established itself as a potent bacterial pathogen causing life-threatening infections. Its significance as a hospital-acquired pathogen can be attributed to its high resistance toward various drugs. Enterococcus faecium and Enterococcus faecalis stand out as the two most pathogenic species and are well known to cause various infections including endocarditis, genitourinary, and gastrointestinal infections.[1]

Infection by Enterococci are challenging therapeutically as the organism harbors innate resistance toward many antimicrobials and may amass resistance toward many other antibacterial drugs through plasmid transfer or transposons.[2] Enterococci show intrinsic resistance toward number of antibiotics including cephalosporins, clindamycin, aztreonam, nalidixic acid, trimethoprim-sulfamethoxazole, and fluoroquinolones.[3]

Owing to the impermeability of its cell wall, Enterococci are generally resistant to low concentrations of aminoglycosides (3 mg/kg/day). The intrinsic resistance can also be due to the presence of chromosomal acetyl-transferase enzymes. Aac(6’)-Ii enzyme confers resistance to tobramycin and kanamycin in E. faecium.[1] High-level gentamicin-resistant (HLGR) in Enterococci is not intrinsically mediated but acquired through plasmid-mediated gene transfer.[1] The most common cause of high-level gentamicin (HLG) resistance is the acquisition of a bifunctional resistance gene called aac(6’) Ie-aph(2”) Ia, linked to transposon Tn5281 which is located at a composite plasmid and is transferable between stains. The resultant enzyme produced in resistant bacteria modifies all aminoglycosides except streptomycin and arbekacin. The modification makes the antibiotic incapable to bind with its target, 30S ribosomal subunit. The gene is located in transposon Tn5281 in Enterococci. Few additional genes such as aph(2”)-Ic, aph(2”)-Id, and aph(2”)-Ib can also be accountable for HLGR. However, incidence and contribution of these genes are less when compared to the bifunctional gene, which has much higher relevance as chief contributor of gentamicin resistance in Enterococci.[45]

HLGR strains were first detected in late 1970s in France, and since then it has become a major concern in the management of serious enterococcal infections. It reduces the efficacy of otherwise successful combined therapy of cell wall active agents (penicillin group) in combination with gentamicin. Antibiotic resistance transfer between strains and across the species makes it as a serious issue mainly in a hospital setup. This study was designed to analyze the resistance profile of enterococcal isolates toward HLG and other prescribed antibiotics as per the Clinical Laboratory Standards Institute (CLSI) guidelines and further establish the incidence of the bifunctional gene in the HLGR Enterococci strains by polymerase chain reaction (PCR).

Materials and Methods

All clinical samples sent to the Microbiology laboratory, HAH Centenary Hospital, Jamia Hamdard, New Delhi, from January 2016 to December 2018, for culture and sensitivity were considered for this cross-sectional study. The specimens were subjected to standard bacteriological culture using blood agar (5% Sheep blood) and MacConkey Agar (Hi-Media, Mumbai) and were placed in incubator in presence of 5%–10% CO2 at 37°C for up to 48 h.[4] Enterococcal colonies were identified on basis of cultural and microscopic characters and were confirmed by biochemical tests such as growth on bile-esculin azide medium, growth on 6.5% NaCl brain heart infusion broth and bacitracin resistance.[6]

Drug resistance was detected by disc diffusion following the CLSI recommendations. Antibiotic discs were selected as per the CLSI guidelines for Enterococci and procured from Hi–Media, Mumbai.[3] E. faecalis, ATCC number 29212 was employed as control. VITEK-2 automated system (Biomerieux, France) was used for species determination of the isolates.

Micro-broth dilution technique was employed to detect the minimum inhibitory concentration (MIC) of HLG. A MIC >500 μg/ml was considered HLGR as per CLSI guidelines.[3] 3–5 isolated colonies were mixed with 5 ml of a Mueller Hinton broth, followed by incubation at 35°C ± 2°C for 2 to 6 h. The broth turbidity was altered to 0.5 McFarland standards. The broth was then diluted to bacterial concentration of 1 × 106 colony-forming unit/ml approximately. 50 μl of the broth was inoculated in each well of the round bottom microtiter plate followed by 50 μl of various dilutions of antibiotic. Two wells in each row were used as control. One well contained 100 μl of inoculum (without antibiotic) and another had 100 μl of sterile broth. The tray was sealed with aluminum foil and placed at 35°C ± 2°C for 16–20 h in an incubator. The lowest drug concentration that completely stopped the bacterial growth, as detected by the unaided eye, was recorded as MIC.

DNA was extracted from enterococcal isolates by heating centrifugation method.[7] The primer sequences utilized for the aac (6′)-Ie-aph (2”)-Ia gene amplification were - F: CAGAGCCTTGGGAAGATGAAG, R: CCTCGTGTAATTCATGTTCTGGC.[8] Commercially available ready-to-use master mix bearing 1X PCR buffer, 3.5 milliMolar MgCl2, 2.5U Taq DNA polymerase, 0.2 milliMolar deoxyribonucleotide triphosphate mix and 3 μl of DNA template (10 μg/ml) was used. DNA amplification was done in PCR thermocycler (2720 thermal cycler, Applied Biosystems), set with standard thermal profile as: primary denaturation at 94°C for 10 min, subsequent 25 cycles of amplification (94°C for 60 s, 55°C for 60 s and 72°C for 60 s), and an extension run for 5 min at 72°C. E. faecalis ATCC number 51,299 (HLG resistant) and 29,212 (HLG sensitive) were utilized as positive control and negative control, respectively.

Electrophoresis of the amplified products was done on a 1.5% agarose gel with ethidium bromide on Sub-Cell GT electrophoresis apparatus (Bio-Rad, USA) at 100 Volts. 100-bp DNA ladder of 100-bp was used as standard for gel electrophoresis and the presence of 348 bp band was considered as indicator for existence of the bifunctional gene. The result was visualized using Gel Doc system (Bio-Rad, USA). The statistics analysis was of the information generated was executed through IBM SPSS Statistics for Windows, Version 25.0. Armonk, NY,US: IBM Corp. The degree of significance was determined among variables with the help of Chi-square test (significant at P ≤ 0.05).

Results

Out of the various clinical samples processed, a total of 182 Enterococcus strains were obtained, mostly from urine (64.8%). Most of these isolates were E. faecalis (76.9%). E. faecium was isolated in far lesser numbers and few isolates were of other species (3 E. avium, 1 E. gallinarum, and 1 E. durans).

Out of the 182 enterococcal isolates, most showed resistance toward penicillin (80.2%). Resistance toward fluoroquinolone antibiotics was around 69%. All strains were sensitive to daptomycin and just one isolate expressed resistant toward linezolid [Table 1]. Twenty-two strains were found to be vancomycin resistant. Out of these, 16 strains expressed resistance toward teicoplanin indicating vanA phenotype and remaining 6 strains were sensitive to teicoplanin indicating vanB phenotype. When resistance pattern was compared in between the two most pathogenic species, E. faecium showed significantly higher percentage of resistance toward amoxicillin, amoxicillin-clavulanic acid, and nitrofurantoin in comparison to E. faecalis (P < 0.05).

Table 1

Antibiotics resistance pattern of Enterococcal isolates

Antibiotic	All species (n=182), n (%)	E. faecalis (n=140), n (%)	E. faecium (n=37), n (%)	Other species (n=5), n (%)
Amoxicillin	138 (75.8)	103 (73.5)	33 (89.1)	2 (40)
Ampicillin - clavulanic acid	51 (28.02)	34 (24.2)	17 (45.9)	0
Chloramphenicol	59 (32.4)	43 (30.7)	16 (43.2)	0
Ciprofloxacin	126 (69.2)	96 (68.5)	29 (78.3)	1 (20)
Erythromycin	119 (65.3)	86 (61.4)	28 (75.6)	4 (80)
High level gentamicin	71 (39.0)	50 (35.7)	21 (56.7)	0
Levoflocxacin	120 (65.9)	90 (64.2)	29 (78.3)	1 (20)
Linezolid	1 (0.54)	0	1 (02.7)	0
Nitrofurantoin	46 (25.2)	30 (21.4)	16 (43.2)	0
Norfloxacin	129 (70.8)	99 (70.7)	29 (78.3)	1 (20)
Penicillin	146 (80.2)	109 (77.8)	34 (91.8)	3 (60)
Teicoplanin	16 (08.7)	12 (08.5)	4 (10.8)	0
Tetracycline	126 (69.2)	98 (70)	25 (67.5)	3 (60)
Tigecycline	9 (04.9)	7 (05)	2 (05.4)	0
Vancomycin	22 (12.08)	16 (11.4)	6 (16.2)	0

E. faecalis=Enterococcus faecalis, E. faecium=Enterococcus faecium

By micro-broth dilution assay, 71 isolates were confirmed as HLG resistant (MIC >500 μg/ml). Out of these 71 HLGRs, for 56 isolates, HLG MIC was ≥500 - <1000 μg/ml (86% E. faecalis and 62% E. faecium). For other 12 isolates the MIC was ≥1000 - <2000 μg/ml (14% E. faecalis and 24% E. faecium) and HLG MIC was ≥2000 μg/ml for the remaining 3 isolates [Figure 1]. All the isolates with MIC >2000 were found to be E. faecium. The incidence of HLGR among E. faecium (56.7%) was significantly higher than E. faecalis (35.7%).

Figure 1

Division of HLGR Enterococcal isolates as per Minimum inhibitory concentration

Table 2 elaborates the difference in resistance pattern of the HLGR and non-HLGR isolates. Resistance of over 90% was seen against β-lactam antibiotics (amoxicillin and penicillin) and fluoroquinolones (levofloxacin, ciprofloxacin, and norfloxacin) in case of HLGR isolates. Most of the vancomycin-resistant Enterococci (VRE) isolates were also found to be HLGR. Resistance toward all antibiotics was significantly higher (P < 0.05) for HLGR isolates than non-HLGRs.

Table 2

Antibiotic resistance pattern of high level gentamicin resistance and nonhigh level gentamicin resistance strains

Antibiotics	HLGR (n=71), n (%)	Non-HLGR (n=111), n (%)	P (significant at P<0.05)
Amoxicillin	67 (94.3)	71 (63.9)	0.000007
Penicillin	68 (95.7)	78 (70.2)	0.000058
Norfloxacin	64 (90.1)	62 (55.8)	0.000002
Erythromycin	59 (83.0)	60 (54.05)	0.00026
Vancomycin	18 (25.3)	4 (3.6)	0.00003
Teicoplanin	13 (18.3)	3 (02.7)	0.0007
Linezolid	1 (01.4)	0	-
Daptomycin	0	0	-
Ciprofloxacin	66 (92.9)	60 (54.05)	0.000001
Levoflocxacin	64 (90.1)	56 (50.4)	0.000001
Ampicillin - clavulanic acid	34 (47.8)	16 (14.4)	0.000002
Nitrofurantoin	32 (45.07)	14 (12.6)	0.000002
Tetracycline	57 (80.2)	68 (61.2)	0.011
Tigecycline	7 (09.8)	2 (01.8)	0.036
Chloramphenicol	34 (47.8)	25 (22.5)	0.0006

HLGR=High level gentamicin resistance

PCR followed by electrophoresis of the amplified product detected bands of 348 bp. Of 71 HLGR isolates confirmed by micro broth dilution, 67 carried aac (6′)-Ie-aph (2”) Ia gene [Figure 2]. Among these 67 strains, 49 isolates were E. faecalis and 18 isolates were E. faecium. All the vancomycin-resistant strains that were HLGR too, carried the bifunctonal gene. Out of the 4 isolates in which bifunctional gene was not found, 2 isolates (1 E. faecalis and 1 E. faecium) had HLGR MIC ≥1000 μg/ml and 2 isolates of E. faecium had HLGR MIC ≥2000 μg/ml [Table 3].

Figure 2

Division of HLGR Enterococcal isolates as per Minimum inhibitory concentration. HLGR: High-level gentamicin-resistant, E. faecium: Enterococcus faecium, E. faecalis: Enterococcus faecalis

Table 3

Distribution of aac(6’)-Ie-aph(2″)-Ia among the high level gentamicin resistance isolates

PCR	Enterococcal spp.	Total isolates	HLG MIC (µg/ml)	Number of strains
aac (6’)-Ie-aph (2″)-Ia gene detected	E. faecium	18	≥500	13
			≥1000	4
			≥2000	1
	E. Fecalis	49	≥500	43
			≥1000	6
			≥2000	0
aac(6’)-Ie-aph (2″)-Ia gene not detected	E. faecium	3	≥500	0
			≥1000	1
			≥2000	2
	E. Fecalis	1	≥500	0
			≥1000	1
			≥2000	0

E. faecalis=Enterococcus faecalis, E. faecium=Enterococcus faecium, HLG=High-level gentamicin, MIC=Minimum inhibitory concentration, PCR=Polymerase chain reaction

Discussion

The significance of Enterococcus as a serious pathogen has grown over the years throughout the world. From urinary tract infection to life-threatening septicemia, Enterococcus has been attributed to infect nearly all body sites.[1] As per the present study, the most common site of enterococcal infection is urinary tract. This is in accordance with findings throughout the world.[1] The second-most common source was pus from different infected body sites. Enterococcal bloodstream infections are very common but unlike other studies, only a few cases of enterococcal bacteremia were detected during the study. Detection of the bacterial strain is important as the virulence along with drug resistance characteristics vary according to species. Worldwide, the rate of infection by E. faecalis is higher than E. faecium but the latter is known to show a higher resistance profile toward many drugs such as aminoglycosides and vancomycin.[1] In the present study, isolation rate was more than two and half times higher for E. faecalis than E. faecium. This pattern is comparable to many other studies conducted across India.[910]

The isolates in the present study expressed high resistance toward β-lactam drugs. Many Indian and International research studies have presented similar results across the world.[1112] As a part of its intrinsic resistance mechanism, Enterococci is known to express penicillin-binding proteins (PBP) with decreased affinity to β-lactam antibiotics, causing low-level resistance toward penicillin group and moderate to high-level cephalosporin resistance.[1] High-level penicillin resistance can be acquired through plasmid-mediated bla gene (for β lactamase production) or due to point mutation in the penicillin-binding region of PBP57. Enterococci showed considerable amount of fluoroquinolone resistance. The presence of efflux pumps reduces the drug accumulation. Resistance may also be due to the acquisition of plasmid-mediated Qnr genes (codes for Qnr proteins that activate efflux pumps and alters quinolone target enzymes) or owing to mutation of ParC or gyrA genes.[13] In the present study, resistance toward fluoroquinolones was just below 70%. The result is considerably higher than that obtained by Chakraborty et al. in a study conducted in 2015.[14] But in a recently conducted study in Delhi, the percentage of ciprofloxacin resistance was much higher at 96%.[15] High degree of resistance was also seen toward erythromycin and tetracycline. Resistance toward erythromycin and other macrolides arise due to modification of the 23S rRNA target by expression of ermB and other methylase genes. Resistance toward tetracycline is due to efflux pumps and expression of chromosomal genes such as tetM, tetO, and tetS that confer resistance to tetracycline and can be transferred through Tn916 transposon.[16] In the current study, most isolates were sensitive toward linezolid, similar to many other studies conducted around the world.[1718] Enterococci express vancomycin resistance due to the expression of low-affinity peptidoglycan receptors In the resistance strains, a D-Alanine unit of peptide side chain is replaced by D-Lactate or D-Serine. These altered moieties have 7–1000 times less affinity toward vancomycin.[16] Many genes (Van A to G and newer van L, van M and van N) are responsible for glycopeptides resistance.[1] In the present study, around 12% isolates were vancomycin resistant. In the 2017 study conducted in Delhi, the isolation rate of VRE was 22%.[15] Even higher isolation was documented by Banerjee et al. in 2015, in the neighboring state of Uttar Pradesh.[6] Overall, the resistance percentage of E. faecium toward amoxicillin, HLG, amoxicillin-clavulanic acid, and nitrofurantoin was significantly higher than that of E. faecalis. E. faecium exhibits higher resistance toward many antibiotics in comparison to E. faecalis has been noticed in other studies.[19]

The isolates showed 39% resistance toward HLG. The finding is considerably higher than similar studies conducted in Delhi.[2021] In a study published in 2016 from Rotak, Haryana, the HLG resistance was 29%.[22] However, a study conducted in 2014 at Chennai[18] and another at Rajasthan[23] showed 42% and 53% HLGR isolation, respectively. The incidence of HLGR amid E. faecium was significantly higher in comparison to E. faecalis. This can be attributed to hyper mutability of its genes and higher capacity to alter its metabolism under selective pressure.[16] Moreover, the presence of chromosomally encoded enzyme in all strains increases its drug-resistant profiles.[15]

The resistance toward many antibiotics was significantly elevated among the HLGR strains when analyzed against to non-HLGR isolates. In most cases, this may be due to presence of different resistance genes on the same transferable plasmid.[24] The results were comparable to the findings of Mathur in 2016.[23]

The MIC for HLG obtained by micro broth dilution assay showed that for most enterococcal isolates (78.8%) gentamicin MIC value was ≥500 μg/ml. HLG MIC was ≥1000 μg/ml and ≥2000 μg/ml for 17.9% and 04.4% resistant isolates, respectively. As per many studies done around the world, the HLG MIC was found to be between 500 and 1000 among most isolates.[1625]

PCR revealed 67 out of 71 HLGR strains (94%) harbored aac (6′)-Ie-aph (2”)-Ia gene. Dadfarma et al. from Iran obtained similar result where all but one HLGR isolates carried the bifunctional gene.[26] Padmasini et al. found the bifunctional gene in 68 out of 76 HLGR isolates.[27] Many studies have shown aac (6′)-Ie-aph (2”) Ia as the principle gentamicin resistance gene.[2829] The gene codes for acetyltransferase-phosphotransferase enzyme that phosphorylates 2’-hydroxy site of gentamicin and acetylates 6’-hydroxy site of other aminoglycosides.[1] The association of the gene with mobile genetic element causes its transfer between species and even to other genus of bacteria. The prevalence of other gentamicin resistance genes is limited and they are trivial contributors to the resistance.[5] HLG MIC for Enterococci possessing aph (2”)-Ib, aph (2”)-Ic, and aph (2”)-Id is generally ≥500 μg/ml, between 256 and 384 μg/ml and ≥2000 μg/ml, respectively.[5] In the four isolates where the bifunctional gene was not detected by PCR, the gentamicin MIC was found to be quite high. Two such isolates had MIC ≥2000 μg/ml. This may be due to the presence of resistant gene aph (2”)-Id and needs to be determined by molecular PCR studies.

Conclusion

The present study focuses on the antibiotic resistance profile of Enterococcus responsible for infections among the population of the region. E. faecalis caused infections more frequently and E. faecium is more resistant enterococcal species. This study showed increasing prevalence of HLGR Enterococci in the Northern India. Aac(6′)-Ie-aph(2”)-Ia gene remains the principle contributor for HLGR in this area. The multidrug resistance nature expressed by HLGR strains and considerable presence of VRE among the clinical isolates is alarming and should be considered as a global threat. Concrete measures to control and arrest the reach of multidrug-resistant Enterococci should be devised and implemented. Continuous monitoring to identify the antimicrobial drug resistance pattern should be done to formulate and revise the antibiotic use policies.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.