| Literature DB >> 35846563 |
Ziying Zhu1,2, Xiaona Zhang1, Haojie Hao2, Heran Xu1, Jun Shu2, Qian Hou2,3, Min Wang1.
Abstract
Wound repair is a key step in the treatment of skin injury caused by burn, surgery, and trauma. Various stem cells have been proven to promote wound healing and skin regeneration as candidate seed cells. Therefore, exosomes derived from stem cells are emerging as a promising method for wound repair. However, the mechanism by which exosomes promote wound repair is still unclear. In this study, we reported that exosomes derived from umbilical cord mesenchymal stem cells (UC-MSCs) promote wound healing and skin regeneration by treating cutaneous nerve damage. The results revealed that UC-MSCs exosomes (UC-MSC-Exo) promote the growth and migration of dermal fibroblast cells. In in vitro culture, dermal fibroblasts could promote to nerve cells and secrete nerve growth factors when stimulated by exosomes. During the repair process UC-MSC-Exo accelerated the recruitment of fibroblasts at the site of trauma and significantly enhanced cutaneous nerve regeneration in vivo. Interestingly, it was found that UC-MSC-Exo could promote wound healing and skin regeneration by recruiting fibroblasts, stimulating them to secrete nerve growth factors (NGFs) and promoting skin nerve regeneration. Therefore, we concluded that UC-MSC-Exo promote cutaneous nerve repair, which may play an important role in wound repair and skin regeneration.Entities:
Keywords: cutaneous nerve regeneration; exosome; nerve growth factor; regeneration; umbilical cord mesenchymal stem cells; wound repair
Year: 2022 PMID: 35846563 PMCID: PMC9279568 DOI: 10.3389/fncel.2022.913009
Source DB: PubMed Journal: Front Cell Neurosci ISSN: 1662-5102 Impact factor: 6.147
Sequences of primers used for quantitative RT-PCR analysis.
| Primer | Forward | Reverse |
| VIPR1 | TCATCCGAATCCTGCTTCAGA | AGGCGAACATGATGTAGTGTACT |
| CALCB | CACCTGTGTGACTCATCGGC | GGGCACGAAGTTGCTCTTCA |
| TACR1 | TTGGCGTAGTTGTCGCGTTG | CGCGAATTAACTACGCACGA |
| TAC2 | AGGGAGGGAGGCTCAGTAAG | GGCGGCTGTAGAGTC |
| TAC4 | GAAGACGCTGCATGTATTG | CATATGCCATGACACATGCAG |
FIGURE 1Culture and identification of UC-MSCs. (A) Culture of UC-MSCs. Scale bar = 100 μm. (B) Flow cytometry analysis showed that UC-MSCs were positive for CD105, Thy1 and CD73, but negative for CD79a, CD45 and CD14.
FIGURE 2Extraction and identification of UC-MSC-Exo. (A) Expression of exosome markers (CD63 and CD81) examined by western blot analysis. (B) Representative images showing the morphology of UC-MSC-Exo by transmission electron microscopy. Scale bar = 100 nm. (C) The Brownian movement of the UC-MSC-Exo. (D) NTA analysis demonstrating the diameter of exosomes which ranged from 56.07 to 115.71 nm, with a mean diameter of 75.66 nm.
FIGURE 3UC-MSC-Exo promote the growth of skin fibroblasts. (A) Scratch wound assay for HDFs treated with UC-MSC-Exo in three time points. (B) Statistical analysis of migration rates. ****p < 0.0001. Error bars indicate SDs of triplicate samples in a single representative experiment. SD, standard deviation. (C) The morphology of HDFs. Scale bar = 100 μm. (D) The immunofluorescence images of vimentin and β-tubulin. HDFs were immunolabeled for vimentin (green) and β-tubulin (red), and nucleic acid was signed with DAPI (blue). Scale bar = 50 μm.
FIGURE 4UC-MSC-Exo promote skin fibroblasts to secrete neural factors. The mRNA expression levels of TAC4 (A), TAC2 (B), CALCB (C), VIPR1 (D), TACR1 (E), which were quantified by quantitative real-time RT-PCR. **p < 0.01, ****p < 0.0001. Error bars indicate SDs of triplicate samples in a single representative experiment.
FIGURE 5UC-MSC-Exo accelerates wound healing. (A) Representative images of the wound healing process in mice treated with control and MSC-Exo. (B) Wound healing situation in mice at 7 days. (C) Wound healing rate of experimental and control group. ***p < 0.0001, ****p < 0.0001. (D) Comparing of wound healing time after treatment with or without MSC-Exo. ****p < 0.0001. Histological features during healing of full-thickness skin wounds from normal mouse skin (E), control mouse (F) and MSC-Exo mouse (G). (H) Quantitative analysis of crawling distance after 14 days post-wounding. ****p < 0.0001, compared with the control group. Error bars indicate SDs of triplicate samples in a single representative experiment.
FIGURE 6Nerve regeneration was analyzed by immunofluorescence staining. The full-thickness skin wounds of control group (A) and experimental group (B) were immunostained for PGP9.5 (red), GAP43 (green) and nucleic acid was signed with DAPI (blue). Scale bar = 50 μm.
FIGURE 7Schematic representation of UC-MSC-Exo promoting wound healing and nerve regeneration.
The role of growth factors in cutaneous wound healing.
| Growth factors | Main function | References |
| EGF | Re-epithelialization | |
| TGF-α | Induces angiogenesis |
|
| TGF-β | Inflammation | |
| VEGF | Granulation tissue formation | |
| PDGF | Granulation tissue formation | |
| bFGF | Re-epithelialization | |
| IGF | Re-epithelialization |
The role of neurotrophic factors.
| Neurotrophic | Main function | References |
| NGF | Nerve regeneration | |
| BDNF | Re-epithelialization/keratinocyte proliferation | |
| GDNF | Schwann cell proliferation | |
| Neurotrophin-3 | Growth, proliferation, and |
|
| Substance P (SP) | Vasodilatation | |
| Vasoactive | Vasodilatation | |
| Cerebral dopamine neurotrophic factor (CDNF) | Nerve regeneration |
|
| Ciliary neurotrophic factor (CNTF) | Nerve regeneration |
|
| Mesencephalic astrocyte-derived neurotrophic factor (MANF) | Nerve regeneration |
|