| Literature DB >> 35846150 |
Vrantika Chaudhary1, Sumit Jangra1, Neelam R Yadav1.
Abstract
Cluster bean popularly known as "guar" is a drought-tolerant, annual legume that has recently emerged as an economically important crop, owing to its high protein and gum content. The guar gum has wide range of applications in food, pharma, and mining industries. India is the leading exporter of various cluster bean-based products all across the globe. Non-coding RNAs (miRNAs) are involved in regulating the expression of the target genes leading to variations in the associated pathways or final protein concentrations. The understanding of miRNAs and their associated targets in cluster bean is yet to be used to its full potential. In the present study, cluster bean EST (Expressed Sequence Tags) database was exploited to identify the miRNA and their predicted targets associated with metabolic and biological processes especially response to diverse biotic and abiotic stimuli using in silico approach. Computational analysis based on cluster bean ESTs led to the identification of 57 miRNAs along with their targets. To the best of our knowledge, this is the first report on identification of miRNAs and their targets using ESTs in cluster bean. The miRNA related to gum metabolism was also identified. Most abundant miRNA families predicted in our study were miR156, miR172, and miR2606. The length of most of the mature miRNAs was found to be 21nt long and the range of minimal folding energy (MFE) was 5.8-177.3 (-kcal/mol) with an average value of 25.4 (-kcal/mol). The identification of cluster bean miRNAs and their targets is predicted to hasten the miRNA discovery, resulting in better knowledge of the role of miRNAs in cluster bean development, physiology, and stress responses.Entities:
Keywords: cluster bean (Cyamopsis tetragonoloba L. Taub.); galactomannan; miRNA identification; miRNA targets; micro RNAs (miRNAs); non coding RNAs
Year: 2022 PMID: 35846150 PMCID: PMC9280363 DOI: 10.3389/fgene.2022.930113
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Workflow for identification of miRNA and their targets in cluster bean.
FIGURE 2Identified miRNA families of cluster bean which have homologues in other plant species (ath- Arabidopsis thaliana, osa-Oryza sativa, gma-Glycine max, mtr-Medicago truncatula, zma-Zea mays, vvi-Vitis vinifera, sof-Saccharum officinarum, pab-Picea abies, aly-Arabidopsis lyrata, smo-Selaginella moellendorffii, tae-Triticum aesativum, cre-Chlamydomonas reinhardtii, pta- Pinus taeda, ppt-Physcomitrella patens).
Summarized parameters of predicted miRNA families in cluster bean.
| Predicted miRNA family | AU | GC | Nucleotide content | Pre-miRNA sequence length | MFE | MFEI |
|---|---|---|---|---|---|---|
| miR1044 | 70.13 | 29.87 | A(39)U(69)G(26)C(20)N(0) | 154 | −30.3 | −0.65 |
| miR1109 | 69.93 | 30.07 | A(39)U(54)G(23)C(17)N(0) | 133 | −27.8 | −0.69 |
| miR1132 | 62.86 | 37.14 | A(10)U(12)G(8)C(5)N(0) | 35 | −12.8 | −0.98 |
| miR1134 | 66.08 | 33.92 | A(20)U(17)G(9)C(10)N(0) | 56 | −12.5 | −0.65 |
| miR1167 | 58.7 | 41.3 | A(14)U(13)G(11)C(8)N(0) | 46 | −16.2 | −0.85 |
| miR1313 | 64.9 | 35.1 | A(26)U(35)G(17)C(16)N(0) | 94 | −22.9 | −0.69 |
| miR1439 | 80.07 | 19.93 | A(240)U(233)G(50)C(68)N(1) | 592 | −75.3 | −0.63 |
| miR1527 | 63.05 | 36.95 | A(18)U(11)G(7)C(10)N(0) | 46 | −11 | −0.64 |
| miR1533 | 83.12 | 16.88 | A(35)U(29)G(8)C(5)N(0) | 77 | −9.9 | −0.761 |
| miR1535 | 42.07 | 57.93 | A(22)U(39)G(41)C(43)N(0) | 145 | −51.6 | −0.61 |
| miR156 | 56.96 | 43.04 | A(48)U(38)G(31)C(34)N(0) | 151 | −38.4 | −0.59 |
| miR168 | 47.92 | 52.08 | A(12)U(11)G(13)C(12)N(0) | 48 | −16.6 | −0.66 |
| miR169 | 56.9 | 43.1 | A(17)U(16)G(13)C(12)N(0) | 58 | −15.9 | −0.63 |
| miR172 | 62.5 | 37.5 | A(19)U(16)G(9)C(12)N(0) | 56 | −14.7 | −0.7 |
| miR1852 | 56.1 | 43.9 | A(19)U(26)G(22)C(14)N(1) | 82 | −21.9 | −0.6 |
| miR1857 | 57.78 | 42.22 | A(9)U(17)G(13)C(6)N(0) | 45 | −11.8 | −0.62 |
| miR2082 | 52.64 | 47.36 | A(12)U(18)G(19)C(8)N(0) | 57 | −18.66 | −0.66 |
| miR2098 | 65.52 | 34.48 | A(19)U(38)G(20)C(10)N(0) | 87 | −21.1 | −0.7 |
| miR2105 | 63.81 | 36.19 | A(30)U(37)G(22)C(16)N(0) | 105 | −27.7 | −0.72 |
| miR2275 | 47.7 | 52.3 | A(16)U(15)G(16)C(18)N(0) | 65 | −21.3 | −0.62 |
| miR2606 | 57.5 | 42.5 | A(10)U(13)G(9)C(8)N(0) | 40 | −10.2 | −0.6 |
| miR2628 | 41.09 | 58.91 | A(21)U(22)G(21)C(9)N(0) | 73 | −18.6 | −0.62 |
| miR2634 | 74.29 | 25.71 | A(10)U(16)G(5)C(4)N(0) | 35 | −12.3 | −1.36 |
| miR2866 | 64.95 | 35.05 | A(19)U(43(G(17)C(17)N(1) | 97 | −21.1 | −0.62 |
| miR2919 | 63.24 | 36.76 | A(21)U(22)G(16)C(9)N(0) | 68 | −22.2 | −0.888 |
| miR393 | 53.85 | 46.15 | A(11)U(17)G(13)C(11)N(0) | 52 | −16.2 | −0.67 |
| miR396 | 61.23 | 38.77 | A(10)U(20)G(10)C(9)N(0) | 49 | −16.5 | −0.86 |
| miR397 | 54.17 | 45.83 | A(8)U(18)G(10)C(12)N(0) | 48 | −14 | −0.63 |
| miR3979 | 60 | 40 | A(11)U(16)G(8)C(10)N(0) | 45 | −11.2 | −0.62 |
| miR399 | 57.15 | 42.85 | A(14)U(10)G(10)C(8)N(0) | 42 | −13.3 | −0.73 |
| miR414 | 49.11 | 50.89 | A(34)U(21)G(29)C(28)N(0) | 112 | −33.4 | −0.6 |
| miR437 | 58.74 | 41.26 | A(18)U(19)G(16)C(10)N(0) | 63 | −21.4 | −0.82 |
| miR4413 | 68.43 | 31.57 | A(21)U(31)G(17)C(7)N(0) | 76 | −14.6 | −0.6 |
| miR444 | 63.83 | 36.17 | A(8)U(22)G(10)C(7)N(0) | 47 | −10.2 | −0.59 |
| miR4995 | 42.86 | 57.14 | A(13)U(14)G(18)C(18)N(0) | 63 | −23.7 | −0.65 |
| miR5015 | 54.24 | 45.76 | A(9)U(23)G(15)C(12)N(0) | 59 | −16.9 | −0.625 |
| miR5021 | 50 | 50 | A(12)U(11)G(14)C(9)N(0) | 46 | −16.2 | −0.7 |
| miR5079 | 76.93 | 23.07 | A(25)U(35)G(8)C(10)N(0) | 78 | −11 | −0.61 |
| miR5265 | 67.22 | 32.78 | A(24)U(17)G(11)C(9)N(0) | 61 | −13.8 | −0.69 |
| miR5267 | 68.75 | 31.25 | A(42)U(46)G(21)C(19)N(0) | 128 | −37.7 | −0.94 |
| miR5338 | 61.62 | 38.38 | A(90)U(85)G(64)C(45)N(0) | 284 | −69 | −0.63 |
| miR537 | 71.43 | 28.57 | A(12)U(18)G(10)C(2)N(0) | 42 | −8.3 | −0.69 |
| miR5489 | 52.31 | 47.69 | A(18)U(16)G(18)C(13)N(0) | 65 | −20.7 | −0.66 |
| miR5542 | 67.2 | 32.8 | A(36)U(48)G(30)C(11)N(0) | 125 | −25.2 | −0.6 |
| miR5565 | 39.55 | 60.45 | A(35)U(46)G(33)C(20)N(0) | 134 | −39.6 | −0.74 |
| miR5641 | 70.28 | 29.72 | A(22)U(30)G(14)C(8)N(0) | 74 | −21.3 | −0.96 |
| miR5658 | 81.82 | 18.18 | A(14)U(22)G(7)C(1)N(0) | 44 | −5.8 | −0.72 |
| miR5662 | 51.84 | 48.16 | A(108)U(75)G(91)C(80)N(1) | 355 | −103.2 | −0.6 |
| miR773 | 53.66 | 46.34 | A(6)U(16)G(12)C(7)N(0) | 41 | −16.2 | −0.85 |
| miR779 | 57.86 | 42.14 | A(29)U(41)G(33)C(18)N(0) | 121 | −31.1 | −0.609 |
| miR781 | 68.19 | 31.81 | A(9)U(21)G(9)C(5)N(0) | 44 | −13.1 | −0.93 |
| miR837 | 54.89 | 45.11 | A(29)U(44)G(30)C(30)N(0) | 133 | −38.4 | −0.63 |
| miR838 | 49.39 | 50.61 | A(138)U(144)G(150)C(139)N(0) | 571 | −177.3 | −0.613 |
| miR863 | 63.64 | 36.36 | A(13)U(15)G(9)C(7)N(0) | 44 | −10.8 | −0.67 |
| miR865 | 76.93 | 23.07 | A(22)U(18)G(4)C(8)N(0) | 52 | −8.7 | −0.72 |
| miR867 | 81.64 | 18.36 | A(45)U(35)G(9)C(9)N(0) | 98 | −17.6 | −0.9 |
| miR902 | 68.86 | 31.14 | A(20)U(22)G(11)C(8)N(0) | 61 | −12.7 | −0.66 |
FIGURE 3Phylogenetic relationship among predicted miRNA families in cluster bean.
Major potential target genes for predicted miRNAs in cluster bean.
| miRNA | Targeted protein | Targeted EST ID | Description |
|---|---|---|---|
| miR156 | SPL4, SPL13, SBP2, SBP1, SPL5 | EG982824.1 GLL094_E10_036 | Squamosa promoter-binding-like protein |
| UBC | EG979243.1 GLL062_C07_030 | Ubiquitin-conjugating enzyme E2 | |
| miR172 | 2AAG | EG985097.1 GLE041_H10_033 | Serine/threonine-protein phosphatase |
| ARF | EG990107.1 GLE087_E01_004 | ADP-ribosylation factor | |
| miR393 | RK20 | EG987334.1 GLE062_E02_004 | 50S ribosomal protein |
| miR3979 | SPZX | EG989678.1 GLE083_C05_022 | Serpin-ZX |
| miR397 | G3PA | EG975619.1 GLL029_A09_040 | Glyceraldehyde-3-phosphate dehydrogenase A |
| miR414 | AGO1_ | EG985306.1 GLE044_A02_008 | Protein argonaute |
| ALFIN | EG986332.1 GLE052_H02_001 | PHD finger protein Alfin1, PHD finger protein ALFIN-LIKE 7 | |
| C3H2 | EG982280.1 GLL08_C06_022 | Zinc finger CCCH domain-containing | |
| CD48C | EG983335.1 GLE022_G09_034 | Cell division control protein 48 homolog C | |
| CESA6, CESA5, CESA2, CESA9, CESA9 | EG983155.1 GLE021_B02_007 | Cellulose synthase A catalytic subunit 5, Cellulose synthase A catalytic subunit 2, Probable cellulose synthase A catalytic subunit 9, Cellulose synthase A catalytic subunit 9 | |
| TGT2 | EG986117.1 GLE050_G11_042 | Trihelix transcription factor GT-2, Trihelix transcription factor GTL1, Trihelix transcription factor GTL2 | |
| miR437 | CCMC | EG985481.1 GLE045_F11_043 | Putative cytochrome c biosynthesis ccmC-like mitochondrial protein |
| miR773 | P2C | EG988418.1 GLE072_A02_008 | Protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein |
| miR837 | HMDH1 | EG988124.1 GLE06_B01_007 | 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 |
| Q8OMT | EG976284.1 GLL034_E07_028 | 8-hydroxyquercetin 8-O-methyltransferase, Isoflavone-7-O-methyltransferase 9 | |
| miR838 | NAC | EG989253.1 GLE07_B05_023 | NAC domain-containing protein 18, NAC domain-containing protein 68, NAC domain-containing protein 67, NAC domain-containing protein 29, NAC domain-containing protein 48 |
| HMA4 | EG990669.1 GLE091_H04_009 | Putative cadmium/zinc-transporting ATPase | |
| miR865 | RL | EG988689.1 GLE074_F05_019 | 60S ribosomal protein |
| miR902 | MNS2 | EG989919.1 GLE085_F05_019 | Mannosyl-oligosaccharide 1, Mannosyl-oligosaccharide 1 |
| miR1109 | AGO4 | EG986669.1 GLE056_A10_040 | Protein argonaute |
| miR1132 | CML35 | EG985964.1 GLE04_C12_046 | Probable calcium-binding protein |
| RANA1 | EG985231.1 GLE043_C03_014 | GTP-binding nuclear protein Ran-A1 | |
| miR1134 | GAST1 | EG989127.1 GLE078_H10_033 | Gibberellin-regulated protein |
| miR1439 | CML | EG985964.1 GLE04_C12_046 | Probable calcium-binding protein |
| miR1527 | CAF | EG981106.1 GLL079_F10_035 | Probable CCR4-associated factor 1 homolog 7 |
| miR1533 | GALE | EG984760.1 GLE038_G01_002 | UDP-glucose 4-epimerase GEPI42, UDP-glucose 4-epimerase, UDP-glucose 4-epimerase 1, UDP-glucose 4-epimerase 2, UDP-glucose 4-epimerase GEPI48 |
| MT | EG983379.1 GLE011_B12_047 | Metallothionein like protein | |
| JKD_ MGP,NUC | EG990549.1 GLE090_G04_010 | Zinc finger protein JACKDAW, Zinc finger protein MAGPIE, Zinc finger protein NUTCRACKER | |
| miR1857 | GALE | GO542112.1 Mdfrjg3507I06.g1 Apple_E | UDP-glucose 4-epimerase GEPI48, UDP-glucose 4-epimerase 2, UDP-glucose 4-epimerase 3, UDP-glucose 4-epimerase GEPI42, UDP-glucose 4-epimerase 1 |
| miR2098 | RS193 | EG981936.1 GLL086_H09_033 | 40S ribosomal protein |
| miR2105 | REV, HOX9, HOX9, HOX10, HOX10 | EG990607.1 GLE091_C08_030 | Homeobox-leucine zipper protein |
| miR2275 | HSP81 82 83 90-1 | EG986829.1 GLE057_F03_011 | Heat shock protein 81-1, Heat shock protein 81-3, Heat shock protein 81-2, Heat shock protein 90-1 |
| miR2628 | DXS | EG980801.1 GLL076_E12_044 | Probable 1-deoxy-D-xylulose-5-phosphate synthase |
| miR2606 | TSJT1 | EG986569.1 GLE055_B02_007 | Stem-specific protein TSJT1 |
| miR2634 | AG | EG990361.1 GLE089_H09_033 | Floral homeotic protein AGAMOUS |
| GAOX2 | EG987827.1 GLE067_C01_006 | Gibberellin 20 oxidase 2, | |
| miR4995 | RLA | EG986778.1 GLE057_B04_015 | 60S acidic ribosomal protein |
| miR5021 | 2AAB_ | EG986207.1 GLE051_F09_035 | Serine/threonine-protein phosphatase 2A |
| 3MAT 5MAT1,AGCT | EG983947.1 GLE030_E09_036 | Malonyl-coenzyme A:anthocyanin 3-O-glucoside-6″-O-malonyltransferase | |
| AGL11, AGL5, AGL1_,MAD21 | EG975055.1 GLL011_C02_006 | Agamous-like MADS-box protein, MADS-box transcription factor 21 | |
| ARI7,ARI8,ARI6_ | EG987656.1 GLE065_E09_036 | Probable E3 ubiquitin-protein ligase | |
| ASP | EG984370.1 GLE035_A02_008 | Aspartic proteinase Asp1 | |
| BGLS | EG983200.1 GLE021_E07_028 | Non-cyanogenic beta-glucosidase,Cyanogenic beta-glucosidase | |
| miR5079 | EXP13 | EG985350.1 GLE044_D07_029 | Expansin-A13 |
| miR5565 | ADLO1 | EG986858.1 GLE057_H05_017 | Protein ARABIDILLO 1 |
| miR5641 | CAX3 | EG984929.1 GLE040_C12_046 | Vacuolar cation/proton exchanger |
| miR5658 | AGL11 | EG975055.1 GLL011_C02_006 | Agamous-like MADS-box protein AGL11 |
| CSLG2 | EG976517.1 GLL036_G04_010 | Cellulose synthase-like protein G2, Cellulose synthase-like protein G1, Cellulose synthase-like protein G3 | |
| GASA4 | EG987384.1 GLE062_H11_041 | Gibberellin-regulated protein 4 | |
| GLYT3 | EG975650.1 GLL029_D02_005 | Probable glycosyltransferase | |
| HSFA9, HSF30, HFA2C,HFA6B | EG985970.1 GLE04_D05_021 | Heat stress transcription factor A-9, Heat stress transcription factor A-2e, Heat shock factor protein HSF30, Heat stress transcription factor A-2c, Heat stress transcription factor A-6b | |
| miR168 | AGO1 | EG985306.1 GLE044_A02_008 | Protein argonaute 1 |
| DHSA | EG985277.1 GLE013_C07_030 | Succinate dehydrogenase [ubiquinone] flavoprotein subunit | |
| miR169 | AL2B7 | EG983762.1 GLE029_F12_043 | Aldehyde dehydrogenase family 2 member B7 |
| miR399 | CYSK | EG985107.1 GLE042_A07_032 | Cysteine synthase |
| miR2082 | TBB | EG984572.1 GLE036_H07_025 | Tubulin beta-6 chain, Tubulin beta-3 chain, Tubulin beta-7 chain, Tubulin beta-4 chain |
| miR5662 | PIP | EG976742.1 GLL013_A03_016 | Probable aquaporin PIP1-2, AquaporinPIP1-2, Aquaporin PIP1-3/PIP1-4, Aquaporin PIP1-3, Aquaporin PIP1-1 |
| miR1535 | C3H11,C3H21 | EG979135.1 GLL061_C02_006 | Zinc finger CCCH domain-containing protein 11, Zinc finger CCCH domain-containing protein 21 |
Common targets of predicted miRNA families in cluster bean
| miRNA | Common target | Traits associated | Function |
|---|---|---|---|
| miR172, miR5021 | PP2A | Biotic and abiotic stress | Serine/threonine protein phosphatase |
| miR5021, miR838 | FRI | Iron content | Ferritin |
| miR156, miR1533, miR5021 | UBC | Pattern triggered immunity | Ubiquitin-conjugating enzyme |
| miR837,miR838, miR5021 | TRL | Role in plant tolerance of oxidative stress | Thioredoxin |
| miR5566, miR156 | TBG | Plant growth and morphogenesis | Tubulin |
| miR5021 ,miR5658 | PATL | Cell formation | Patellin |
| miR1533, miR838 | P2C | Stress and developmental process | Probable protein phosphatase |
| miR5021, miR5658, miR396 | MADS | Flower development | Floral homeotic protein |
FIGURE 4GO annotation for output targets and their distribution in three categories (A) Molecular function (B) Biological process (C) Cellular component.
FIGURE 5Gene regulatory networks of cluster bean target genes in GENEMANIA against Arabidopsis thaliana.
FIGURE 6Major transcription factor classes identified from cluster bean ESTs.
FIGURE 7A proposed model of interactions among transcription factors and miRNAs for gene regulation in cluster bean.
List of predicted miRNA families in cluster bean.
| Input sequence Id | Precurson start/Stop | Known mature miRNA sequence | Predicted miRNA sequence | Predicted miRNA family | Homolog miRNA |
|---|---|---|---|---|---|
| EG990325.1 GLE089_F01_003 | 554–644 | 5′:UGACAGAAGAAAGAGAGCAC:3′ | 5′:UGAGAGAAGAAAGAGAGGAA:3′ | miR156 | ath-miR156h |
| EG980529.1 GLL073_G12_042 | 382–429 | 5′:UCGCUUGGGCAGAUCGGGAC:3′ | 5′:UCGCUUGGUCAGAUCUGCGC:3′ | miR168 | sof-miR168b |
| EG984942.1 GLE040_D12_045 | 201–258 | 5′:GAGCCAAGGAUGACUUGCCGU:3′ | 5′:GAGCCAAGGGUGACUUAAUGU:3′ | miR169 | vvi-miR169l |
| EG985097.1 GLE041_H10_033 | 324–379 | 5′:AGAAUCUUGAUGAUGCUGCAU:3′ | 5′:AGAAUCUUGAUCAUCCUGUGU:3′ | miR172 | gma-miR172b |
| EG987334.1 GLE062_E02_004 | 369–420 | 5′:UCCAAAGGGAUCGCAUUGAUC:3′ | 5′:UCCAAAGGGAUCGCAUGUCAC:3′ | miR393 | gma-miR393 |
| EG978583.1 GLL055_H01_001 | 205–253 | 5′:UUCCACAGCUUUCUUGAACUU:3′ | 5′:UUUCACAGCUUUCUUGAUUGU:3′ | miR396 | osa-miR396c |
| EG975619.1 GLL029_A09_040 | 413–460 | 5′:UCAUUGAGUGCAGCGUUGACG:3′ | 5′:UCUCUGAAUGCAGCGUUGACU:3′ | miR397 | pab-miR397 |
| EG990966.1 GLE094_G01_002 | 207–248 | 5′:UGCCAAAGGAGAAUUGCCC:3′ | 5′:AUCCAAAGGUGAAUUGCUC:3′ | miR399 | tae-miR399 |
| EG985485.1 GLE045_G03_010 | 317–428 | 5′:UCAUCCUCAUCAUCAUCGUCC:3′ | 5′:UUAUCAUCAUCCUCAUCAUCC:3′ | miR414 | osa-miR414 |
| EG978745.1 GLL057_D04_013 | 137–199 | 5′:AAAGUUAGAGAAGUUUGACUU:3′ | 5′:AUAGCUAGAGAAGUUUGAAAU:3′ | miR437 | osa-miR437 |
| EG976745.1 GLL038_H10_033 | 311–357 | 5′:UGCAGUUGCUGCCUCAAGCUU:3′ | 5′:UUCAUUUGAAGCCUCAAGCUU:3′ | miR444 | osa-miR444a.2 |
| EG978435.1 GLL054_D09_037 | 223–300 | 5′:UUGAGGUGUUUCUACAGGCUA:3′ | 5′:UUGAGGAGUUUCUACAUUCAA:3′ | miR537 | ppt-miR537a |
| EG989794.1 GLE084_D07_029 | 632–672 | 5′:UUUGCUUCCAGCUUUUGUCUC:3′ | 5′:UUUGCUUCCAGCUUUGGUUUG:3′ | miR773 | ath-miR773 |
| EG985501.1 GLE045_H05_017 | 388–541 | 5′:UUGUAGUGCAUAUUUGUUUU:3′ | 5′:UUGUUAUGCAUGUUGGUUUU:3′ | miR1044 | ppt-miR1044 |
| EG989165.1 GLE017_B06_023 | 380–512 | 5′:UAGUGGGAGAUUUUGUGUAAC:3′ | 5′:UAUUGGGAAAUUUUGUGUCGC:3′ | miR1109 | smo-miR1109 |
| EG974827.1 GLL020_C10_038 | 335–369 | 5′:CAUUAUGGAACGGAAGGAG:3′ | 5′:CAUUAUGGAAAGGAAGGGA:3′ | miR1132 | tae-miR1132 |
| EG986974.1 GLE05_A06_024 | 36–91 | 5′:CAACAACAACAAGAAGAAGAAGAU:3′ | 5′:GAACAAGAAGAAGAAGAAGAAGAA:3′ | miR1134 | tae-miR1134 |
| EG975778.1 GLL02_E10_036 | 44–89 | 5′:GGGGUGUGAUGAUUUGAAAC:3′ | 5′:UGGGUGUGAGGAUUUGAGAC:3′ | miR1167 | cre-miR1167 |
| EG989769.1 GLE084_B06_023 | 158–251 | 5′:UACCACUGAAAUUAUUGUUCG:3′ | 5′:UUCAAUUGAAAUUAUUGGUCG:3′ | miR1313 | pta-miR1313 |
| EG989141.1 GLE079_A10_040 | 161–752 | 5′:UUUUGGAACGGAGUGAGUAUU:3′ | 5′:UUAUGAAACGGAGUGAGUAAU:3′ | miR1439 | osa-miR1439 |
| EG981106.1 GLL079_F10_035 | 51–96 | 5′:UAACUCAACCUUACAAAACC:3′ | 5′:GAACUCAAGCUAACAAAACC:3′ | miR1527 | gma-miR1527 |
| EG975750.1 GLL02_C09_038 | 453–529 | 5′:AUAAUAAAAAUAAUAAUGA:3′ | 5′:UUAAUAAAAAUUAUAAAAA:3′ | miR1533 | gma-miR1533 |
| EG981151.1 GLL010_F06_019 | 47–191 | 5′:CUUGUUUGUGGUGAUGUCU:3′ | 5′:CUGGUCUGUGGUGCUGUCC:3′ | miR1535 | gma-miR1535 |
| EG983098.1 GLL01_H03_009 | 96–177 | 5′:AUAUGGAUUCAGAAUGCAGGU:3′ | 5′:AUAAGGAAACAGAAUGCAGGA:3′ | miR1852 | osa-miR1852 |
| EG975952.1 GLL031_C04_014 | 116–160 | 5′:UGGUUUUUUUGGAGCAUGAGG:3′ | 5′:GGAAUUUUUUGGAGCAGGAGG:3′ | miR1857 | osa-miR1857 |
| EG990914.1 GLE094_C01_006 | 644–700 | 5′:UGUGUGUUCCGCUUCUUCUUU:3′ | 5′:AGCGUCUUCUGCUUCUUCUUU:3′ | miR2082 | ppt-miR2082 |
| EG983237.1 GLE021_H04_009 | 192–278 | 5′:CGGUUUGUCAAGCGGAGUGC:3′ | 5′:UGCUUUGUCAAGGGGAGUGU:3′ | miR2098 | osa-miR2098 |
| EG978398.1 GLL054_A10_040 | 393–497 | 5′:UUGUGAUGUGAAUGAUUCAU:3′ | 5′:GGGUGAUGUGAUUGAUUCCU:3′ | miR2105 | osa-miR2105 |
| EG987207.1 GLE061_C06_022 | 253–317 | 5′:AGGAUUAGAGGGACUUGAACC:3′ | 5′:ACGCUUCGAGGGACUUGAAUC:3′ | miR2275 | zma-miR2275c |
| EG986569.1 GLE055_B02_007 | 573–612 | 5′:UACAAUUCCUUAGGUGCUUUU:3′ | 5′:UUCAGCUCCUUAGGUGCAUUU:3′ | miR2606 | mtr-miR2606a |
| EG980814.1 GLL076_F12_043 | 210–282 | 5′:CAUGAAAGAAUGAUGAGUAA:3′ | 5′:CAGGUGAGAAUGAUGAGGAA:3′ | miR2628 | mtr-miR2628 |
| EG983630.1 GLE027_H07_025 | 570–604 | 5′:UUUAUUCUCAGUUUGUUGCUC:3′ | 5′:UUUAUUCUCAGUUUUUUGAUC:3′ | miR2634 | mtr-miR2634 |
| EG982808.1 GLL094_D08_029 | 586–682 | 5′:UCUAGUUUGUGUUCAGCAUC:3′ | 5′:UCUAAUUUGUGUUCACUUUC:3′ | miR2866 | osa-miR2866 |
| EG988391.1 GLE071_F12_043 | 404–471 | 5′:AAGGGGGGGGGGGGAAAGA:3′ | 5′:AGGGGGAGGGGGGGAAAUU:3′ | miR2919 | osa-miR2919 |
| EG988087.1 GLE016_B04_015 | 180–224 | 5′:UCUCUCUCUCCCUUGAAGGC:3′ | 5′:UCACUCUCUCCCUUGCAGUU:3′ | miR3979 | osa-miR3979 |
| EG976112.1 GLL032_G08_026 | 113–188 | 5′:UAAGAGAAUUGUAAGUCACU:3′ | 5′:UCACUGAAUUGUAAGUUACU:3′ | miR4413 | gma-miR4413b |
| EG986778.1 GLE057_B04_015 | 648–710 | 5′:AGGCAGUGGCUUGGUUAAGGG:3′ | 5′:AAGCAGUGGCUUGGUCAAGGC:3′ | miR4995 | gma-miR4995 |
| EG986237.1 GLE051_H12_041 | 18–76 | 5′:UCUGUUGUUGUUGGUGUUAUG:3′ | 5′:UCUGUUGUUGUUGUUGUUGUU:3′ | miR5015 | ath-miR5015b |
| EG985015.1 GLE041_B08_031 | 5–586 | 5′:UGAGAAGAAGAAGAAGAAAA:3′ | 5′:GGAGAAGAAGAGAAAGGAAA:3′ | miR5021 | ath-miR5021 |
| EG990900.1 GLE094_B02_007 | 644–721 | 5′:UUUGGAUCUGUUAUUUUGGUAU:3′ | 5′:UUUCUUUCUGUUAUUUUGGAAU:3′ | miR5079 | osa-miR5079 |
| EG982261.1 GLL08_B02_007 | 154–214 | 5′:AAGUGAUGUUGGAAUGGUUA:3′ | 5′:UAGUGAAGUUGGAAUAAUUA:3′ | miR5265 | mtr-miR5265 |
| EG981105.1 GLL079_F09_035 | 141–268 | 5′:AGGCAUUUGCUAGAAUACACCCAC:3′ | 5′:AAGGAUUUGCUAAUAUACACCCAC:3′ | miR5267 | mtr-miR5267a |
| EG987890.1 GLE067_G12_042 | 22–305 | 5′:UGAAGCUUCAGUUGGUUGUAU:3′ | 5′:AGAAGCUUCAGUUGGUUUUGA:3′ | miR5338 | osa-miR5338 |
| EG989431.1 GLE017_D06_021 | 177–241 | 5′:CAGGUGUUCUCGAUGGCUUCC:3′ | 5′:CUAGUGAUUUCGAUGGCUUCC:3′ | miR5489 | osa-miR5489 |
| EG977779.1 GLL049_B04_015 | 307–431 | 5′:UUUGAGAAGGUAUCAUGAGAU:3′ | 5′:UAUGAGAAUGUAUUAUGAGAU:3′ | miR5542 | osa-miR5542 |
| EG986048.1 GLE050_B05_023 | 40–173 | 5′:UUGUUUGGAUGUUGUCGGA:3′ | 5′:UUGUUUGGAUGCUGAUGGU:3′ | miR5565 | sbi-miR5565e |
| EG983888.1 GLE02_H11_041 | 113–186 | 5′:UGGAAGAAGAUGAUAGAAUUA:3′ | 5′:UGGAAGAAGAUGUGAAAAUUA:3′ | miR5641 | ath-miR5641 |
| EG985672.1 GLE047_E04_012 | 293–618 | 5′:AUGAUGAUGAUGAUGAUGAAA:3′ | 5′:AUGAUGAUGAAGAAGAAGAAG:3′ | miR5658 | ath-miR5658 |
| EG984029.1 GLE031_E11_044 | 110–464 | 5′:AGAGGUGACCAUUGGAGAUG:3′ | 5′:AGGGGUGACCGUUGGAGACU:3′ | miR5662 | ath-miR5662 |