Literature DB >> 35845525

Icariin promotes the repair of bone marrow mesenchymal stem cells in rabbit knee cartilage defects via the BMP/Smad pathway.

Feng Jiao1, Wang Tang2, Jie Wang2, Donghua Liu2, Hongyi Zhang1, Dongming Tang1.   

Abstract

Background: Icariin (ICA) has been widely used in the treatment of osteoporosis. However, the potential mechanism of its critical role in repairing knee cartilage damage still needs to be further clarified.
Methods: First, rabbit bone marrow mesenchymal stem cells (BMSCs) were isolated, cultured, and identified. Subsequently, BMSCs were treated with different concentrations of ICA. Cell Counting Kit 8 (CCK-8) and 5-ethynyl-2'-deoxyuridine (EdU) were used to evaluate the cell proliferation in each group. Alcian Blue staining, immunofluorescence, and western blotting were used to evaluate the ability of BMSCs to differentiate cartilage. In addition, a rabbit knee cartilage injury model was established. Evaluation of cartilage defects in each group was performed according to the classification system outlined by the International Cartilage Repair Society (ICRS). Hematoxylin and eosin (HE), Alcian Blue, and immunohistochemistry were used to analyze the pathological status of knee cartilage.
Results: In vitro, the results showed that ICA promoted the cartilage differentiation of BMSCs as well as cell proliferation. In addition, ICA promoted the expression of type II collagen (COL2A1), aggrecan, and bone morphogenetic protein 2 (BMP2) in BMSCs, while BMP-Smad inhibitor (Noggin) reversed the repair effect of ICA on BMSCs. In vivo, our results showed that the ICRS score of the BMSC and ICA treatment group was higher. Moreover, BMSC and ICA treatment promoted the proliferation of chondrocytes and repaired the cartilage-like tissue on the surface of cartilage defect. Conclusions: The combined application of ICA and BMSCs can repair rabbit knee cartilage injury by regulating the BMP/Smads pathway, indicating that ICA and BMSCs may be a viable clinical treatment strategy for knee cartilage damage. 2022 Annals of Translational Medicine. All rights reserved.

Entities:  

Keywords:  BMP/Smads; Icariin (ICA); bone marrow mesenchymal stem cell (BMSC); knee cartilage damage

Year:  2022        PMID: 35845525      PMCID: PMC9279777          DOI: 10.21037/atm-22-2515

Source DB:  PubMed          Journal:  Ann Transl Med        ISSN: 2305-5839


Introduction

Osteoarthritis (OA), an affliction with a large social burden, is defined as a degenerative joint disease involving cartilage and its surrounding tissues (1). In the early stages of OA, the surface of the articular cartilage changes little. With further changes in the composition and structure of articular cartilage, cartilage integrity is destroyed, chondrocytes undergo apoptosis, and OA ultimately arises thereby (2). In the treatment of OA, improving cartilage damage and enhancing cartilage protection are considered to be promising avenues of development, with the promotion of cartilage regeneration thus also being seen as a propitious line of OA treatment research (3). Mesenchymal stem cells (MSCs) can be easily grown in culture, have the ability to differentiate into cartilage, and thus are an alternative cell source for cartilage repair (4,5) and are of considerable significance for the regeneration of cartilage. Icariin (ICA) is the main bioactive ingredient extracted from the Chinese herbal medicine Epimedium brevicornum Maxim, which has been shown to reduce cartilage degradation (6). A clinical trial has reported that ICA was effective in preventing postmenopausal osteoporosis with relatively low side effects (7). ICA has been extensively studied as a potential small molecular drug for bone regeneration, and its desirable properties are generally thought to arise from the estrogen-like effects it exerts on osteoblasts as a result of the structural similarity between ICA and β-estradiol (8,9). ICA not only promotes chondrogenic differentiation (10) and osteoblastogenesis, but also inhibits osteoclastogenesis (11), leading to bone formation. ICA has been shown to promote osteogenic differentiation by regulating the osteoclastogenesis inhibitory factor (OPG) to Receptor Activator of Nuclear Factor-κB Ligand (RANKL) expression ratio (12). Furthermore, Wang et al. (13) reported that ICA could increase alkaline phosphatase (ALP) activity and upregulate the messenger RNA (mRNA) expression levels of Runx2, ALP, COL I, and OCN. Song et al. (8) reported that ICA promoted MC3T3-E1 cell differentiation through activation of the extracellular regulated protein kinases (ERK) and c-Jun N-terminal kinase (JNK) signaling pathways. Finally, ICA has been shown to inhibit cartilage tissue destruction (14). Therefore, ICA may play an important role in protecting against cartilage damage and promoting cartilage repair. The bone morphogenetic protein 2 (BMP2) signaling pathway is a critical regulator of cartilage and bone formation (15,16). In addition, BMP2 binds to its receptors to induce phosphorylation of drosophila mothers against decapentaplegic protein(Smad) 1/5/9 (15) and then regulates the early stage of osteoblast differentiation through transcription factors, such as Id1, Dlx5, and Runx (17,18). Studies in developmental biology have revealed that transcription factors, including Runx2 and β-catenin, play a key role in the regulation of bone marrow MSC (BMSC) differentiation (19,20). Moreover, Runx2 expression is upregulated by BMP2-activated Smad proteins, and also interacts with Smad proteins to induce osteoblast differentiation (21,22). There are many factors affecting the proliferation and differentiation of BMSC, such as inflammation, mechanical stress (23), and some specific cytokines. Inflammation was considered as an inhibitory role in the cartilage regeneration (24). Studies suggest that ICA can regulate BMP and Runx signaling and enhance osteoblastogenesis in vitro (25,26). Although evidence suggests that ICA can attenuate hypoxia-induced apoptosis in osteoblasts (27), it is uncertain whether ICA acts on BMP2/Smad signaling pathways. Therefore, the aim of the present study was to investigate the therapeutic effect of ICA in repairing knee cartilage damage, and for the first time, we explore the regulation of ICA on BMP2/Smad signal pathway in BMSC osteogenic induction. We present the following article in accordance with the ARRIVE reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-2515/rc).

Methods

Cell isolation and culture

New Zealand rabbits (1 month old) were purchased from the Experimental Animal Center of Southern Medical University. Rabbit BMSCs were isolated from rabbit bone marrow. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Hyclone, South Logan, UT, USA) containing 100 U/mL penicillin/streptomycin and 10% fetal bovine serum (FBS; Hyclone). The medium was changed every 3 days. Experiments were performed under a project license granted by institutional committee board of Guangzhou Hospital of Integrated Traditional and Western Medicine (No. E-20210427), in compliance with national guidelines for the care and use of animals. A protocol was prepared before the study without registration.

Determination of surface antigens of BMSCs

Third-generation BMSCs grown to 80–90% were collected, digested with 0.25% trypsin at room temperature and centrifuged, and the cell pellet was collected. The pellet was washed with phosphate-buffered saline (PBS) and made into a 1×105/mL cell suspension. Following this, 10 µL each of fluorescently labeled phenotypic antibodies, CD29, CD44, CD90, CD34, and CD45, was added to 100 µL of the cell suspension. Surface antigen expression was detected using flow cytometry (BD-FACSVerse, San Jose, CA, USA).

BMSC osteogenic induction and Alizarin Red staining

Osteogenic induction medium (each 100 mL) containing 10% FBS (Gibco, Grand Island, NY, USA), 2% double antibody, 0.01 µmol/L dexamethasone (Solarbio, Beijing, China), 10 mmol/L β-sodium glycerophosphate (Solarbio), and 50 mg/L ascorbic acid (Solarbio) was prepared. Cells were cultured with osteogenic induction medium and stained with Alizarin Red. The residual medium was washed off with sterile PBS, and the cells were fixed with 4% paraformaldehyde for 15 min. The residual fixative was washed with double-distilled water, and 2 mL of 0.2% Alizarin Red staining solution (Solarbio) was added to each well for a staining duration of 30 min. After the residual dye was washed off, the staining results were observed microscopically.

Chondrogenic induction of BMSCs and Alcian Blue staining

Cartilage induction medium containing 10% FBS, 1% double antibody, 100 nM dexamethasone, 50 µg/mL Vc, 100 µg/mL sodium pyruvate, 40 ug/mL proline, 50 mg/mL insulin transferrin selenite, and 10 ng/mL tumor growth factor beta (TGF- β) was prepared. The cells were cultured in osteogenic induction medium and stained with Alcian Blue. The cells were then fixed with 4% paraformaldehyde for 15 min, and the residual stationary solution was washed away with PBS. The cells were then soaked with Alcian acidification solution (Solarbio) for 3 min and dyed with Alcian staining solution (Solarbio) for 30 min. After the residual dyes were washed off, the dyeing results were observed microscopically.

Adipogenesis induction of BMSCs and Oil Red O staining

Lipid induction medium containing 10% FBS, 1% double antibody, 10 µg/mL insulin (Solarbio), 1 µM dexamethasone (Solarbio), 0.5 mM IBMX (Solarbio), and 0.1 mM indomethacin (Solarbio) was prepared. The cells were cultured in adipogenic induction medium and stained with Oil Red O. The cells were fixed with 10% neutral formaldehyde for 30 min, and the residual fixative was washed off with PBS. Next, 0.5% Oil Red O working solution was added to the cells, which were dyed in dark for 1 h. The residual dye was washed off with isopropanol, and the dyeing results were observed microscopically.

Cell viability assay

Cell viability was determined with Cell Counting Kit 8 (CCK-8; Dojindo, Kumamoto, Japan). Cells were seeded into 96-well plates at a density of 2×103 cells/well, and cells were treated with different concentrations of ICA (0, 0.1, 1, and 10 µM). Cell viability was determined at specific times using the CCK-8 kit (and absorbance at 450 nm was measured.

Cell proliferation analysis

BeyoClick EdU-555 cell proliferation detection kit (Beyotime, Shanghai, China) was used to determine the proliferation ability of BMSCs. Proliferated BMSCs were incubated with EdU working solution (10 µM) for 3 h at 37 °C. The incubated BMSCs were washed with PBS to remove residual liquid and fixed with 4% paraformaldehyde for 15 min. Cells were incubated with 0.3% Triton-X100 (Merck Millipore, Billerica, MA, USA) for 15 min at room temperature and stained with reaction solution (C0075S, Beyotime). The staining results were observed using a fluorescence microscope (Olympus, Tokyo, Japan).

Immunofluorescence

Treated cells were fixed with 4% paraformaldehyde for 30 min at room temperature. Cells were permeabilized with 0.1% Triton X-100 and blocked with 1% bovine serum albumin. Cells were incubated with rabbit polyclonal anti-COL2A1, BMP2 and Runx2 antibodies (Abcam, Cambridge, UK) overnight at 4 °C. Cells were incubated with CM-Dil-labeled goat anti-rabbit secondary antibody (Boster, Wuhan, China) at room temperature and stained with DAPI. Cells were observed by fluorescence microscopy (Olympus).

Real-time quantitative reverse transcription polymerase chain reaction

Total cellular RNA was extracted using Trizol reagent (Takara Bio Inc., Shiga, Japan). Reverse transcription was performed using the BestarTM qPCR RT Kit (cat. No. 2220, DBI (Bioscience, Shanghai, China) according to the manufacturer’s instructions. Real-time analysis was performed on a Stratagene real-time polymerase chain reaction (PCR) instrument (Agilent, Santa Clara, CA, USA) using the BestarTM qPCR MasterMix Kit (cat. No. 2043, DBI). The relative expression levels of each gene were quantified using the 2−ΔΔCt method. The primer sequences are shown in .
Table 1

The sequences of primers

IDSequence (5'-3')
GAPDH.FCCTCGTCTCATAGACAAGATGGT
GAPDH.RGGGTAGAGTCATACTGGAACATG
Aggrecan.FGGAGCTTTGGACTTTGGCGGA
Aggrecan.RACGTGCAGTGGTGGCTGTGAC
Sox9.FCCCACCTCTCTTACCTCTCTC
Sox9.RATCCAGTCTCTCTTCCACTCC
COL2A1.FCCTTGGTGGAAACTTTGCTGC
COL2A1.RTGCCTTGAAATCCTTGCGGTC
MMP-13.FTTCTACCACACAAACCACACT
MMP-13.RCTTCCTCGGACAAATCATCAT
Runx2.FCTCCGAAATGCCTCTGCTGTTATGA
Runx2.RCGGGGTCCATCCACTGTAACTTTAA
Smad1.FAATCAGCAGAGGAGATGTTCA
Smad1.RAAGCGGTTCTTATTGTTGGAC
BMP2.FATCCAGTCTCTCTTCCACTCC
BMP2.RGGTGATCAGCCAGGGGAAAGG

Western blot

BMSCs cells were collected and lysed with RIPA cell lysate. The protein content in the samples was detected using a bicinchoninic acid (BCA) protein assay kit (Beyotime). Protein samples were electrophoresed on 12% SDS-PAGE, and protein bands were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% nonfat milk for 2 h at room temperature, incubated with primary antibodies overnight at 4 °C, and then incubated with horseradish peroxidase (HRP)–conjugated secondary antibodies for 2 h at room temperature. Protein bands were visualized by chemiluminescence using an enhanced chemiluminescence (ECL) kit (Thermo Fisher Scientific, Waltham, MA, USA).

Construction of rabbit knee cartilage injury model

Female New Zealand rabbits (weight 2.5 kg) were purchased from the Experimental Animal Center of Southern Medical University and raised in an environment with a temperature of 22 °C and a relative humidity of 55%. Rabbits were anesthetized intravenously with 3% sodium pentobarbital (40 mg/kg). An incision was made at the medial edge of the patellar ligament of the right knee, and a hole with a diameter of 3 mm and a depth of 4 mm was drilled. The depth was a full-thickness cartilage defect with bleeding red bone marrow. The patella was reset, the wound was sutured, and 800,000 units of penicillin were injected into the gluteal muscle every day for 3 days after operation.

Animal grouping and treatment

All animal models were randomly divided into 5 groups with 7 animals in each group. They were divided into sham operation (sham), operation (operation), operation + BMSCs, operation + ICA, and operation + BMSCs + ICA groups. The specific treatment process was performed as follows: on the third day after modeling, the animals in sham group received an incision on the skin tissue, were injected with normal saline (1 mL), and were then sutured without cartilage damage; the animals in the operation group were injected with an equal volume of normal saline (1 mL) into the joint cavity; the animals in the BMSC group were injected with 1 mL of rabbit BMSC (1×107 cells) into the joint cavity; the animals in the ICA group were injected with 1 mL of 10 µM ICA into the ear vein; and the animals in the BMSCs + ICA group were treated with an injection into the joint cavity of 1 mL of rabbit BMSC (1×107 cells) preincubated with 10 µM ICA for 72 h. The used concentration of ICA was adjusted based on a previous report (28). The administration frequency of each group of animals was once a week, with a total of 3 doses. After 8 weeks of observation, the rabbits were euthanized and the knee joints were removed. Cartilage damage was assessed based on the International Cartilage Repair Society (ICRS) gross morphology assessment scale for cartilage repair ().
Table 2

Baroscopic evaluation of cartilage repair according to ICRS

FeatureScore
Degree of defect repair
   In level with surrounding cartilage4
   75% repair of defect depth3
   50% repair of defect depth2
   25% repair of defect depth1
   0% repair of defect depth0
Integration to border zone
   Complete integration with surrounding cartilage4
   Demarcating border <1 mm3
   3/4 of graft integrated, 1/4 with a notable border >1 mm width2
   1/2 of graft integrated with surrounding cartilage, 1/2 with a notable border >1 mm1
   From no contact to 1/4 of graft integrated with surrounding cartilage0
Macroscopic appearance
   Intact smooth surface4
   Fibrillated surface3
   Small, scattered fissures or cracks2
   Several, small, or few but large fissures1
   Total degeneration of grafted area0
Overall repair assessment
   Grade I: normal12
   Grade II: nearly normal8-11
   Grade III: abnormal4-7
   Grade IV: severely abnormal1-3

ICRS, international society for cartilage repair.

ICRS, international society for cartilage repair.

Hematoxylin and eosin (HE) staining and Toluidine Blue staining

The lower end of the obtained femur was fixed with paraformaldehyde for at least 24 h and then soaked in 10% EDTA for 3 weeks. Tissues were dehydrated, embedded with paraffin wax, and cut into 5-µm thick sections. Sections were deparaffinized and dehydrated sequentially with xylene and graded alcohol, stained with hematoxylin staining solution for 5 min, washed with water for 10 min, treated with 1% hydrochloric acid ethanol for 5 s, washed with water again for 1 min, stained again with 0.5% eosin for 5 min, and finally treated once more with graded alcohol and xylene. The slides were sealed with neutral gum, and the results were observed under a microscope after air-drying. The pretreatment of Toluidine Blue staining was the same as that of HE staining. Deparaffinized sections were stained with 1% Toluidine Blue for 3 min and treated with graded alcohol and xylene. The staining results were observed under a light microscope.

Immunohistochemistry

The sections were deparaffinized and dehydrated in xylene and graded alcohol, and antigen retrieval was performed with antigen retrieval solution. The sections were incubated overnight at 4 °C with rabbit anti-BMP2, Runx2, and Smad1 antibodies, respectively. Next, the sections were incubated with HRP-conjugated goat anti-rabbit secondary antibody for 1 h min at room temperature. The sections were stained with DAB staining solution and counterstained with hematoxylin. The staining results were observed under a light microscope.

Statistical analysis

Data were analyzed using GraphPad Prism 8.0.2 software (GraphPad Software, Inc., San Diego, CA, USA). All experiments were repeated 3 times independently, and the experimental results are expressed as mean ± standard deviation. Differences between 2 groups were analyzed by Student’s t-test, and comparisons between multiple groups were performed using 1-way analysis of variance (ANOVA) and Tukey’s post hoc test. A P value <0.05 was considered to indicate a statistically significant difference.

Results

Characterization and differentiation potential of BMSCs

The third-generation BMSCs were a homogeneous population with a spindle shape, and cytomorphological observations showed that BMSCs isolated from bone marrow also possessed this feature. The morphology of the induced BMSCs was significantly changed. The cells become rounded and grew tentacles, mostly triangular in shape (). Flow cytometry results showed that the cells were positive for the typical BMSCs markers CD29 (96.8%), CD44 (95.4%), and CD90 (94.4%), while being negative for CD34 (2.5%) and CD45 (3.7%; ). BMSCs have the potential to differentiate into osteoblasts, chondrocytes, and adipocytes. Alizarin Red S, Alcian Blue, and Oil Red O staining showed that BMSCs cultured under osteogenic differentiation conditions formed mineralized nodules, exhibited increased proteoglycan expression, and generated lipid droplets, respectively (). This indicated that the isolated BMSCs had the ability to differentiate into osteogenic, chondrogenic, and adipogenic types.
Figure 1

Characterization and differentiation potential of BMSCs. (A) Morphological observation of BMSCs before and after induction. (B) The expression levels of marker molecules CD29, CD34, CD90, CD45, and CD44 of BMSCs were determined by flow cytometry. (C) Alizarin Red S, Alcian Blue, and Oil Red O staining were used to detect the osteogenic, chondrogenic, and adipogenic differentiation levels of BMSCs, respectively. BMSC, bone marrow mesenchymal stem cell.

Characterization and differentiation potential of BMSCs. (A) Morphological observation of BMSCs before and after induction. (B) The expression levels of marker molecules CD29, CD34, CD90, CD45, and CD44 of BMSCs were determined by flow cytometry. (C) Alizarin Red S, Alcian Blue, and Oil Red O staining were used to detect the osteogenic, chondrogenic, and adipogenic differentiation levels of BMSCs, respectively. BMSC, bone marrow mesenchymal stem cell.

ICA promoted the proliferation of BMSCs

In this study, different concentrations of ICA were used to act on cells, and the EdU proliferation experiments showed that ICA treatment significantly increased the red fluorescence area in a concentration-dependent manner and promoted the proliferation of BMSCs (). In addition, ICA increased cell viability in a time-dependent and concentration-dependent manner ().
Figure 2

ICA promoted BMSCs proliferation. (A) An EdU proliferation assay was used to determine the cell proliferation level of BMSCs treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) at different durations (3, 7, and 14 d). (B) The cell viability of BMSCs treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) at different durations (24, 48, and 72 h) was determined by CCK8 assay. *, P<0.05; ***, P<0.001 compared with the BMSCs group. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

ICA promoted BMSCs proliferation. (A) An EdU proliferation assay was used to determine the cell proliferation level of BMSCs treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) at different durations (3, 7, and 14 d). (B) The cell viability of BMSCs treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) at different durations (24, 48, and 72 h) was determined by CCK8 assay. *, P<0.05; ***, P<0.001 compared with the BMSCs group. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

ICA induced chondrogenic differentiation of BMSCs

Cells were treated with 0.1, 1, or 10 µM of ICA, and the ability of cells to differentiate into chondroblasts was tested on days 3, 7, and 14. Alcian Blue staining showed that BMSCs expressed more polysaccharide glycans with increasing incubation time and ICA concentration (). The subsequent experiments further confirmed the ability of ICA to induce chondrogenic differentiation of BMSCs. The immunofluorescence results of COL2A1 showed that ICA treatment significantly increased the expression level of COL2A1 compared with the BMSC group in a time- and concentration-dependent manner (). Reverse-transcription PCR results showed that ICA treatment upregulated the mRNA expression levels of Aggrecan, COL2A1, BMP2, Runx2, Smad1, MMP-13, and Sox9 (). Western blot results further confirmed that ICA induced a gradual increase in the expression levels of these chondrogenesis-related proteins in a time- and concentration-dependent manner ().
Figure 3

ICA induced chondrogenic differentiation of BMSCs. Alcian Blue staining was used to determine the ability of BMSCs to differentiate into chondrogenic cells. BMSCs were treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) and the levels of polysaccharide glycans (blue area) were detected at different times (3, 7, and 14 d). ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

Figure 4

ICA induced chondrogenic differentiation of BMSCs. The expression levels of COL2A1 under different concentrations of ICA and different action times were determined by immunofluorescence. Blue is DAPI and green is the target protein. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

Figure 5

ICA promoted the expression of chondrogenesis-related genes. (A) ICA upregulated the mRNA expression levels of Aggrecan, COL2A1, BMP2, Runx2, Smad1, MMP-13, and Sox9. (B) ICA upregulated the protein expression levels of Aggrecan, COL2A1, BMP2, Runx2, Smad1, and MMP-13. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the BMSCs group. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

ICA induced chondrogenic differentiation of BMSCs. Alcian Blue staining was used to determine the ability of BMSCs to differentiate into chondrogenic cells. BMSCs were treated with different concentrations of ICA (0, 0.1, 1, and 10 µM) and the levels of polysaccharide glycans (blue area) were detected at different times (3, 7, and 14 d). ICA, icariin; BMSC, bone marrow mesenchymal stem cell. ICA induced chondrogenic differentiation of BMSCs. The expression levels of COL2A1 under different concentrations of ICA and different action times were determined by immunofluorescence. Blue is DAPI and green is the target protein. ICA, icariin; BMSC, bone marrow mesenchymal stem cell. ICA promoted the expression of chondrogenesis-related genes. (A) ICA upregulated the mRNA expression levels of Aggrecan, COL2A1, BMP2, Runx2, Smad1, MMP-13, and Sox9. (B) ICA upregulated the protein expression levels of Aggrecan, COL2A1, BMP2, Runx2, Smad1, and MMP-13. *, P<0.05; **, P<0.01; ***, P<0.001 compared with the BMSCs group. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

ICA induced chondrogenic differentiation of BMSCs by upregulating the level of BMP2

To confirm whether ICA induces chondrogenic differentiation of BMSCs through the regulation of BMP2, we treated cells with an inhibitor of BMP2 protein (Noggin). This revealed that ICA significantly increased the protein expression levels of Runx2, COL2A1, Aggrecan, matrix metalloproteinase 13 (MMP-13), p-Smad1, and Smad1 in BMSCs. The protein levels when cells were cotreated with ICA and Noggin were significantly lower than those treated with ICA alone (). Immunization results for BMP2 and Runx2 also showed that Noggin treatment reduced the high levels of BMP2 and Runx2 induced by 1 µM of ICA (). Alcian Blue staining results further demonstrated that Noggin treatment reduced the expression level of polysaccharide glycans induced by 1 µM of ICA (). The above results indicated that inhibiting the expression of BMP2 and Runx2 can reduce the chondrogenic differentiation of BMSCs induced by ICA, which induces the chondrogenic differentiation of BMSCs by upregulating the level of BMP2 and Runx2.
Figure 6

ICA induced the chondrogenic differentiation of BMSCs by regulating the level of BMP2. (A) The protein expression levels of Aggrecan, COL2A1, MMP-13, p-Smad1, Smad1, Runx2, and GAPDH in each group were detected by western blotting. Columns A, B, C, and D represent the BMSCs group, BMSCs + 1-µM ICA group, BMSCs + Noggin group, and BMSCs + 1-µM ICA + Noggin group, respectively. (B) The expression levels of BMP2 and Runx2 in cells of each group were determined by immunofluorescence. Blue is DAPI and green is the target protein. (C) The levels of polysaccharide glycans (blue area) in the cells of each group were determined by Alcian Blue staining. (D) Evaluation of the repair level of damaged cartilage tissue after BMSCs and/or ICA treatment according to ICRS criteria. ***, P<0.001 indicates statistical significance. ICA, icariin; BMSC, bone marrow mesenchymal stem cell; ICRS, international society for cartilage repair.

ICA induced the chondrogenic differentiation of BMSCs by regulating the level of BMP2. (A) The protein expression levels of Aggrecan, COL2A1, MMP-13, p-Smad1, Smad1, Runx2, and GAPDH in each group were detected by western blotting. Columns A, B, C, and D represent the BMSCs group, BMSCs + 1-µM ICA group, BMSCs + Noggin group, and BMSCs + 1-µM ICA + Noggin group, respectively. (B) The expression levels of BMP2 and Runx2 in cells of each group were determined by immunofluorescence. Blue is DAPI and green is the target protein. (C) The levels of polysaccharide glycans (blue area) in the cells of each group were determined by Alcian Blue staining. (D) Evaluation of the repair level of damaged cartilage tissue after BMSCs and/or ICA treatment according to ICRS criteria. ***, P<0.001 indicates statistical significance. ICA, icariin; BMSC, bone marrow mesenchymal stem cell; ICRS, international society for cartilage repair.

Combination of ICA and BMSCs in the repair of knee cartilage injury in vivo

We subsequently assessed the repair level of damaged cartilage tissue after 8 weeks of BMSC and ICA treatment using the ICRS criteria. The mean ICRS score of the surgery group was much lower than that of the sham group, and the knee cartilage was severely damaged. ICRS scores were significantly increased after BMSC or ICA treatment. After the combined treatment of BMSCs and ICA, the ICRS score of the BMSC + ICA group increased significantly and was significantly higher than that of the BMSC alone and ICA alone groups (). The results of HE staining for the surgery group showed that the cartilage surface was irregular, the cartilage layer was narrowed, and the cartilage structure was severely damaged. After treatment with ICA or BMSCs alone, the damaged cartilage tissue was improved, and the combined use of ICA and BMSCs significantly restored the structure of the damaged cartilage tissue (). The results of Toluidine Blue staining showed that compared with the operation group, the ICA group, BMSC group and BMSC + ICA group had deeper Toluidine Blue staining, with the content of the extracellular matrix (ECM) being significantly upregulated in these groups (). Furthermore, immunohistochemical results showed that ICA or BMSC treatment alone significantly increased the expression levels of BMP2, Runx2, and Smad1 in damaged cartilage tissue. Combination treatment with ICA and BMSC was more effective than treatment with ICA or BMSC alone ().
Figure 7

HE staining and toluidine blue staining results of each group. Seven rabbits in each group were used for surgical modeling, and after operation the rabbits was treated with injection of BMSCs or ICA. At the 8th week, bone and joints were preserved, and stained with hematoxylin and eosin and toluidine blue. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

Figure 8

The immunohistochemical results of BMP2, Runx2, and Smad1 in each group. Seven rabbits in each group were used for surgical modeling, and after operation the rabbits was treated with injection of BMSCs or ICA. At the 8th week, expression of BMP2, Runx2, and Smad1 in bone and joints was detected by immunohistochemistry. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

HE staining and toluidine blue staining results of each group. Seven rabbits in each group were used for surgical modeling, and after operation the rabbits was treated with injection of BMSCs or ICA. At the 8th week, bone and joints were preserved, and stained with hematoxylin and eosin and toluidine blue. ICA, icariin; BMSC, bone marrow mesenchymal stem cell. The immunohistochemical results of BMP2, Runx2, and Smad1 in each group. Seven rabbits in each group were used for surgical modeling, and after operation the rabbits was treated with injection of BMSCs or ICA. At the 8th week, expression of BMP2, Runx2, and Smad1 in bone and joints was detected by immunohistochemistry. ICA, icariin; BMSC, bone marrow mesenchymal stem cell.

Discussion

Due to its ability to stimulate estrogen receptor-dependent osteoblastic functions, ICA has multiple pharmacological properties with potency and protective effects (29-31). One in vitro experiment demonstrated that ICA can promote the proliferation and differentiation of osteoblasts and the DNA synthesis of BMCs (32). In addition, ICA has been shown alleviate mitochondrial dysfunction and decrease apoptosis in dilated cardiomyopathy (DCM) (33). Consistent with this, our study demonstrated that ICA exerts positive effects on cell proliferation as indicated by the increased cell proliferation and decreased cell apoptosis. Articular cartilage is mainly composed of chondrocytes, ECM, and water (14), while bone marrow stromal cells retains the ability to differentiate into cartilage. Therefore, it is critically important to investigate the differentiation BMSCs as it pertains to the effects of ICA. To identify the role of ICA in cartilage repair, we established a cartilage injury model. Next, we histologically evaluated the width of cartilage injury and analyzed the pathological status of knee cartilage. Previous study reported that ICA could promote osteogenic differentiation by upregulating BMAL1 expression through BMP signaling in BMSCs (25), while Shi et al. reported that ICA could induce osteogenic differentiation via activation of cAMP/PKA/CREB signaling pathway (30). In addition, ICA inhibits chondrocyte apoptosis and angiogenesis by regulating the TDP-43 signaling pathway (34). In the present study, we confirmed that ICA could effectively elevate the ability of BMSCs to differentiate cartilage. In addition to this, we discovered that ICA treatment led to a significant increase in the expression of hypertrophic cartilage markers (e.g., type X collagen and Aggrecan) during osteogenic differentiation. Of note, our findings showed that ICA treatment improved the articular cartilage injury through cell growth and differentiation. Matrix metalloproteinases (MMPs) are multifunctional growth factors, which figure prominently in the development of inflammatory and immune diseases as well as in the damaging of cartilage and bone (35). BMP2 binds to the BMP receptor and then activates the cytoplasmic serine/threonine kinase of BMP receptor (BMPR)-I and Smad1/5/8, and this process was associated with cartilage damage. Phosphorylated Smad translocates into the nucleus and regulates the expression of target genes (36). Furthermore, BMP2 has been shown to have an overall positive role in promoting bone regeneration (37). In this study, we verified the positive effects of ICA on the osteogenic differentiation of BMSCs. Likewise, Zhang et al. found that ICA regulates miR-23a-3p–mediated osteogenic differentiation of BMSCs via BMP2/Smad5/Runx2 and WNT/β-catenin pathways (38). Moreover, in this study, the protein expression of BMP2 was significantly different between the ICA group and control group, indicating that BMP2 might play an important role in the formation of ectopic ossification after muscle injury, a finding in line with that of another research (39). Consequently, it can be surmised that BMP2 may also be vital to the process of BMSC differentiation. The goal of MSC-based therapy is to be able to promote engraftment and osteogenic differentiation of the transplanted cells. As an osteoinductive factor, BMP2 is able to promote bone regeneration (39) and has widely used for bone regeneration as an osteoinductive adjuvant (40,41). However, BMP2 is a pleiotropic protein that can also exert adverse effects on the surrounding tissues, such as in the case of ectopic bone formation or the swelling of soft tissue (42,43). Therefore, the direct injection of BMSCs combined with ICA might be a good therapeutic candidate for cartilage repair. In the present study, the ICRS scores of the BMSC and ICA treatment group were higher than those of the other groups. Meanwhile, BMP-Smad inhibitor (Noggin) reversed the repair effect of ICA on BMSCs. This suggests that the BMP2-induced phosphorylation of Smad is essential for the proliferation of BMSCs. To the best of our knowledge, the present study provided evidence that the effect of ICA on BMSC was attenuated by Noggin. These results may provide a theoretical basis for using ICA in clinical treatment of neurobiological bone regeneration. In fact, there are a large number of Chinese herbal compounds that may be used to treat cartilage damage (44). Therefore, researchers need to make more efforts to study the specific mechanism of drugs promoting cartilage repair. In conclusion, the present study showed that ICA could alter the expression of COL2A1 and aggrecan, and induce the osteogenic differentiation of BMSC in vitro. Furthermore, it was shown that ICA could enhance the BMP2/Smad signaling pathway, indicating that the administration of ICA and BMSCs may be a viable clinical treatment strategy for knee cartilage damage. The article’s supplementary files as
  44 in total

1.  Bmp2 in osteoblasts of periosteum and trabecular bone links bone formation to vascularization and mesenchymal stem cells.

Authors:  Wuchen Yang; Dayong Guo; Marie A Harris; Yong Cui; Jelica Gluhak-Heinrich; Junjie Wu; Xiao-Dong Chen; Charles Skinner; Jeffry S Nyman; James R Edwards; Gregory R Mundy; Alex Lichtler; Barbara E Kream; David W Rowe; Ivo Kalajzic; Val David; Darryl L Quarles; Demetri Villareal; Greg Scott; Manas Ray; S Liu; James F Martin; Yuji Mishina; Stephen E Harris
Journal:  J Cell Sci       Date:  2013-07-10       Impact factor: 5.285

2.  The flavonol glycoside icariin promotes bone formation in growing rats by activating the cAMP signaling pathway in primary cilia of osteoblasts.

Authors:  Wengui Shi; Yuhai Gao; Yuanyuan Wang; Jian Zhou; Zhenlong Wei; Xiaoni Ma; Huiping Ma; Cory J Xian; Jufang Wang; Keming Chen
Journal:  J Biol Chem       Date:  2017-10-31       Impact factor: 5.157

Review 3.  Critical molecular switches involved in BMP-2-induced osteogenic differentiation of mesenchymal cells.

Authors:  Hyun-Mo Ryoo; Mi-Hye Lee; Youn-Jeong Kim
Journal:  Gene       Date:  2005-11-28       Impact factor: 3.688

4.  Symptomatic ectopic bone formation after off-label use of recombinant human bone morphogenetic protein-2 in transforaminal lumbar interbody fusion.

Authors:  Nan-Fu Chen; Zachary A Smith; Eric Stiner; Sean Armin; Hormoz Sheikh; Larry T Khoo
Journal:  J Neurosurg Spine       Date:  2010-01

5.  Content Determination of Active Component in Huangqi Yinyanghuo Group and Its Effects on hTERT and Bcl-2 Protein in Osteosarcoma.

Authors:  Ying Tan; Lei Tan; Shuai Huang; Junfan Lu; Longtan Yu
Journal:  J Anal Methods Chem       Date:  2014-10-13       Impact factor: 2.193

6.  Adaptor protein CrkII negatively regulates osteoblast differentiation and function through JNK phosphorylation.

Authors:  Jung Ha Kim; Kabsun Kim; Inyoung Kim; Semun Seong; Kwang-Il Nam; Kyung Keun Kim; Nacksung Kim
Journal:  Exp Mol Med       Date:  2019-09-25       Impact factor: 8.718

7.  Icariin regulates miR-23a-3p-mediated osteogenic differentiation of BMSCs via BMP-2/Smad5/Runx2 and WNT/β-catenin pathways in osteonecrosis of the femoral head.

Authors:  Xiao-Yun Zhang; Hua-Nan Li; Feng Chen; Yue-Ping Chen; Yuan Chai; Jian-Zhao Liao; Bin Gan; Ding-Peng Chen; Song Li; Yong-Qian Liu
Journal:  Saudi Pharm J       Date:  2021-10-29       Impact factor: 4.330

8.  Icariin-Loaded Hydrogel Regulates Bone Marrow Mesenchymal Stem Cell Chondrogenic Differentiation and Promotes Cartilage Repair in Osteoarthritis.

Authors:  Yuefeng Zhu; Le Ye; Xiaoxi Cai; Zuhao Li; Yongqian Fan; Fengjian Yang
Journal:  Front Bioeng Biotechnol       Date:  2022-02-09

9.  A Novel, Noncanonical BMP Pathway Modulates Synapse Maturation at the Drosophila Neuromuscular Junction.

Authors:  Mikolaj J Sulkowski; Tae Hee Han; Carolyn Ott; Qi Wang; Esther M Verheyen; Jennifer Lippincott-Schwartz; Mihaela Serpe
Journal:  PLoS Genet       Date:  2016-01-27       Impact factor: 5.917

Review 10.  TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease.

Authors:  Mengrui Wu; Guiqian Chen; Yi-Ping Li
Journal:  Bone Res       Date:  2016-04-26       Impact factor: 13.567

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.