| Literature DB >> 35832480 |
Junpeng Feng1,2, Xuebing Wang1,3, Yingli Lu1, Chang Yu1, Xinyan Wang1, Lianshi Feng1.
Abstract
In recent years, obesity has become an important risk factor for human health; how to effectively prevent and reduce the occurrence of obesity is a hot research topic in recent years. Hypoxic training effectively improves abnormalities of lipid metabolism caused by obesity. The current study explored the effects of hypoxic training on BAIBA secretion and white fat browning in inguinal fat in obese rats. Analyses were performed by HPLC/MS/MS-MS/MS, RT-q PCR and western blot methods. The findings showed that 4 weeks of hypoxic training reduced body weight, Lee's index, and regulated blood lipid profile in obese rats. Hypoxic training up-regulated BAIBA concentration in gastrocnemius muscle and circulation in obese rats. Hypoxic training significantly upregulated expression of PPARα and UCP-1 in inguinal fat of obese rats and increased white fat browning. The findings showed that BAIBA may involve in improveing blood lipid profile and white fat browning by modulating PPARα and UCP-1 expression.Entities:
Keywords: BAIBA; browning; hypoxic training; lipid metabolism; obesity
Year: 2022 PMID: 35832480 PMCID: PMC9272788 DOI: 10.3389/fphys.2022.882151
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Real-time PCR Primer sequences.
| Primer Name | Primer Sequence | Product Length/Bp |
|---|---|---|
|
| TCCCTCAGGATTGGCCTCTAC | 101 |
|
| GTCATCAAGCCAGCCGAGAT | |
|
| TCCACGAAGCCTACCTGAAGAACT | 187 |
|
| AATCGGACCTCTGCCTCCTTGTT | |
|
| GAAGTGTGACGTTGACATCCG | 282 |
|
| GCCTAGAAGCATTTGCGGTG |
Dilution ratio of primary antibodies.
| Primary antibody | Antibody Manufacturers | Catalog No. | Dilution ratio |
|---|---|---|---|
| PPAR-α | Abcam | ab24509 | 1:3,000 |
| PGC-1 α | Abcam | ab54481 | 1:1,000 |
| UCP-1 | Abcam | ab23841 | 1:1,000 |
| β-Actin | CST | 4,967 | 1:1,000 |
FIGURE 1Changes in Body Weight and Lee’s Index of Rats after Normoxic and Hypoxic Exercise. n = 8, # p < 0.05 vs. NC group; ##p < 0.01 vs. NC group; +p < 0.05 vs. ONC group; ++p < 0.01 vs. ONC group; -p<0.05 vs. ONE group; --p<0.01 vs. ONE group; *p < 0.05 vs. OHC group; **p < 0.01 vs. OHC group; following tables same.
Changes in Blood Lipid levels in Rats after Normoxic and Hypoxic Exercise (n = 8).
| NC | NE | ONC | ONE | OHC | OHE | |
|---|---|---|---|---|---|---|
| TC (mmol/L) | 1.23 ± 0.25 | 0.88 ± 0.21## | 1.41 ± 0.17 | 0.97 ± 0.12++## | 1.30 ± 0.10 | 0.86 ± 0.23++**## |
| TG (mmol/L) | 0.27 ± 0.04 | 0.17 ± 0.03# | 0.47 ± 0.17## | 0.31 ± 0.03++ | 0.41 ± 0.11## | 0.25 ± 0.08++** |
| HDL (mmol/L) | 0.38 ± 0.04 | 0.41 ± 0.10 | 0.33 ± 0.05 | 0.38 ± 0.06 | 0.35 ± 0.05 | 0.46 ± 0.13++** |
| LDL (mmol/L) | 0.37 ± 0.10 | 0.30 ± 0.06# | 0.31 ± 0.02# | 0.27 ± 0.02++ | 0.28 ± 0.05 | 0.23 ± 0.03##++--** |
n = 8, #p < 0.05 vs. NC group; ##p < 0.01 vs. NC group; +p < 0.05 vs. ONC group; ++p < 0.01 vs. ONC group; -p < 0.05 vs. ONE group; --p < 0.01 vs. ONE group; *p < 0.05 vs. OHC group; **p < 0.01 vs. OHC group; following tables same.
FIGURE 2mRNA expression levels of PGC-1α, PPAR α, and UCP-1 in inguinal fat of rats. mRNA expression levels of PPARα and UCP-1 in inguinal adipose of rats of NC, NE, ONC, ONE, OHC, and OHE groups were determined using β-Actin as a reference gene. n = 8, # p < 0.05 vs. NC group; ## p < 0.01 vs. NC group; +p < 0.05 vs. ONC group; ++p < 0.01 vs. ONC group; -p < 0.05 vs. ONE group; --p < 0.01 vs. ONE group; *p < 0.05 vs. OHC group; **p < 0.01 vs. OHC group; following tables same.
FIGURE 3Protein expression levels of UCP-1 (A), PPAR α (B) and PGC-1α (C) in inguinal adipose of rats after normoxic and hypoxic exercise. Protein expression levels of PPARα and UCP-1 in inguinal adipose of rats in NC, NE, ONC, ONE, OHC, and OHE groups were expressed as relative levels based on the expression level of β-Actin (D). n = 8, # p < 0.05 vs. NC group; ## p < 0.01 vs. NC group; +p < 0.05 vs. ONC group; ++p < 0.01 vs. ONC group; -p < 0.05 vs. ONE group; --p < 0.01 vs. ONE group; *p < 0.05 vs. OHC group; **p < 0.01 vs. OHC group; following tables same.
Levels of BAIBA in Gastrocnemius Muscle and Blood of Rats after normoxic and hypoxic exercise (n = 8).
| NC | NE | ONC | ONE | OHC | OHE | |
|---|---|---|---|---|---|---|
| Muscle BAIBA(ng/mg) | 1.12 ± 0.04 | 6.47 ± 1.24## | 1.68 ± 1.02 | 7.07 ± 2.50 ++## | 2.89 ± 1.13 | 3.72 ± 1.12++-- |
| Blood BAIBA(ng/mL) | 23.28 ± 7.50 | 37.94 ± 8.49## | 35.56 ± 12.17 | 44.28 ± 22.17## | 14.09 ± 2.72++ | 39.15 ± 16.89** |
n = 8, #p < 0.05 vs. NC group; ##p < 0.01 vs. NC group; +p < 0.05 vs. ONC group; ++p < 0.01 vs. ONC group; -p < 0.05 vs. ONE group; --p < 0.01 vs. ONE group; *p < 0.05 vs. OHC group; **p < 0.01 vs. OHC group; following tables same.
Relationship between BAIBA and blood lipid, and browning index in Rats (n = 8).
| Muscle BAIBA | Blood BAIBA | ||
|---|---|---|---|
| Correlation Value ( | Correlation Value ( | ||
| TC | Pearson correlation | −0.478 (0.006)%% | −0.422 (0.016) % |
| TG | −0.313 (0.082) | −0.277 (0.124) | |
| HDL | 0.167 (0.360) | 0.139 (0.448) | |
| LDL | −0.338 (0.059) | −0.194 (0.288) | |
| PPARα mRNA | 0.791 (0.000) %% | 0.355 (0.046) % | |
| UCP-1 mRNA | 0.568 (0.001) %% | 0.550 (0.001) %% | |
| PGC-1α protein | 0.372 (0.187) | 0.164 (0.273) | |
| PPARα protein | 0.425 (0.015) % | 0.339 (0.058) | |
| UCP-1 protein | 0.246 (0.175) | 0.279 (0.122) |
%significant difference p < 0.05, %%significant difference p < 0.01.