| Literature DB >> 35822031 |
Mayu Inokuchi1, Yoko Yamaguchi2, Benjamin P Moorman3, Andre P Seale3,4.
Abstract
Euryhaline teleost fish are characterized by their ability to tolerate a wide range of environmental salinities by modifying the function of osmoregulatory cells and tissues. In this study, we experimentally addressed the age-related decline in the sensitivity of osmoregulatory transcripts associated with a transfer from fresh water (FW) to seawater (SW) in the euryhaline teleost, Mozambique tilapia, Oreochromis mossambicus. The survival rates of tilapia transferred from FW to SW were inversely related with age, indicating that older fish require a longer acclimation period during a salinity challenge. The relative expression of Na+/K+/2Cl- cotransporter 1a (nkcc1a), which plays an important role in hyposmoregulation, was significantly upregulated in younger fish after SW transfer, indicating a clear effect of age in the sensitivity of branchial ionocytes. Prolactin (Prl), a hyperosmoregulatory hormone in O. mossambicus, is released in direct response to a fall in extracellular osmolality. Prl cells of 4-month-old tilapia were sensitive to hyposmotic stimuli, while those of >24-month-old fish did not respond. Moreover, the responsiveness of branchial ionocytes to Prl was more robust in younger fish. Taken together, multiple aspects of osmotic homeostasis, from osmoreception to hormonal and environmental control of osmoregulation, declined in older fish. This decline appears to undermine the ability of older fish to survive transfer to hyperosmotic environments.Entities:
Keywords: age; fish; gill; osmoreception; osmoregulation; prolactin; salinity tolerance; survival
Year: 2021 PMID: 35822031 PMCID: PMC9261306 DOI: 10.3389/fragi.2021.675395
Source DB: PubMed Journal: Front Aging ISSN: 2673-6217
Primer sets used in real-time qPCR.
| Gene name | GenBank accession no | Primer sequence 5′ to 3′ | Efficiency | |
|---|---|---|---|---|
| NKAα1a | LC556924 | Forward | AACTGATTTGGTCCCTGCAA | 114.2% |
| Reverse | ATGCATTTCTGGGCTGTCTC | |||
| NKCC1a | AY513737 | Forward | GGAGGCAAGATCAACAGGATTG | 92.8% |
| Reverse | AATGTCCGAAAAGTCTATCCTGAACT | |||
| NCC2 | EU518934 | Forward | CCGAAAGGCACCCTAATGG | 113.5% |
| Reverse | CTACACTTGCACCAGAAGTGACAA | |||
| EF1α | LC556928 | Forward | AGCAAGTACTACGTGACCATCATTG | 84.6% |
| Reverse | AGTCAGCCTGGGAGGTACCA |
FIGURE 1(A) Effects of age on percent survival of tilapia transferred from FW to SW (n = 20). Adult tilapia aged 4 months (B) or >24 months (C) were then kept in FW (filled circles) or transitioned from FW to SW over a 1-h (open squares), 3-h (filled triangles), and 12-h (open diamonds) period (n = 10).
FIGURE 2Effects of age and salinity on the expression of branchial mRNA expression of (A) ncc2, (B) nkcc1a, and (C) nkaα1a. White and black bars represent means from 4-mo to >24-mo fish. Fish were sampled at the end of the 24-h period following transfer to FW or a 12-h transition to SW. Means not sharing the same letter are significantly different at p < 0.05.
FIGURE 3(A) Effects of age (4 months vs >24 months) on hyposmotically induced Prl188 release from dispersed Prl cells of FW-acclimated fish incubated for 1 h. Black and white bars represent hyperosmotic (355 mOsm/kg) and hyposmotic (300 mOsm/kg) media, respectively. * significantly different from each other at p < 0.05. (B) Effect of oPrl on the expression of ncc2 in gill filaments of FW-acclimated tilapia incubated overnight. Open and filled circles represent means from 4- to >24-mo-old fish, respectively. *, ** significantly different between ages at p < 0.05 and p < 0.01, respectively; ††, ††† significantly different from 0 dose at p < 0.01 and p < 0.001, respectively.