| Literature DB >> 35821997 |
Steve D Guzman1, Jennifer Judge1, Shahjahan M Shigdar2, Thomas A Paul3, Carol S Davis1, Peter C Macpherson1, James F Markworth1, Holly Van Remmen4,5,6, Arlan Richardson6,7, Anne McArdle2, Susan V Brooks1,3.
Abstract
Aging results in the progressive accumulation of senescent cells in tissues that display loss of proliferative capacity and acquire a senescence-associated secretory phenotype (SASP). The tumor suppressor, p16 INK4A , which slows the progression of the cell cycle, is highly expressed in most senescent cells and the removal of p16-expressing cells has been shown to be beneficial to tissue health. Although much work has been done to assess the effects of cellular senescence on a variety of different organs, little is known about the effects on skeletal muscle and whether reducing cellular senescent load would provide a therapeutic benefit against age-related muscle functional decline. We hypothesized that whole-body ablation of p16-expressing cells in the advanced stages of life in mice would provide a therapeutic benefit to skeletal muscle structure and function. Treatment of transgenic p16-3MR mice with ganciclovir (GCV) from 20 to 26 months of age resulted in reduced p16 mRNA levels in muscle. At 26 months of age, the masses of tibialis anterior, extensor digitorum longus, gastrocnemius and quadriceps muscles were significantly larger in GCV-treated compared with vehicle-treated mice, but this effect was limited to male mice. Maximum isometric force for gastrocnemius muscles was also greater in GCV-treated male mice compared to controls. Further examination of muscles of GCV- and vehicle-treated mice showed fewer CD68-positive macrophages present in the tissue following GCV treatment. Plasma cytokine levels were also measured with only one, granulocyte colony stimulating factor (G-CSF), out of 22 chemokines analyzed was reduced in GCV-treated mice. These findings show that genetic ablation of p16+ senescent cells provides moderate and sex specific therapeutic benefits to muscle mass and function.Entities:
Keywords: aging; inflammation; muscle atrophy; sarcopenia; senescence
Year: 2022 PMID: 35821997 PMCID: PMC9261355 DOI: 10.3389/fragi.2021.821904
Source DB: PubMed Journal: Front Aging ISSN: 2673-6217
FIGURE 1GCV+ muscle showed reduced expression of p16 . (A) p16-3MR mice were given ganciclovir (GCV+) or vehicle (GCV−) via intraperitoneal (IP) injection at 20-month of age for 10 days over 2 weeks. Additional 5-day treatments were administered over 1 week in five subsequent months until sacrifice after 6 months. Tissue was harvested at 26-month of age. (B) p16 mRNA relative to 18s mRNA was reduced nearly ∼50% in gastrocnemius muscles of GCV+ mice compared to saline treated controls (GCV−). Bars show the mean ± SEM of three to five mice per group with dots representing data from each individual mouse. Blue and red data points represent male and female mice, respectively. ** Denotes p < .001 between groups for each tissue by one-way ANOVA with Tukey post-hoc test.
Real-time PCR primers.
|
| ||
| Gene | Sequence (5′-3′) | |
| TNF-α | Forward | ATGGCCTCCCTCTCATCAGT |
| Reverse | TGGTTTGCTACGACGTGGG | |
| IL-6 | Forward | TCCGGAGAGGAGACTTCACA |
| Reverse | TTGCCATTGCACAACTCTTTTCT | |
| AChRα | Forward | GCCATTAACCCGGAAAGTGAC |
| Reverse | CCCCGCTCTCCATGAAGTT | |
| MuSK | Forward | ACCGTCATCATCTCCATCGTGT |
| Reverse | CTCAATGTTATTCCTCGGATACTCC | |
| 18s | Forward | GCTTGCTCGCGCTTCCTTACCT |
| Reverse | TCACTGTACCGGCCGTGCGTA | |
|
| ||
| Gene | Assay ID | |
| p16(INK4a) | Mm00494449_m1 (Thermo Fisher Scientific) | |
FIGURE 2Hind limb muscle masses were preserved in male GCV+ mice. Masses are shown for extensor digitorum longus (EDL), tibialis anterior (TA), gastrocnemius (GTN) and quadriceps (Quad) muscles in milligrams for male ganciclovir treated (GCV+) and vehicle treated (GCV−) mice. Bars show the mean ± SEM of four mice per group with dots representing data from each individual male mouse. *Denotes p < .05 between groups by two-tailed unpaired t-test.
FIGURE 3Gastrocnemius (GTN) muscles from male ganciclovir treated (GCV−) mice generated higher forces than muscles from vehicle treated (GCV−) mice. Data are shown for maximum isometric tetanic force (Po) generated by extensor digitorum longus (EDL), soleus and GTN muscles expressed in millinewtons (mN). EDL and soleus muscles were evaluated in vitro, while GTN muscles were evaluated in situ using both direct muscle stimulation and nerve stimulation. Bars show the mean ± SEM of four mice per group with dots representing data from each individual male mouse. *Denotes p < .05 and ** denotes p < .01 between groups by two-tailed unpaired t-test.
FIGURE 4CD68-positive but not Pax7-positive cells were reduced in GCV+ mice. (A) Representative images are shown for cross sections of extensor digitorum longus (EDL) muscles stained with an antibody to the macrophage marker CD68 (red) as well as wheat germ agglutinin (WGA, white) and DAPI (blue). (B) Data showing counts of intramuscular CD68-positive cells are shown for cross sections from ganciclovir (GCV+) and vehicle treated (GCV−) mice. (C) Representative images are shown for cross sections of soleus muscles stained with an antibody to the satellite cell marker Pax7 (green) as well as laminin (red) and DAPI (blue). White arrows indicate Pax7-positive cells that overlap with DAPI and are between sarcolemma and basal lamina of muscle fibers. (D) Data showing counts of intramuscular Pax7-positive cells are shown for cross sections from ganciclovir (GCV+) and vehicle treated (GCV−) mice. For both CD68 and Pax7, cell counts are expressed either relative the area analyzed (mm2) or by the number of muscle fibers in the sections (%). Bars show the mean ± SEM of five to eight mice per group with dots representing data from each individual mouse. Blue and red data points represent male and female mice, respectively. *Denotes p < .05 between groups by two-tailed unpaired t-test. Scale bar = 50 μm.
FIGURE 5Plasma inflammatory factors and skeletal muscle cytokine mRNA expression were largely unaffected with p16-positive cell deletion. (A) Plasma protein levels (pg/ml) for 22 inflammatory mediators are shown for saline treated controls (GCV−), combined male and female GCV treated mice, GCV+ (all), male GCV treated mice, GCV+ (Male), and female GCV treated mice, GCV+(Female). (B) TNFα and IL-6 mRNA expression relative to 18s mRNA in gastrocnemius (GTN) muscles were not significantly different in young, GCV−, and GCV+ mice. Bars show the mean ± SEM of three to eight mice per group with dots representing data from each individual mouse. *Denotes p < .05 between groups by one-way ANOVA.