Literature DB >> 35819943

Different phylotypes of Cutibacterium acnes cause different modic changes in intervertebral disc degeneration.

Weibin Lan1, Xiaomeng Wang1, Xuezhao Tu1, Xiunian Hu2, Haichuan Lu1.   

Abstract

BACKGROUND: The contribution of Cutibacterium acnes (C. acnes) infection to intervertebral disc degeneration (IDD) and the antibiotic therapy has evoked several controversies in recent years. While some microbiology studies report bacterial disc infection within IDD patients, others attribute the positive results to contamination during prolonged cultures. In addition to the clinical controversy, little was known about the mechanism of C. acnes-caused Modic changes (MCs) if C. acnes was the pathogenic factor.
OBJECTIVES: This study aimed to investigate the inflammatory mechanism of MCs induced by different phylotypes of C. acnes in patients with IDD.
METHODS: Specimens from sixty patients undergoing microdiscectomy for disc herniation were included, C. acnes were identified by anaerobic culture, followed by biochemical and PCR-based methods. The identified species of C. acnes were respectively inoculated into the intervertebral discs of rabbits. MRI and histological change were observed. Additionally, we detected MMP expression in the rabbit model using reverse transcription-quantitative polymerase chain reaction (RT-qPCR).
RESULTS: Of the 60 cases, 18 (30%) specimens were positive for C. acnes, and we identified 4 of 6 defined phylogroups: IA, IB, II and III. The rabbits that received Type IB or II strains of C. acnes showed significantly decreased T1WI and higher T2WI at eighth weeks, while strain III C. acnes resulted in hypointense signals on both T1WI and T2WI. Histological examination results showed that all of the three types of C. acnes could cause disc degeneration and endplates rupture. Moreover, endplate degeneration induced by type IB or II strains of C. acnes is related with MMP13 expression. Meanwhile, strain III C. acnes might upregulated the level of MMP3.
CONCLUSION: This study suggested that C. acnes is widespread in herniated disc tissues. Different types of C. acnes could induce different MCs by increasing MMP expression.

Entities:  

Mesh:

Year:  2022        PMID: 35819943      PMCID: PMC9275720          DOI: 10.1371/journal.pone.0270982

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Intervertebral disc degeneration (IDD) and the subsequent appearance of Modic changes (MCs) in or near the vertebral endplates are usually associated with low back pain (LBP). Epidemiological studies suggested that latent infection of the low-virulent anaerobic bacteria, especially Cutibacterium acnes (C. acnes), a common skin commensal which was formerly called Propionibacterium acnes (P. acnes), was a possible cause of IDD, MCs, sciatica and low back pain [1-3]. This raised interesting therapeutic propositions, and supported the use of antibiotics in the treatment of LBP. Previous studies have demonstrated that the prevalence of C. acnes in intervertebral disc ranged from 13% to 44%, which is supported by the isolation of this bacterial species from surgical specimens of herniated discs [3-5]. Moreover, the histological identification of C. acnes in the intervertebral discs from patients with IDD has provided evidence of its infection, rather than microbiologic contamination [5, 6]. According to other researchers’ reports, C. acnes is composed of a number of distinct evolutionary lineages, designated types IA, IB, II, and III, based on single locus phylotyping [7, 8]. Based on new technologies such as Multilocus Sequence Typing (MLST) and whole genome sequencing [9], this classification has been extended to IA1, IA2, IB, IC, II, and III types. Furthermore, several previous studies have suggested that these phylogroups may have different pathogenicity traits and may be related to various clinical disease states [10-12]. Nevertheless, little was known about the differences of pathological roles of each subtype of C. acnes infected in the intervertebral discs. Early cartilage endplate degeneration could induce extracellular matrix (ECM) degradation and release of matrix metalloproteinases (MMPs). Thus changes in MMPs are important features of endplate degeneration. It has been reported MMP-13 and MMP1 are associated with MCs and endplate degeneration which caused by C.acnes infection in animal models [13, 14]. However, the relationship between different types of C.acnes and MMPs remains to be further investigated. The objectives of the present study were to characterize the prevalence of phylogroups of C. acnes in resected disc tissues of patients with lumbar disc herniation, and to compare the pathological changes when inoculated different types of C. acnes into the discs of New Zealand white rabbits.

Materials and methods

Study subjects and sample collection

A total of 60 patients who underwent lumbar microdiscectomy between January 2019 and November 2019 at The First Hospital of Longyan (Fujian Province, China) were included and consented for participation in this study. All the patients were diagnosed with lumbar disc herniation by MRI. Patients were excluded if they had been received antibiotic treatment within two weeks of this study start date. Other exclusion criteria were: immunocompromised; traumatic hernia; inflammatory or rheumatic diseases; the presence of unexplained radiological masses. Among included patients, the average age was 54.30 ± 13.48 years, and 33 patients were male and 27 patients were female. All disc samples were obtained using standard operating practices. The specimens were placed aseptically in separate closed sterile glass vials to minimize the possibility of contamination after resection. The size of the excised disc specimen was 3x4x5 mm ~ 10x4x5 mm. This study was approved by the Clinical Ethics Committee of Longyan First Hospital.

Microbial culture

The tissue samples were cut into smaller pieces, and the tissue broken apart and ground up, using an separately packaged sterile scalpel. The samples were first spread on the surface of a Columbia blood agar (CBA) plate (Oxoid, UK), and then collectively embedded in the center of the plate. For each individual tissue sample, one piece of tissue was used for aerobic incubation and the other piece is used for anaerobic culture. The Anaerobic Work Station Concept 400 (Ruskinn Technology) was used for culture; inoculated plates were cultured for 14 days at 37˚C, 80% N2, 10% CO2, and 10% H2. The same amount of homogenate was also cultured on Columbia Blood Agar (Oxoid) for seven days at 37˚C to detect aerobic bacteria.

Molecular and phenotypic identification

The colonies were subcultured on CBA plates and cultured under aerobic or anaerobic conditions at 37°C for 24h, then Gram’s staining was performed. The presumptive C. acnes isolates were identified using the Rapid ID 32A kit (bioMerieux, France). Staphylococcus spp. were identified by standard biochemical tests, latex agglutination for clumping factor/protein A was used to distinguish S. aureus from coagulase negative staphylococci. After purification of genomic DNA using the QIAamp DNA mini kit (Qiagen), C. acnes was confirmed by 16S rRNA-based PCR using the primers and conditions previously described [15].

recA sequence analysis and mAb typing

C. acnes could be divided into phylogroups IA, IA/IB, IC, II, or III according to Nucleotide sequence analysis of the recA housekeeping gene [7, 8]. The recA locus was amplified with the previously described primers PAR-1 and PAR-2 for the downstream and upstream flanking sequences of the recA open reading frame, respectively, and the 1201 bp amplicon was generated. According to the manufacturer’s instructions, the sequencing process was carried out using the ABI PRISM ready reaction terminator cycle sequencing kits (version 1.1; Perkin-Elmer Applied Biosystems). The samples were analysed on capillary electrophoresis system of ABI PRISM 3100 genetic analyzer (Perkin-Elmer Applied Biosystems). Monoclonal antibody(mAb) typing was performed by immunofluorescence microscopy (IFM) as previously described [7]. C. acnes isolates were detected with the mouse mAbs QUBPa1 and QUBPa2. Slides were observed by Leitz Dialux 20 fluorescence microscope.

Animals

A total of nine New Zealand White rabbits, with an age of about 3 months and an average weight of 2 kg, were used in this study. Spinal deformity was excluded by X-ray examination. Rabbits were randomly divided into three groups with 3 animals in each group (Table 1). The study was approved by the institutional review committee and ethics committee of the authors’ institution. Rabbits were fed with regular water and food and housed for at least one week before experimentation.
Table 1

Animal group information.

Inoculated bacterial typeNumbersInoculated segmentBacterial load
Group IThe type IB strain of C. acnes isolated from patient3L5-L6C. acnes suspension in sterilized TSB without bovine serum at 1×107 CFU/mL with 25μL
L4-L5Sterilized TSB without bovine serum with 25μL
Group IIThe type II strain of C. acnes isolated from patient3L5-L6C. acnes suspension in sterilized TSB without bovine serum at 1×107 CFU/mL with 25μL
L4-L5Sterilized TSB without bovine serum with 25μL
Group IIIThe type III strain of C. acnes isolated from patient3L5-L6C. acnes suspension in sterilized TSB without bovine serum at 1×107 CFU/mL with 25μL
L4-L5Sterilized TSB without bovine serum with 25μL

Preparation of bacterial inoculum

We identified three strains of C. acnes isolated from patients with IDD. C. acnes harvested from each colony on the agar were washed using TSB without bovine serum for 3 times, then the concentration was adjusted to 1× 107 CFU (Colony Forming Units) per mL by using the plate count method.

Percutaneous puncture

All rabbits were anesthetized using pentobarbital sodium for 15 mg/kg via auricular vein and were placed in right lateral position. All operations were performed under sterile conditions. Under the fluoroscopic guidance, percutaneous puncture was performed, starting from the right side of animal, into subchondral bone superior to the L4-L5 and L5-L6 discs. A 22-gauge needle was used with a so-called screw-in method to penetrate cortical bone. The needle tip entered the subchondral bone at a distance of 1 to 2 mm from the adjacent endplate. When the needle tip arrived at the correct location, 25 μL C. acnes suspension was inoculated slowly into the nucleus pulposus at the L5-L6 segment and 25 μL of bovine serum-free sterilized TSB was injected into the L4-L5 segment as internal control (Table 1). After the procedure, rabbits were housed individually with free access to food and water and no antibiotics were used before and after the operation.

MRI examination

Lumbar MRI scans were performed before and every two weeks after the surgery until the eighth week. Animals were fasted on a platform after deep anaesthesia with pentobarbital sodium and scanned with knee coil using the 3.0-T GE HDxt Signa/MRI system (GE Corporation, Connecticut, USA). The scanning parameters: T1W TE/TR, 8.4 ms/540 ms, T2W TE/TR, 48.2 ms/2000 ms, slice thickness, 3 mm, and Field of View, 20 × 20. The MRI scans were evaluated by an experienced radiologist and a spinal surgeon. Besides, we also performed quantitative measurements of the end-plate region signal intensity. ImageJ software (version 1.51; National Institutes of Health), was used to measure signal intensity of the superior subchondral bone region adjacent to L4-L5, and L5-L6 on T2 and T1-weighted central images, as previously reported [16].

Histological examination

At the eighth week, the animals were euthanized with an overdose of pentobarbital sodium (40 mg/kg) for histological examination. After the intervertebral discs with endplates were fixed in 4% formaldehyde for 24 hours, it was decalcified with Ethylenediaminetetraacetic Acid for three months, processed with routine paraffin embedding, and sectioned at 5 μm. Hematoxylin and eosin (HE) staining was conducted and photographed under the magnification of 100x.

Cocultures of cartilaginous endplate and C. acnes

Following the sacrifice of 3-months-old rabbits under pentobarbital sodium anesthesia, the cartilaginous endplate tissues of rabbits were harvested and cultured. The tissues were carefully excised from intervertebral discs and rinsed in PBS, then were cut into pieces quickly. Endplate cells were obtained by digestion with type II collagenase for two hours at 37°C. The supernatant was centrifuged at 900 rpm for 5 min and the cellular pellet was then resuspended by using Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS). The cells were cultured in condition of 37°C, 5%CO2. Three strains of C. acnes were cultured independently in broth for 2 weeks, the supernatant was harvested by centrifugation at 6000 rpm for 10 min, filtered by using a 0.22-μm filter and then stored at 4°C. The supernatant of C. acnes was added to the endplate cell culture in a 6-well plate.

RT-qPCR

The endplate cells were cultured with three phylotypes of C. acnes respectively for 24h. They were lysed and total RNA was extracted by using Ultrapure RNA kit. Reverse transcription was then performed using HiFiScript cDNA Synthesis kit (CW2569, CWBIO, China). The qPCR was performed to evaluate genes of MMP13 and MMP1, using the UltraSYBR Mixture (CW0957, CWBIO, China). The following primers were included: MMP13 (Forward: AAAGGAGGAGGTTCCTAGAGG; Reverse: ATACCCAATAAAATGTTGGAT), MMP1(Forward: TAGCTGGTTCAACTGCAGGAA; Reverse: AGGCTCACAGAATACATTGGG). Amplification was performed at 95°C for 10 min (pre-incubation), 40 cycles of 95°C for 15s, 60°C for 60s, 72°C for 20 s (amplification), 95°C for 15s and 60°C for 60s (melting curves), and 4°C for 5 min (cooling).

Statistical analysis

Analysis of variance (ANOVA) or Student’s t-test using SPSS 19.0 was performed to compare mean data among groups, the differences between each group were analyzed with the least significant difference. Statistical significance was taken as P < 0.05.

Results

Bacterial culture analysis

The results of culture of surgically resected disc specimens showed that bacterial growth was observed for 21 of 60 patients (35%), the other 39 cases had no colonies formation. Of the 60 samples, 18 (30%) specimens were positive for C. acnes, and colony numbers of each sample ranged from 1–100 CFU. Coagulase-negative Staphylococcus spp was present in 3 cases (5%). For specimens with growth of C. acnes, a majority (16/18, 88.9%) yielded only this organism, and there were no additional bacterial species present. Only two patients had tissue samples containing both C. acnes and coagulase-negative staphylococci. Aerobic culture did not lead to any additional significant findings.

Phylotyping of C. acnes isolates from intervertebral discs

By using recA sequence analysis, it was possible to accurately divide C. acnes isolates into types IA (IA1 and IA2), IB, IC, II, or III. Of the 18 strains of C. acnes, 39% were found to belong to the type II lineage, identified in 7 cases, 33% were type IA1, present in 6 cases, 22% type III in 4 cases, and 6% type IB in 1 case. No isolates were found to belong to the type IC lineage.

Signal changes in MRI at intervertebral discs in three groups of rabbits

It has been reported that inoculation of caudal discs with strain IA of C. acnes increased intervertebral disc degeneration in rat models [17]. Thus we dismissed this strain of C. acnes in this paper, the other three phylotypes of C. acnes suspension: type IB, type II and type III, were inoculated into three groups of rabbits, as shown in Table 1. No abnormal signals were found before the operation. Nevertheless, intervertebral discs injected with C. acnes showed significant signal changes since the second week in all three groups (Fig 1). Interestingly, hypointense signals at T1WI and hyperintense signals at T2WI in the cartilage endplates area appeared in Group I and Group II, and there were no significant differences in the signal changes between these two groups. While signals on both T1WI and T2WI were hypointense compared to TSB-injected discs in the rabbits of Group I. Furthermore, on T2WI, the normal signal of nucleus pulposus shifted into hypointense signal, indicating the disc degeneration for all three groups. All of these abnormal signals remained constant until the euthanasia of the rabbits at the eighth week, and the volume of signal changes had increased from the second week to the eighth week (Table 2). In contrast, the TSB inoculated control discs were normal during the observation. According to the Pfirrmann classification system, the severity of the intervertebral disc degeneration in the three groups of animals was V or IV grades.
Fig 1

Signal changes were observed at the second week after the inoculation of the isolated three types strain of C. acnes.

Before the surgery, there were no abnormal signals at T1WI and T2WI. An obvious hypointense signal was observed on T1WI and the hyperintense signal was found on T2WI at the C. acnes-inoculated segment (L5-L6, indicated by a white filled arrow) in Group I and Group II. The hypointense signal changes were also observed on T1WI in the rabbits of Group III, while the signal intensity of T2WI decreased in this group animals. No significant signal changes were observed at the internal control segment of L4-L5 in all groups (indicated by a thin arrow).

Table 2

Signal intensity (adjusted by cerebrospinal fluid) of endplate region.

After injection*
Before injection2w4w8wP value
T1WI
TSB2.61±0.482.67±0.292.28±0.142.54±0.680.306
Group I2.72±0.371.60±0.721.21±0.851.03±0.370.034
Group II2.68±0.231.75±0.641.34±0.570.82±0.370.028
Group III2.83±0.181.52±0.481.13±0.220.76±0.450.019
T2WI
TSB0.41±0.100.48±0.060.54±0.070.68±0.090.487
Group I0.39±0.090.43±0.040.52±0.060.76±0.100.039
Group II0.42±0.100.48±0.070.54±0.080.79±0.040.025
Group III0.43±0.080.41±0.090.38±0.100.31±0.050.043

*The values are given as the mean and the standard deviation.

Signal changes were observed at the second week after the inoculation of the isolated three types strain of C. acnes.

Before the surgery, there were no abnormal signals at T1WI and T2WI. An obvious hypointense signal was observed on T1WI and the hyperintense signal was found on T2WI at the C. acnes-inoculated segment (L5-L6, indicated by a white filled arrow) in Group I and Group II. The hypointense signal changes were also observed on T1WI in the rabbits of Group III, while the signal intensity of T2WI decreased in this group animals. No significant signal changes were observed at the internal control segment of L4-L5 in all groups (indicated by a thin arrow). *The values are given as the mean and the standard deviation.

Intervertebral disc degeneration and endplates rupture after inoculation of C. acnes

In contrast with the control group, the segments injected with C. acnes showed moderate degeneration with the disappearance of nucleus pulposus and disorganizing of annulus fibrosus at the eighth week in all three rabbits of Group II, while Group I and Group III animals presented disorganized collagen fibers in discs infected with C. acnes. The area occupied by the nucleus pulposus was decreased and had an irregular shape. There was endplate rupture at C. acnes treated segments in two of Group I animals, one of Group III rabbits and all of three rabbits in Group II. By contrast, TSB injected intervertebral discs had a normal structure, in which nucleus pulposus was enclosed with normal annulus fibrosus (Fig 2). Histological analysis suggested that there was no indication of inflammatory cells in three groups of animals.
Fig 2

Typical histological images of slices from the three groups of rabbits at eighth weeks after the inoculation.

The intervertebral discs from the TSB-inoculated control segment (L4-L5) had distinct nucleus pulposus and normal arranged annulus fibrosus. The segment of three types of C. acnes inoculated intervertebral discs (L5-L6) was demonstrated as disappearance of nucleus pulposus, endplates fracture (black rectangle), disorganized annulus fibrosus, and partly cartilage proliferation.

Typical histological images of slices from the three groups of rabbits at eighth weeks after the inoculation.

The intervertebral discs from the TSB-inoculated control segment (L4-L5) had distinct nucleus pulposus and normal arranged annulus fibrosus. The segment of three types of C. acnes inoculated intervertebral discs (L5-L6) was demonstrated as disappearance of nucleus pulposus, endplates fracture (black rectangle), disorganized annulus fibrosus, and partly cartilage proliferation.

MMP expression in endplate chondrocytes induced by different phylotypes of C. acnes

To further investigate the mechanism of Modic changes induced by C. acnes, we tested the relationship between MMP and C. acnes by stimulating endplate chondrocytes with C. acnes supernatant. The results showed that the gene expression of MMP13 was increased in type IB and II strains of C. acnes supernatant group, while the level of MMP1 in endplate chondrocytes was significantly increased in type III strain of C. acnes group compared with controls. All the increase tended to be greater when the concentrations of C. acnes was higher (Fig 3). Interestingly, type IB and II strains of C. acnes did not effect the expression level of MMP1 in endplate cells, and coculturing with type III strain of C. acnes supernatant seems enhance the gene expression of MMP13 but not significantly.
Fig 3

RT-qPCR analysis of MMP13 and MMP1 mRNA expression in endplate chondrocytes cocultured with 2% or 4% supernatant of different phylotypes of C.acnes.

*p < 0.05, **p < 0.01.

RT-qPCR analysis of MMP13 and MMP1 mRNA expression in endplate chondrocytes cocultured with 2% or 4% supernatant of different phylotypes of C.acnes.

*p < 0.05, **p < 0.01.

Discussion

As a member of normal skin and oral microbiota, C. acnes may be present in a low number in the blood as a consequence of tooth brushing and endodontic therapy. Since the avascular nuclear disc might provide an ideal anaerobic environment for infection of C. acnes [18], it has been proposed that C. acnes may cause chronic and mild infection in herniated intervertebral discs. In the present study, C. acnes was shown to colonize non-pyogenic disc, with a prevalence rate of 30%, consistent with the previously reported a prevalence of 32% [5, 3, 19]. Some researchers believed that C. acnes isolated from intervertebral discs may reflect intraoperative contamination or be pollutants during bacterial culture [20]. However, we believed that most of the bacteria isolated from discs were likely to represent the original growth due to the following reasons. First of all, more than ten research groups have independently proved the presence of C. acnes in microbial culture by molecular analysis and histological examination [1, 5, 21]. Therefore, it seems unreasonable to attribute all isolated C. acnes as pollutants. Secondly, two histological reports [5, 6] revealed that C. acnes grew in clusters within the tissues rather than on the surface of tissues, indicating the growth of bacterium inside intervertebral discs. Overall, the latent residence of C. acnes in intervertebral discs should not be ignored, and its role in the pathophysiology of IDD and herniation requires more comprehensive analysis. The main pathological function of latent infection of C. acnes was the induction of IDD. It has been proved that inoculation with C. acnes could initiate or accelerate IDD in animal models [22, 23]. However, little is known about the relationship between different phylotypes of C. acnes and modic change. Although Modic changes are thought to be associated with disc degeneration, not all Modic changes are found clinically together with degeneration. Interestingly, a previous study showed that the typical strain of C. acnes (ATCC 6919) caused Modic type-II changes in rabbit models [24]. It is possible that the early effects of C. acnes are so weak for MRI to fully reflect, because a previous research has suggested that MRI may miss Modic change-like pathology [25]. The results of our study indicated that infection of different phylotypes of C. acnes might be capable of producing discal damage differently. We speculated one of the possible reasons may be the different virulence of various species of C. acnes, some of them are more virulent, but others may be less virulent [26], thus probably leading to different pathological change and dispersion of MRI image. Therefore, we supported that the intervertebral discs infected by C. acnes would have more chance to result in latent low-grade chronic inflammation [3], which is then represented as Modic changes and disc degeneration rather than the pyogenic discitis. Besides, some limitations still exist in this experiment. The quadrupedal rabbit model might not completely represent biomechanical effects found in humans. The etiology of different types of Modic changes may be continuous. Further studies of primates over a long-term period and more intervening factors would help to deepen our understanding of the occurrence and development of Modic changes. In addition, the sample sizes of both clinical research and animal experiment were relatively small. We agree that even after stringent preoperative skin disinfection, contamination of biopsy samples with skin microbiota cannot be fully excluded. In the part of clinical sample collection, some muscle and ligaments around the disc should be obtained as control tissue in consideration of rigorousness. Further comprehensive investigations about this issue both in vivo and in vitro should be conducted in the future. In general, we demonstrated a high prevalence of C. acnes in intervertebral disc tissue of patients undergoing microdiscectomy. Moreover, according to Koch’s Postulates, C. acnes might be a potential cause of disc degeneration and Modic changes when inoculated into intervertebral discs. Different strains of C. acnes could probably lead to different dispersion of MRI image. In clinical practice, the difference between different types of modic changes still needs to be further investigated. (XLSX) Click here for additional data file. 22 Mar 2022
PONE-D-21-33277
Different phylotypes of Propionibacterium acnes cause different modic changes in intervertebral disc degeneration
PLOS ONE Dear Dr. Lu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The authors are called upon to respond to all reviewers' concerns and queries. Specifically, please clarify the categorization of groups and the denomination utilized for the bacterial strain. The MMP related data needs to be further proccessed to incorporate to article. The details regarding experimental proccess need to be clarified at points as well as the utilization of the patient data. Likewise, the disccussion part needs to be edited and specific claims less decisively expressed.
Please submit your revised manuscript by Apr 28 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Dragana Nikitovic, Ph.D Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: This work was supported by Fujian Province Natural Science Foundation of China (2019J01051964) and Startup Fund for scientific research, Fujian Medical University. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: This work was supported by Province Natural Science Foundation of China (2019J01051964) and Startup Fund for scientific research, Fujian Medical University.The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Dear Authors Manuscript PONE-D-21-33277 Thanks for your submission and the chance to review your work. It’s an interesting study, using multiple methods: retrieval and culture from surgical intervertebral disc samples from 60 patients undergoing diskectomy; there were P Acnes growth in 18 cases. Different P. Acnes species were identified, and three types were inoculated to three groups of rabbits on the L5-6 disc, having as a control L4-5. Animal spines were imaged q2 weeks via MR and analyzed histologically at 8 weeks. Additionally, discal cells were co-cultured with different types of P Acnes in different concentrations, and MMP expression was measured. It's an overall well-designed study, interesting and bridging a gap in the field’s knowledge, and have a relevant result (differential effect on the discs of the animal model and culture depending on the P Acnes strain). However, I disagree that different biomechanical environment of the animal model, justifies proposing primates as the next step. MMP part should be strengthen if it is to be included and reported as results. I have several observations that may improve the paper: - P Acnes name has been changed to Cutibacterium acnes, I’d suggest you to at least mention that change either on introduction and/or discussion. - Animal groups nomination is confusing in the manuscript, sometimes using Groups I, II, III and other times you refer to the bacteria type. Revise. - How did you measure discal MR signal intensity? Describe your method and the software utilized. - Page 7, initial paragraph, I guess it should say “Since the avascular…”, not vascular. - The role of MMP in the pathogenesis of the model is not well introduced, It’s methods for detection are not described and yet, is one of the main results. Please, amend. What’s the hypothetical contribution of MMP to the pathogenesis of MCs? - Why did you use type IB P Acnes instead of IA1? (actually, you had more cases of IA1). Please, clarify. - On the part of the discussion, I would moderate the conclusion about type 1-2 P. Acnes producing Modic 1 changes and type 3, Modic 3, since this study has limited numbers of experimental animals for each type. And outside this study, there is no evidence to support such affirmation. I would rephrase this part more on the side of data suggesting that different strains of P Acnes are capable of producing discal damage differently. - A section of study limitations is missing: low number of subjects (for a prevalence study), not having negative control cultures (i.e. from surgical field), low number of animals per group and thus, using solely the results of the current study, one cannot rule out that P Acnes might be a contaminant. As noted on the discussion as reasons, none of them are contained in this paper. Please add a limitation section on your discussion. Best, Reviewer #2: This is well-written well-conducted research in a topic of interest to the spine professionals since colonization by C. acnes in degenerated humans discs is still a question pending an answer. There is both literature supporting this hypothesis and literature going against it. There is even research with molecular analysis of bacterial DNA (NGS) that did not locate C. acnes within the microbiome of degenerated human discs. In this report, authors isolate C.acnes from human discs after surgical excision and culturing with a 30% positivity rate. Apparently there was no control tissue in this point of the research to determine rate of positive disc colonization by C. acnes, and not contamination during the process. Otherwise, there is controversy as well in controlling culture with surrounding disc tissues (muscles, ligament) since the defect of the annulus could be a way to bacterial spread of the C. acnes outside the disc. Although this is a weakness to determine rate of true disc colonization, the isolated phylotypes of C. acnes were inoculated into rats intervertebral disc and it does not seem to invalidate this process. Methods says that patients' pain were accessed but there is no report in the results section about it. If this is not an analyzed measure, it should not be in methods. How long were patients followed after primary surgery? Percutaneous puncture: it is not clear if after percutaneous puncture of the disc, the rats were opened with a surgical approach to the vertebra and then bone wax was placed at the punctures’ holes. It says that the rat was sutured layer by layer giving the impression that a surgical approach was performed. This is a good paper considering that is original and brings a new point to the whole C.acnes disc degeneration discussion. It does not prove or gives an answer to the whole C. acnes presence in the disc or its relationship to disc degeneration, but it is original in stating the effects of the C. acnes and some of their different phylotypes in normal disc of rats. Rats spine different biomechanics is a limitation and has been brought into the limitations paragraph. It is expected that inoculation of any bacteria into a normal disc would lead to infection and inflammatory response and knowing how different types of C. acnes reacts to disc degeneration and its endplates is a good and new data, although the main question on the presence of C. acnes in the human disc remains unanswered. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Mauricio Campos-Daziano MD Reviewer #2: Yes: Nelson Astur [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
15 May 2022 Thank you for your letter and the reviwers’ comments concerning our manuscript. We are happy to improve the manuscript based on these helpful and valuable comments from you. We have revised the manuscript according to the editor’s advice, hoping to meet the submission requirements. Revisions in the text are shown using red highlight for additions, and strikethrough font for deletions. The responses to the reviewer's comments are presented in the response file. Submitted filename: Response to reviewers.docx Click here for additional data file. 22 Jun 2022 Different phylotypes of Cutibacterium acnes cause different modic changes in intervertebral disc degeneration PONE-D-21-33277R1 Dear Dr. Lu, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Dragana Nikitovic, Ph.D Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Thanks for accepting our suggestions to make your manuscript more publishable. I think it would constitute a good piece for bridging the knowledge gaps remaining the C acnes hypothesis. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Mauricio Campos Daziano ********** 4 Jul 2022 PONE-D-21-33277R1 Different phylotypes of Cutibacterium acnes cause different modic changes in intervertebral disc degeneration Dear Dr. Lu: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Dragana Nikitovic Academic Editor PLOS ONE
  26 in total

1.  Propionibacterium acnes and lipopolysaccharide induce the expression of antimicrobial peptides and proinflammatory cytokines/chemokines in human sebocytes.

Authors:  István Nagy; Andor Pivarcsi; Kornélia Kis; Andrea Koreck; László Bodai; Andrew McDowell; Holger Seltmann; Sheila Patrick; Christos C Zouboulis; Lajos Kemény
Journal:  Microbes Infect       Date:  2006-05-19       Impact factor: 2.700

2.  Propionibacterium acnes types I and II represent phylogenetically distinct groups.

Authors:  Andrew McDowell; Susanna Valanne; Gordon Ramage; Michael M Tunney; Josephine V Glenn; Gregory C McLorinan; Ajay Bhatia; Jean-Francois Maisonneuve; Michael Lodes; David H Persing; Sheila Patrick
Journal:  J Clin Microbiol       Date:  2005-01       Impact factor: 5.948

3.  A new phylogenetic group of Propionibacterium acnes.

Authors:  Andrew McDowell; Alexandra L Perry; Peter A Lambert; Sheila Patrick
Journal:  J Med Microbiol       Date:  2008-02       Impact factor: 2.472

4.  Relationship between annular tear and presence of Propionibacterium acnes in lumbar intervertebral disc.

Authors:  Zezhu Zhou; Zhe Chen; Yuehuan Zheng; Peng Cao; Yu Liang; Xingkai Zhang; Wenjian Wu; Jiaqi Xiao; Shijing Qiu
Journal:  Eur Spine J       Date:  2015-08-19       Impact factor: 3.134

5.  Association Between Lumbar Disc Degeneration and Propionibacterium acnes Infection: Clinical Research and Preliminary Exploration of Animal Experiment.

Authors:  Bo Li; Zhe Dong; Yongchao Wu; Ji Zeng; Qixin Zheng; Baojun Xiao; Xianyi Cai; Zhiyong Xiao
Journal:  Spine (Phila Pa 1976)       Date:  2016-07-01       Impact factor: 3.468

6.  Antibiotic treatment in patients with chronic low back pain and vertebral bone edema (Modic type 1 changes): a double-blind randomized clinical controlled trial of efficacy.

Authors:  Hanne B Albert; Joan S Sorensen; Berit Schiott Christensen; Claus Manniche
Journal:  Eur Spine J       Date:  2013-02-13       Impact factor: 3.134

7.  An evaluation of PCR primer sets used for detection of Propionibacterium acnes in prostate tissue samples.

Authors:  Karen S Sfanos; William B Isaacs
Journal:  Prostate       Date:  2008-10-01       Impact factor: 4.104

8.  Histological Identification of Propionibacterium acnes in Nonpyogenic Degenerated Intervertebral Discs.

Authors:  Ye Yuan; Zezhu Zhou; Yucheng Jiao; Changwei Li; Yuehuan Zheng; Yazhou Lin; Jiaqi Xiao; Zhe Chen; Peng Cao
Journal:  Biomed Res Int       Date:  2017-03-19       Impact factor: 3.411

9.  Propionibacterium acnes induces cartilaginous endplate degeneration by promoting MIF expression via the NF-κB pathway.

Authors:  Ying Zhang; Yuting Wang; Yanyan Yuan; Yeting Lin; Binbin Lin; Haiyan Zhou
Journal:  J Orthop Surg Res       Date:  2020-06-09       Impact factor: 2.359

10.  Propionibacterium acnes, Coagulase-Negative Staphylococcus, and the "Biofilm-like" Intervertebral Disc.

Authors:  Michael F Coscia; Gerald A Denys; Matthew F Wack
Journal:  Spine (Phila Pa 1976)       Date:  2016-12-15       Impact factor: 3.241

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.